ID: 1160818977

View in Genome Browser
Species Human (GRCh38)
Location 19:1049354-1049376
Sequence AGTCCAGGCTGAGCCCCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160818977_1160818985 17 Left 1160818977 19:1049354-1049376 CCTGCGGGGGCTCAGCCTGGACT 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1160818985 19:1049394-1049416 ACCGCCTTCCTGGGCCACAACGG 0: 1
1: 2
2: 0
3: 13
4: 164
1160818977_1160818987 18 Left 1160818977 19:1049354-1049376 CCTGCGGGGGCTCAGCCTGGACT 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1160818987 19:1049395-1049417 CCGCCTTCCTGGGCCACAACGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1160818977_1160818990 23 Left 1160818977 19:1049354-1049376 CCTGCGGGGGCTCAGCCTGGACT 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1160818990 19:1049400-1049422 TTCCTGGGCCACAACGGGGCCGG 0: 1
1: 1
2: 3
3: 13
4: 139
1160818977_1160818988 19 Left 1160818977 19:1049354-1049376 CCTGCGGGGGCTCAGCCTGGACT 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1160818988 19:1049396-1049418 CGCCTTCCTGGGCCACAACGGGG 0: 1
1: 0
2: 1
3: 12
4: 104
1160818977_1160818983 8 Left 1160818977 19:1049354-1049376 CCTGCGGGGGCTCAGCCTGGACT 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1160818983 19:1049385-1049407 GGCCACATCACCGCCTTCCTGGG 0: 1
1: 0
2: 2
3: 12
4: 196
1160818977_1160818982 7 Left 1160818977 19:1049354-1049376 CCTGCGGGGGCTCAGCCTGGACT 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1160818982 19:1049384-1049406 GGGCCACATCACCGCCTTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160818977 Original CRISPR AGTCCAGGCTGAGCCCCCGC AGG (reversed) Exonic
900032077 1:379422-379444 AGGCCAGGCTCAGCCCCCAGTGG + Intergenic
900052626 1:607608-607630 AGGCCAGGCTCAGCCCCCAGTGG + Intergenic
901453505 1:9350479-9350501 AGTCCAGGCAGTGCCCTGGCCGG - Intronic
902219019 1:14953008-14953030 AGCCAAGACTGAGCCCCAGCTGG + Intronic
903006665 1:20303272-20303294 AGGCCTGGCTGAGCCCACACAGG + Intronic
903698971 1:25232265-25232287 TGCCCAGGCCGAGTCCCCGCCGG + Intronic
904208231 1:28868921-28868943 AGTCCAGGCTGGGCACCTGCTGG + Intergenic
904319024 1:29684575-29684597 AGTGCCGGCTGAGACCCTGCAGG - Intergenic
904613117 1:31735995-31736017 AGTGCAGTCTGAGCCCCAGACGG + Intronic
905370949 1:37482461-37482483 TGTCCAGGCTGGGCCCGTGCCGG - Exonic
905810903 1:40912455-40912477 TGCCCAGGCTGATGCCCCGCCGG + Intergenic
907382763 1:54104907-54104929 ACTTCAGGCTCAGCCCCCTCAGG + Intronic
907393537 1:54174310-54174332 AGTCCAGGCTGAGCCCCAGGAGG - Intronic
912587606 1:110780865-110780887 ACCCCAGTCTGTGCCCCCGCAGG - Intergenic
919832733 1:201553217-201553239 TATCCAGGCTGAGCCCTCCCTGG - Intergenic
