ID: 1160817205

View in Genome Browser
Species Human (GRCh38)
Location 19:1041695-1041717
Sequence ATGTATTGGCGGCCTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160817205_1160817215 19 Left 1160817205 19:1041695-1041717 CCTTCACCAGGCCGCCAATACAT 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1160817215 19:1041737-1041759 CATCGCTGGAGGCATGCAAGCGG 0: 1
1: 0
2: 1
3: 14
4: 106
1160817205_1160817212 5 Left 1160817205 19:1041695-1041717 CCTTCACCAGGCCGCCAATACAT 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1160817212 19:1041723-1041745 GGGAGTGAGCTCTCCATCGCTGG 0: 1
1: 0
2: 4
3: 46
4: 194
1160817205_1160817217 26 Left 1160817205 19:1041695-1041717 CCTTCACCAGGCCGCCAATACAT 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1160817217 19:1041744-1041766 GGAGGCATGCAAGCGGTGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 128
1160817205_1160817216 25 Left 1160817205 19:1041695-1041717 CCTTCACCAGGCCGCCAATACAT 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1160817216 19:1041743-1041765 TGGAGGCATGCAAGCGGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 111
1160817205_1160817213 8 Left 1160817205 19:1041695-1041717 CCTTCACCAGGCCGCCAATACAT 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1160817213 19:1041726-1041748 AGTGAGCTCTCCATCGCTGGAGG 0: 1
1: 2
2: 16
3: 74
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160817205 Original CRISPR ATGTATTGGCGGCCTGGTGA AGG (reversed) Intronic
900160059 1:1219210-1219232 ATGTATTGGGGGTCTGGGGCAGG - Intronic
900813611 1:4826631-4826653 ATGTAGTGGTGGCCCTGTGAGGG + Intergenic
907458580 1:54591983-54592005 ATGTATTGAATGCCTGGTAAGGG - Intronic
917631619 1:176896513-176896535 AAAGATTGGGGGCCTGGTGAGGG - Intronic
921421482 1:214953997-214954019 ATATATTGGAGCCCTGGAGAAGG - Intergenic
923808475 1:237287000-237287022 TTGTAGTGGTGGCTTGGTGATGG + Intronic
924302144 1:242650674-242650696 TTGTAGTGGTGGCCTGGTAATGG + Intergenic
1063092553 10:2880078-2880100 AGGTGTTGGGGGCCTGGGGAAGG - Intergenic
1069270764 10:66524495-66524517 ATCTGTTGGCTGGCTGGTGATGG + Intronic
1074820929 10:117177876-117177898 ATGTATGGGAGGCATGGTGCTGG + Intergenic
1083430314 11:62610980-62611002 ATTTCTTCGCGGCCTGGTGGGGG + Exonic
1087658426 11:100955579-100955601 ATGTATTGGCTGCCTGCTCTGGG + Intronic
1089295844 11:117467200-117467222 ATATATTGGCGGCGGGGGGAGGG - Intronic
1094179107 12:27572289-27572311 CTGTACTGGCAGCCTAGTGAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098729443 12:74014690-74014712 ATGTACAGGCAGCATGGTGATGG + Intergenic
1102012880 12:109629585-109629607 ATCTATTGGCTTCCTGGAGATGG + Intergenic
1105018696 12:132802207-132802229 ATGTATTGATGAGCTGGTGAAGG - Intronic
1108419712 13:50235541-50235563 ATGTATGGGTGGCATGTTGAAGG + Intronic
1113303913 13:109055515-109055537 ATATATTGGGGTCCTGGAGATGG + Exonic
1119158304 14:72431741-72431763 ATCCCTTGGGGGCCTGGTGATGG - Intronic
1146961475 17:36984005-36984027 ATGTATTGGTGTCCTACTGATGG + Intronic
1147229842 17:39009582-39009604 AAGTGTTGGCTGCCTGGTAATGG - Intergenic
1147476300 17:40714893-40714915 ATGTATTTGGGGAATGGTGATGG - Intergenic
1149187215 17:54013236-54013258 CTGTTTTGACAGCCTGGTGAGGG - Intergenic
1153880368 18:9417105-9417127 ATGTAATGGAGGCCCTGTGATGG - Intergenic
1160174649 18:76583066-76583088 GTGTACTGGCGTCCTGGAGATGG - Intergenic
1160817205 19:1041695-1041717 ATGTATTGGCGGCCTGGTGAAGG - Intronic
1164678825 19:30120739-30120761 ATGTATGGGTGGCCTGAGGAGGG - Intergenic
928421969 2:31144362-31144384 ATGTTTTGGTGGGCTGGTGGTGG - Intronic
932758437 2:74424495-74424517 TTGTGTTGGCTGCCTGGTGTTGG + Intronic
936125919 2:109789160-109789182 CTGCAGTGGTGGCCTGGTGAAGG - Intergenic
936218774 2:110582308-110582330 CTGCAGTGGTGGCCTGGTGAAGG + Intergenic
1170278998 20:14625002-14625024 ATGGCTTGGCCGGCTGGTGAGGG + Intronic
1177852487 21:26365181-26365203 ATCTTATGGTGGCCTGGTGATGG + Intergenic
950713124 3:14828058-14828080 ATGTGTTGGCTAACTGGTGATGG + Intronic
955857336 3:63287245-63287267 ATGTTTTAGGGGCCTGGTGACGG + Intronic
968594244 4:1474155-1474177 ATGAAATGGTGCCCTGGTGATGG + Intergenic
979381921 4:120016893-120016915 TTGTATTGGTGGCTTGGTAATGG + Intergenic
982795636 4:159640518-159640540 ATGTATTGGAGGCTGGGAGAGGG + Intergenic
983238278 4:165204979-165205001 GTGTCTTGGCAGCCTAGTGAAGG - Intronic
983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG + Intergenic
989507840 5:42247897-42247919 CTGTATAGGAGGCATGGTGAGGG + Intergenic
994124288 5:96152278-96152300 ATGAACTGGTGGCCTAGTGAAGG + Intergenic
995141001 5:108735027-108735049 ATGAATTGCCGGCCGGGGGAGGG + Intergenic
998730200 5:145066862-145066884 ACCTATTGGCGTCCTGATGAAGG - Intergenic
999281265 5:150367731-150367753 TGGTATTGGCTGCCTGGTGCTGG - Intronic
1016745191 6:147572003-147572025 ATGTACTGATGGCCTGGTGGAGG - Intronic
1019775454 7:2909660-2909682 ATGTTTGGGCGGAATGGTGAGGG - Intronic
1035145112 7:156807198-156807220 ATGTATTGTCTGCCTGGTTTTGG + Intronic
1047412945 8:124639041-124639063 AGGTATTGGCGGCCTGGCCCAGG + Intronic
1048207276 8:132425161-132425183 ATGTATTGGCGTCCAGTTGGGGG - Intronic
1050832464 9:10030630-10030652 ATATATGAGGGGCCTGGTGATGG + Intronic
1052456662 9:28707750-28707772 ATTTATTGTCGGGGTGGTGAAGG + Intergenic
1053347762 9:37390431-37390453 ATGTCTTGGCTGACTGGTCATGG + Intergenic
1061653699 9:132070968-132070990 AGGTGTGGGAGGCCTGGTGAGGG + Intronic
1194621842 X:96182510-96182532 CAGGATTGGCTGCCTGGTGAGGG + Intergenic
1196456657 X:115895866-115895888 ATGTCTTGGGAGCCTGGTGGTGG - Intergenic