ID: 1160816327

View in Genome Browser
Species Human (GRCh38)
Location 19:1037615-1037637
Sequence TCCTCTCCAGGTGGGCATGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 246}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160816315_1160816327 13 Left 1160816315 19:1037579-1037601 CCTCTTCTCTCCACCATGACCTG 0: 1
1: 0
2: 2
3: 35
4: 430
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816318_1160816327 -6 Left 1160816318 19:1037598-1037620 CCTGCTCCACCCCTCCTTCCTCT 0: 1
1: 1
2: 9
3: 230
4: 1771
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816316_1160816327 3 Left 1160816316 19:1037589-1037611 CCACCATGACCTGCTCCACCCCT 0: 1
1: 0
2: 3
3: 38
4: 561
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816314_1160816327 14 Left 1160816314 19:1037578-1037600 CCCTCTTCTCTCCACCATGACCT 0: 1
1: 0
2: 7
3: 46
4: 517
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816311_1160816327 27 Left 1160816311 19:1037565-1037587 CCCAGTGAAGGTCCCCTCTTCTC 0: 1
1: 0
2: 1
3: 20
4: 169
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816313_1160816327 15 Left 1160816313 19:1037577-1037599 CCCCTCTTCTCTCCACCATGACC 0: 1
1: 1
2: 5
3: 51
4: 553
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816317_1160816327 0 Left 1160816317 19:1037592-1037614 CCATGACCTGCTCCACCCCTCCT 0: 1
1: 1
2: 7
3: 75
4: 685
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246
1160816312_1160816327 26 Left 1160816312 19:1037566-1037588 CCAGTGAAGGTCCCCTCTTCTCT 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1160816327 19:1037615-1037637 TCCTCTCCAGGTGGGCATGACGG 0: 1
1: 0
2: 1
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160816327 Original CRISPR TCCTCTCCAGGTGGGCATGA CGG Exonic