923111205 1:230891734-230891756 AGGCCAGGCTGTGCCCTTGCAGG + Intergenic
1066047545 10:31606433-31606455 ACTCCAGTCTCAGCCCCCGCAGG - Intergenic
1067542502 10:47166145-47166167 CCTCCAGGCTGAGCCCCTGGGGG - Intergenic
1069849999 10:71398100-71398122 AAGCCAGGCAGAGTCCCCGCCGG - Intronic
1069928240 10:71865873-71865895 AGTCCAGGAACAGCTCCCGCTGG - Intergenic
1070751122 10:78964532-78964554 ATTTCTGGCTGGGCCCCCGCTGG + Intergenic
1071608627 10:87015962-87015984 AGGCAAGGCTGAGTCCCCGGAGG - Intergenic
1072803923 10:98412288-98412310 AGTCCTGGCTGAGCCCTCCTTGG + Intronic
1073340948 10:102744122-102744144 AGCCAGGGCTGAACCCCCGCAGG + Exonic
1074455576 10:113592749-113592771 AAGCCAGGCTGAGGCCCCTCCGG - Intronic
1074586095 10:114768574-114768596 ACTGCGGGCTGAGCCCCCTCAGG - Intergenic
1075412885 10:122242015-122242037 GGGCCGGCCTGAGCCCCCGCAGG - Intronic
1075923829 10:126235124-126235146 AGTCCAGGCCAGGCCACCGCAGG + Intronic
1077358298 11:2128596-2128618 GGTACAGGCTGAGCCCTGGCAGG + Intergenic
1078168561 11:8911289-8911311 AGTCCTGGCTGGGCTCCCGCTGG + Intronic
1079296764 11:19241432-19241454 AGTCCCGGCTCAGCCCCCGCCGG - Exonic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1084531935 11:69732516-69732538 AGGCAGGGCTGAGCCCCTGCGGG + Intergenic
1084561680 11:69909135-69909157 AATCATGGCTGCGCCCCCGCCGG + Intergenic
1085048598 11:73367894-73367916 AGACAAGGCAGAGCCCACGCAGG - Exonic
1085052386 11:73386516-73386538 AGCCCAGACTGAGCCCCCACTGG - Intronic
1088172817 11:107017791-107017813 AGTCCAGGTTGACCCGCCTCCGG + Exonic
1088536402 11:110866627-110866649 TGTCCAGGCTGAGGCCACTCAGG + Intergenic
1090420501 11:126572077-126572099 GGACCAGGCTGAGCCTCCCCAGG - Intronic
1091228763 11:133974348-133974370 AGGCCAGGTTGAGCCCCGCCCGG + Intergenic
1091581515 12:1793348-1793370 GGTCCAAGCTGAGCTCACGCTGG + Exonic
1091791560 12:3274929-3274951 AGTCCAGACTGCGCCCCCGTAGG + Intronic
1092487415 12:8914588-8914610 AGGCCTGGCTGAGCCGCGGCCGG + Exonic
1096946757 12:55415053-55415075 AGGCCTGGCTGAGCCGCGGCCGG - Intergenic
1099033659 12:77559786-77559808 AGTTGAGGCTGAGCCCAGGCAGG + Intergenic
1103794587 12:123494583-123494605 AGACCAGCCTGAGCTCCCGTGGG + Intronic
1103927807 12:124433439-124433461 TGGACAGGCTGAGGCCCCGCTGG - Intronic
1104040959 12:125130315-125130337 AGTGGAGGCTGAGCCACCCCTGG - Intronic
1106411996 13:29517054-29517076 AGGCCCGGCTGAGCCCACGCAGG + Intronic
1110595668 13:77318075-77318097 AGTCCTGGGTGAGACCCTGCTGG + Intronic
1111858304 13:93668725-93668747 AGGCAAGGCTGAGCTCCCTCAGG - Intronic
1113917433 13:113882943-113882965 TGTGCAGGCAGAGCCCCCTCCGG - Intergenic
1114117631 14:19638169-19638191 AGCCAGGGCTGAGCCTCCGCAGG + Intergenic
1114549141 14:23523227-23523249 AGCTCTGGCTCAGCCCCCGCTGG - Exonic
1119429611 14:74557898-74557920 CTTCCAGGCTGAGCTCCCACTGG - Intronic
1119774273 14:77238874-77238896 AGTCCAGGGAGAGCCACCCCGGG - Intronic
1119898831 14:78243153-78243175 GGCCCAGGCAGAGCCCCAGCAGG - Intronic
1123457463 15:20439101-20439123 AGTCCACGCTGAGGCGGCGCAGG - Intergenic
1123660595 15:22561258-22561280 AGTCCACGCTGAGGCGGCGCAGG + Intergenic
1123964014 15:25438265-25438287 AGTCCTGGCTGAGCGACGGCGGG - Intronic
1124263609 15:28214250-28214272 AGTCCACGCTGAGGCGGCGCAGG - Exonic
1125385200 15:39129743-39129765 AGTGCTGGCTGAGGCCCTGCAGG - Intergenic
1126110673 15:45172941-45172963 AGGGAAGGCTGAGCCCCCGTGGG + Intronic
1129243094 15:74263225-74263247 TGTCCAGCCTGAGCTCCCCCAGG - Intronic
1129605972 15:77025208-77025230 AGTCCAGGCTGCCTCCCGGCGGG - Intronic
1129674208 15:77623571-77623593 CGCCCAGGCTGAGCTCCTGCAGG + Intronic
1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG + Intergenic
1132864139 16:2085360-2085382 ACTGCAGGCTGAGGCCCAGCTGG - Intronic
1133046112 16:3089261-3089283 GGAGCAGGCCGAGCCCCCGCAGG - Exonic
1133168059 16:3962950-3962972 TGTGCAGGGGGAGCCCCCGCGGG + Exonic
1133271232 16:4611765-4611787 TGTCCTGGCTGAGGCCCTGCAGG + Intronic
1133274128 16:4626287-4626309 AGGCCAGGCTGACCCGCTGCTGG - Intronic
1134089536 16:11384221-11384243 AGGCCAGGCTGAGCTCCTCCAGG + Exonic
1134914079 16:18054542-18054564 TGGCCATGCTGAGCTCCCGCAGG - Intergenic
1137380625 16:47995641-47995663 AGTACAGGCTCAGCTCCTGCTGG - Intergenic
1141144344 16:81518453-81518475 AGTCCAGCCTGGACCCCTGCAGG - Intronic
1142059440 16:88020018-88020040 GGTCCAGGATGGGCGCCCGCTGG - Intronic
1142135609 16:88450658-88450680 TGTCCAGGCTGAGCCCACCTAGG - Intergenic
1142759949 17:2036324-2036346 AGAGCAGGCTGGGCCCCGGCCGG + Intronic
1144835494 17:18154615-18154637 AGTCCAGCCTGGGTCCCAGCTGG + Intronic
1145312343 17:21707551-21707573 AGTCCAGGGCAAGCCCCAGCTGG - Intergenic
1145774836 17:27520694-27520716 AGGCCAGGCTGTGCCCGCCCAGG + Intronic
1147611426 17:41803817-41803839 GTTCCAGGCTGAGCCCTTGCTGG + Intronic
1148245998 17:46031223-46031245 AGTTCAGGATGAGACCCTGCTGG - Exonic
1148553806 17:48565865-48565887 AGTCAAGGCTGAGCCCAAGGAGG - Intronic
1151305553 17:73260848-73260870 AGGCCAGGCAGAGCCCCTGCTGG + Intronic
1151589254 17:75032723-75032745 AGGCAAGGCTGAGCCCCGGGCGG + Intronic
1151719838 17:75848765-75848787 AGTGCAGGCCCAGCCCCCGCAGG - Intronic
1151882964 17:76905895-76905917 TCTCCAGGCTGGGCCCCAGCAGG - Intronic
1151987944 17:77556128-77556150 AACCCAGGCTGAGACCCCACAGG + Intergenic
1151990389 17:77570678-77570700 TGTCCAGGCTGAGCTCAGGCTGG - Intergenic
1152252307 17:79218508-79218530 AGGACAGGCAGAGCCCCTGCTGG + Intronic
1152748099 17:82050443-82050465 GGTCCAGGCTGGGCCGCCCCAGG + Exonic
1152947579 17:83206294-83206316 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1157534641 18:48449356-48449378 AGTCCAGGCTCTGCCCCAGAAGG - Intergenic
1160169172 18:76538645-76538667 ACTCCAGGCTGAGTCCCCAGGGG - Intergenic
1160818977 19:1049354-1049376 AGTCCAGGCTGAGCCCCCGCAGG - Exonic
1160917790 19:1506004-1506026 TGTCCTGGCTGAGCCCCTGCAGG - Exonic
1161980255 19:7626554-7626576 AGTCAAGGCTGTGCCCTTGCGGG - Intronic
1162027021 19:7900199-7900221 TGTGCAGGCTGAGCCTCTGCAGG - Exonic
1162701875 19:12522183-12522205 AGTTCAGGCTGTGGCCACGCTGG + Intronic
1163736351 19:18983601-18983623 AGTCCAGGGTGGGCACCCGGGGG - Intergenic
1163783251 19:19261469-19261491 CGGCCACGCTGCGCCCCCGCAGG + Exonic
1165160625 19:33813631-33813653 AGTGCAGCCTGAGCCCCCAACGG - Exonic
1165428330 19:35757578-35757600 AGTTCAGGCTGGCCCCCCGGGGG + Intronic
1166422719 19:42651352-42651374 CATGCAGGCTGAGCCCCTGCTGG - Intronic
1166446149 19:42858474-42858496 TGTGCTGGCTGAGCCCCTGCTGG + Intronic
1166449136 19:42882423-42882445 TGTGCTGGCTGAGCCCCTGCTGG + Intronic
1166483088 19:43189231-43189253 TGTGCTGGCTGAGCCCCTGCTGG + Intronic
1167155374 19:47735358-47735380 AGCCCAGGGTGAGCCCCAGCAGG + Intronic
1167339808 19:48908481-48908503 ATTCCAGGCTGACCCAGCGCCGG - Intronic
1167376314 19:49114291-49114313 TCTCCAGGCTGCGCCTCCGCAGG + Intergenic
1167632970 19:50637360-50637382 AGACCAGGATGAGTGCCCGCCGG + Exonic
926356899 2:12048759-12048781 AGTCCTCGCTGAGCCCTCACTGG - Intergenic
926621058 2:15047719-15047741 AGTGCAGGCTGGGCCCATGCAGG + Intergenic
932570085 2:72934009-72934031 AGTCCAGCTTGGGCCCACGCAGG - Exonic
936251784 2:110873347-110873369 AGTCCACACTGGGCCCCAGCTGG - Intronic
937694937 2:124798342-124798364 AGCCCAGGCTGAGACTCCGCTGG - Intronic
944318100 2:198305074-198305096 AGTAAAGGCTGAGCACCAGCAGG - Intronic
944397885 2:199290046-199290068 ACTGCAGCCTGAGCCCCTGCTGG + Intronic
947904433 2:233750195-233750217 AGTCCAGGCTGAGTCTCAGATGG + Intronic
948920846 2:241065211-241065233 AGACCCGGCTGAGCCGCCGACGG + Intronic
948961739 2:241344270-241344292 GCTCCAGGCTGAGCCACCCCTGG + Intronic
949014384 2:241701545-241701567 AGGCCGGGCTGAGGCCCCGGGGG + Intergenic
1170154930 20:13260874-13260896 AGCCCTGGCTGAGCCTCCCCAGG - Intronic
1170665740 20:18384646-18384668 AGGCCAGGCTGGGCCCCTCCTGG + Intronic
1172061817 20:32191585-32191607 AGTTCAGTCTGAGCCCCTGATGG + Intergenic
1173245611 20:41335499-41335521 AGGCCAGGCTGAGCCACCTGGGG - Intergenic
1174385783 20:50187823-50187845 AGACCAGACTCAGCCCCAGCAGG - Intergenic
1175171581 20:57084973-57084995 AGGCCAGGCTGGGCCCCAACAGG + Intergenic
1178817178 21:35942156-35942178 AGGCCAGGCTGAGCCCACAAAGG + Intronic
1179795154 21:43778233-43778255 AGACCAGGCTGTGCCCTGGCAGG - Intergenic
1180465119 22:15603917-15603939 AGCCAGGGCTGAGCCTCCGCAGG - Intergenic
1181054792 22:20255740-20255762 ACTCCAGGCTGGGGCCCCTCAGG + Intronic
1181438708 22:22924830-22924852 AGTCCAGGCTGAGCCACTCCTGG + Intergenic
1181527515 22:23498735-23498757 AGTCCAGGCTGAGGCGAGGCAGG - Intergenic
1181566702 22:23743062-23743084 TGTCCAGGCTGAGTCACGGCTGG + Exonic
1183327280 22:37201139-37201161 AGTCCAGGCTTGGCCTCAGCAGG + Intergenic
1183633578 22:39047566-39047588 AGGCCAGGCTGAGGCCCAGCAGG - Intronic
1184298208 22:43539613-43539635 AGCCCTGGCTGAGCCACCCCAGG - Intronic
1184653311 22:45929137-45929159 AGGCAAGGCTGAGCCCTCGTGGG - Intronic
1184904664 22:47472895-47472917 AGCCCTGGCTGAGCCACAGCTGG + Intronic
950447318 3:13045763-13045785 AGGCCAGGCTCAGCCCCTACAGG + Intronic
950488733 3:13289383-13289405 ACTCCAGGTTGAGCCCTCACGGG - Intergenic
950962494 3:17120483-17120505 ATTCCACGCTGAGTCCCCGGAGG + Intergenic
953200763 3:40776805-40776827 GGTCCAGGCTGGGCCTCTGCAGG + Intergenic
954886730 3:53881761-53881783 GAGCCAGGCGGAGCCCCCGCAGG - Intronic
969259694 4:6025490-6025512 AGCCCAGGCTGAGGGCCCCCTGG - Intergenic
969876773 4:10141316-10141338 CTTCCAGGCTGAGCCCCTGGAGG + Intergenic
973719315 4:53707111-53707133 AGCCCAGTCTGAGACCCCACGGG - Intronic
973877024 4:55230169-55230191 TGACCAGGCTGAGCGCACGCTGG + Intergenic
986369916 5:7069591-7069613 AGTCTAGTCTGTGCCCCCACCGG - Intergenic
986736007 5:10667758-10667780 AGTCAAGGCTGAGGCCCCAGAGG - Intergenic
987379893 5:17275501-17275523 GGCCAAGGCTGAGCCCCCGAAGG + Exonic
997470635 5:134115148-134115170 AGGCCGAGGTGAGCCCCCGCCGG + Exonic
999665083 5:153904495-153904517 AATCCAGGCTGAGAACCAGCAGG + Intergenic
1002059230 5:176616659-176616681 AGGCCAGGCCGAGCCCAGGCAGG - Intergenic
1002374678 5:178780168-178780190 AGTGGAGGCTGAGCCACCCCTGG + Intergenic
1002632477 5:180590893-180590915 GGTCCAGGACGCGCCCCCGCGGG + Intronic
1002741743 5:181439446-181439468 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1003611532 6:7618790-7618812 AGTCCAGGCTGAGTTGCCCCCGG - Intergenic
1006151475 6:31992382-31992404 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006157776 6:32025120-32025142 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1007581553 6:42963173-42963195 AGTACAGGCTGTGCACCCCCAGG + Exonic
1007783905 6:44269690-44269712 AAGCCAGGCTGAGCCACTGCAGG - Intergenic
1011290595 6:85772762-85772784 AGTCCAACCTGAGCCCCCCTTGG - Intergenic
1011928078 6:92672950-92672972 AGTCCAGCCTGAGCACCCTTTGG + Intergenic
1019246883 6:170715203-170715225 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1019288040 7:233519-233541 CGTGCAGGCTGAGCTCCCCCGGG + Intronic
1019409463 7:900276-900298 AGGCCTGGCTTAGCCTCCGCAGG + Intronic
1019479678 7:1260672-1260694 AGGCCAGGCCGGGCACCCGCAGG - Intergenic
1019916438 7:4135861-4135883 GGACCAGGCTGAGCCCCCAATGG - Intronic
1022100972 7:27169036-27169058 AGTCCAGCCTGAGTCTCCACTGG + Intronic
1022476797 7:30716321-30716343 AGTGCAGGCTGAGCACTCACAGG + Intronic
1022946972 7:35295900-35295922 ACTGCAGGCTTCGCCCCCGCAGG + Intergenic
1024209463 7:47191169-47191191 AGTCCAGGCAGTGCCTCCGAGGG - Intergenic
1026807224 7:73435980-73436002 GGACCAGGCTGAGTCCCCACAGG + Exonic
1028983654 7:96993377-96993399 AGCCCAGGCTGTGCCGCGGCCGG + Intergenic
1029342108 7:99953611-99953633 AGTCAACGCTGAGCCTCAGCAGG + Intergenic
1029526032 7:101094590-101094612 CCTCCTGGCTGAGCCCCGGCCGG - Intergenic
1030062643 7:105635171-105635193 AAGCCAGGCTGAGAGCCCGCAGG - Intronic
1035501258 8:92750-92772 AGGCCAGGCTCAGCCCCCAGTGG + Intergenic
1036228918 8:6983069-6983091 AGTACAGACTGAGACCCTGCTGG - Intergenic
1036231370 8:7002174-7002196 AGTACAGACTGAGACCCTGCTGG - Intronic
1036691806 8:10949104-10949126 AGTCCGGGGTGAGCCCTGGCTGG + Intronic
1036786799 8:11693030-11693052 ACTCCACGCAGAGGCCCCGCAGG - Intronic
1043336374 8:79181391-79181413 AGTCCAGGCTGGGTCCCAGATGG - Intergenic
1043519909 8:81033837-81033859 GGCCTGGGCTGAGCCCCCGCTGG + Intronic
1048973129 8:139656294-139656316 GGCCCAGGCTGAGCCCCAGCTGG - Intronic
1049423813 8:142528424-142528446 AGTCCAGCCTGGGCCCCAACAGG - Intronic
1049738387 8:144222152-144222174 AGGCCAGGGTGAGCCCCAGACGG + Intronic
1053415561 9:37944951-37944973 TGGCCAGGCTGAGCCCCTGGAGG + Intronic
1055418271 9:76108142-76108164 AGTGCTGGCTCAGACCCCGCTGG + Intronic
1057517062 9:95730759-95730781 ATTACAGGCTGAGCCACTGCCGG - Intergenic
1057928219 9:99171189-99171211 AGGGCAGGCTGAGCCCCAGGGGG - Intergenic
1059446586 9:114342008-114342030 GGTCCAGGCTCAGCCACCTCTGG - Exonic
1061259165 9:129470131-129470153 AGTCCAGGCTGAGGCGAGGCAGG + Intergenic
1061289401 9:129642140-129642162 AGTCCAAGCCGCGCCCCCGCCGG + Exonic
1061864738 9:133486315-133486337 AGTCCAGGCTCTGCCCGTGCTGG + Intergenic
1061964328 9:134004573-134004595 AGTGGATGCTCAGCCCCCGCAGG + Intergenic
1062449264 9:136608687-136608709 AGGCCAGGCTGGGCCCCACCCGG - Intergenic
1062566360 9:137165639-137165661 AGTCCAGGATGGGGCCACGCTGG - Intronic
1203607655 Un_KI270748v1:70662-70684 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1186020685 X:5251597-5251619 AGTCCAGGTTGTGCCCCATCAGG + Intergenic
1189007978 X:37014820-37014842 TGGCCAGGCTGGGGCCCCGCAGG - Intergenic
1198077830 X:133211550-133211572 AGTGCAGGCTGAGCCACTGATGG - Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic