ID: 1160819696

View in Genome Browser
Species Human (GRCh38)
Location 19:1052305-1052327
Sequence GACCCAAGGCGGGTGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160819682_1160819696 12 Left 1160819682 19:1052270-1052292 CCAGGGCAGCAGAGTCGGTGAGG 0: 1
1: 0
2: 3
3: 24
4: 411
Right 1160819696 19:1052305-1052327 GACCCAAGGCGGGTGGGCAGTGG 0: 1
1: 0
2: 1
3: 30
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160819696 Original CRISPR GACCCAAGGCGGGTGGGCAG TGG Intronic
900947777 1:5841000-5841022 GACCCAGGGCCCATGGGCAGGGG - Intergenic
902028278 1:13401076-13401098 GTCGCAAGGCGGGAGTGCAGTGG + Intergenic
902154515 1:14473597-14473619 GTCCCAAGGCTGGAGTGCAGTGG - Intergenic
902164152 1:14556147-14556169 GTCCCCAGGCTGGAGGGCAGCGG + Intergenic
902884345 1:19393844-19393866 GACTCCTGGCGTGTGGGCAGGGG + Intronic
903006535 1:20302545-20302567 GACACAAGGCCTGAGGGCAGGGG + Intronic
903687776 1:25145002-25145024 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
904597548 1:31656385-31656407 GTCCCAAGGTGAGTGGGCACTGG - Exonic
904649918 1:31997743-31997765 CACCCAAGGCTGGTGTGCAGTGG + Intergenic
904988443 1:34572378-34572400 GACCCCAGGGGAGAGGGCAGTGG - Intergenic
905155769 1:35979322-35979344 GTCCCAAGGCTGGGGTGCAGCGG - Intronic
905246181 1:36615552-36615574 GCCCCAGGGCAGGAGGGCAGGGG + Intergenic
907318569 1:53588481-53588503 GACCCAGAGAGGGTGGTCAGGGG - Intronic
907589587 1:55653564-55653586 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
913639089 1:120793416-120793438 GACACAAGGCGAGTGTGCACAGG - Intergenic
915123400 1:153647086-153647108 GTCCCAAGGGAGATGGGCAGTGG + Intergenic
915227853 1:154424094-154424116 GGCCCCAGGCTGGGGGGCAGAGG - Intronic
917107413 1:171507021-171507043 GAATCAAGGGGGGTGGGGAGGGG - Intronic
920245026 1:204580925-204580947 GTCACATGGCTGGTGGGCAGTGG - Intergenic
921177720 1:212608575-212608597 GGCCGAAGGCGGGTGGAGAGAGG - Intronic
922211489 1:223490092-223490114 GACCCAGGCAGGGTGGGCAGGGG + Intergenic
922296420 1:224253691-224253713 GTCCCAAGGCTGGAGTGCAGTGG - Intronic
923597045 1:235368596-235368618 CGCCCAAGGCTGGTGTGCAGTGG + Intronic
924606829 1:245542480-245542502 GACCCAAGGAGGCAGGGAAGTGG + Intronic
1063390916 10:5649407-5649429 GACACAGGGCAGGGGGGCAGCGG - Intronic
1064194091 10:13231453-13231475 GACCCACAGTGGGTGGGAAGAGG - Intronic
1064339531 10:14473926-14473948 TACCCCAGGGGGGTGGGCAGAGG - Intergenic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1065955159 10:30687388-30687410 GACCCCAGGCTGTTGTGCAGGGG - Intergenic
1067198624 10:44145972-44145994 GACCCCAGGCTGAAGGGCAGTGG - Intergenic
1067495298 10:46756147-46756169 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1067582495 10:47454366-47454388 AACCCTAGGAGAGTGGGCAGGGG + Intergenic
1067599356 10:47584241-47584263 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1067949016 10:50710827-50710849 GACCCTAGGAGGGTGGGGATTGG + Intergenic
1069086896 10:64151125-64151147 TACCAGAGGCTGGTGGGCAGAGG - Intergenic
1069507003 10:69008334-69008356 GGCCCAAGGCTGGAGTGCAGTGG - Intronic
1069925490 10:71847506-71847528 GTCCCCAGGCTGGTGTGCAGTGG - Intronic
1070189790 10:74101444-74101466 CACCCCAGGCTGGAGGGCAGTGG - Intronic
1070570348 10:77636499-77636521 GACCCAAAGTGGGTGGCCTGGGG + Intronic
1070884334 10:79875833-79875855 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1071650889 10:87392133-87392155 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1072692707 10:97582430-97582452 CACCCATGGCGGGTGAGCAGCGG - Intronic
1072701387 10:97643983-97644005 GGGCCAAGGCGGGTTGGCTGTGG + Intronic
1072719554 10:97772079-97772101 GCTCCAAGGCGGGGAGGCAGTGG + Intergenic
1074293090 10:112156100-112156122 GACACAAGGCAAGTGGACAGAGG + Intronic
1074818820 10:117163999-117164021 GACCCCGGGCGGGGGGTCAGAGG + Intergenic
1075863327 10:125696381-125696403 AACCCAAAGTGGGTGGGCTGGGG - Intergenic
1076152976 10:128178232-128178254 GAGCCAAGGGGGGTGGTCACTGG + Intergenic
1076751911 10:132547517-132547539 GATGCCAGGCAGGTGGGCAGAGG - Intronic
1076851130 10:133093664-133093686 GACCCAAGGGGGCTGGGAAGGGG - Intronic
1077211973 11:1375336-1375358 GACCCAGCAAGGGTGGGCAGTGG + Intergenic
1077327613 11:1970515-1970537 GACCACGGGCGGGTGGGCGGAGG - Intronic
1077517161 11:3008940-3008962 CACCCATGGCGGGTGGGCTGGGG - Intronic
1077670112 11:4149558-4149580 CACCCAAGGCTGGAGAGCAGTGG - Intergenic
1078317140 11:10303510-10303532 GTGCAAAGGCGGCTGGGCAGTGG - Intergenic
1078432283 11:11297496-11297518 GACCCCAGGGAGGTGGGCAAGGG - Intronic
1079075937 11:17385738-17385760 GACCCTAGCGGGGAGGGCAGGGG - Intergenic
1079077420 11:17392856-17392878 GCCCTAAGTCTGGTGGGCAGGGG - Intergenic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1079921840 11:26442562-26442584 AACCCAAGGCTGGTGTGCAAGGG + Intronic
1080642289 11:34165005-34165027 GACCCAGGGAGGGGGAGCAGGGG - Intronic
1080883242 11:36342107-36342129 GACTCAAGGTGGGTCGGCAGAGG + Intronic
1081745517 11:45470008-45470030 GGCCCATGGCAGGTAGGCAGTGG + Intergenic
1082784884 11:57311370-57311392 GCCCCAAGGCGGGTTGGGGGCGG - Intronic
1083323931 11:61863816-61863838 GACCCACAGCGGGAGGGAAGTGG + Intronic
1083619129 11:64040388-64040410 GACCCCCGGCAGGAGGGCAGAGG + Intronic
1084015602 11:66378724-66378746 GTCCCAAGGCTGGAGTGCAGTGG - Intergenic
1084125223 11:67094961-67094983 GACCCAGGACGGGTGGGCAAAGG - Intergenic
1084433255 11:69123139-69123161 GACCCATGGCGGGGGGGCGGGGG + Intergenic
1084636926 11:70398836-70398858 GGCCCAAGGAGGCCGGGCAGGGG + Intronic
1085233866 11:74996112-74996134 TCCCCCAGGCGGGAGGGCAGTGG - Intronic
1085385681 11:76156980-76157002 GACCCCAGACCTGTGGGCAGAGG + Intergenic
1085543824 11:77298470-77298492 GACCCCAGGCTGGAGAGCAGTGG - Intronic
1088321050 11:108554882-108554904 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1089680193 11:120115142-120115164 GACCCAGGGCTAATGGGCAGGGG - Intronic
1089778785 11:120858248-120858270 GGCTCAAGATGGGTGGGCAGCGG + Intronic
1091178176 11:133580003-133580025 AACCCAAGGGAGGGGGGCAGTGG - Intergenic
1202810595 11_KI270721v1_random:25695-25717 GACCACGGGCGGGTGGGCGGAGG - Intergenic
1091445387 12:541922-541944 GATCCCAGGAGGGAGGGCAGTGG - Intronic
1093655281 12:21687613-21687635 GAGCCAAGGGGGGTTGGCATAGG + Intronic
1094480423 12:30876907-30876929 GACACAAGGTGGGTAGGGAGGGG + Intergenic
1094484665 12:30915025-30915047 GAACCCAGGAGGGTGGGGAGAGG - Intergenic
1095437065 12:42201609-42201631 GAGCCCAGGCTGGAGGGCAGTGG + Intronic
1096417289 12:51425090-51425112 GAAGGAAGGAGGGTGGGCAGAGG - Intronic
1097872470 12:64612137-64612159 AACCCAGGGAGGGTGGGCATGGG - Intronic
1098254298 12:68600832-68600854 AGCCCAAGGCTGGAGGGCAGTGG - Intergenic
1098312129 12:69158797-69158819 GACTCAGGGCGGGTGGGGTGGGG - Intergenic
1098887724 12:75977233-75977255 CACCCAAGGCTGGAGGCCAGTGG + Intergenic
1100059842 12:90561021-90561043 GTCCCCAGGCGGGAGTGCAGTGG - Intergenic
1101630279 12:106486247-106486269 GACCCCAGGCTGGAGTGCAGTGG - Intronic
1103728273 12:123009820-123009842 CACCCATGCCAGGTGGGCAGTGG - Intronic
1104068264 12:125323556-125323578 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1104619779 12:130302294-130302316 GACCTATGGGGGGTGGGGAGAGG - Intergenic
1105016724 12:132790292-132790314 TACCCCAGGCTGGAGGGCAGTGG - Intronic
1105681130 13:22728676-22728698 GACCCAAGGGGTGTGGGGGGTGG + Intergenic
1105870952 13:24505900-24505922 GTCCCAAGACGCGTGGGCCGCGG - Intronic
1106360435 13:29026061-29026083 GAGGAAAGGCGGTTGGGCAGTGG + Exonic
1107769117 13:43771176-43771198 AATCCAAGGCGGGAGGGCAGAGG + Intronic
1110515370 13:76405624-76405646 CACCCATGGTGGGTTGGCAGGGG + Intergenic
1112483940 13:99802746-99802768 GACCCAAGGATGCTGGGCAGAGG - Intronic
1113848875 13:113406956-113406978 GCCCCCAGGCGAGTGTGCAGGGG - Intergenic
1114055557 14:18964846-18964868 GACACAAAGCTGGTGGGAAGAGG + Intergenic
1114106989 14:19436917-19436939 GACACAAAGCTGGTGGGAAGAGG - Intergenic
1114671944 14:24416092-24416114 GTGCCCAGGGGGGTGGGCAGTGG + Exonic
1115596877 14:34917820-34917842 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1116233307 14:42246295-42246317 CACCCCAGGCTGGAGGGCAGTGG + Intergenic
1116881953 14:50179422-50179444 TACCCAAGGCTGGAGTGCAGTGG + Intronic
1118853549 14:69603716-69603738 GACCTAAGGTTGGAGGGCAGAGG + Intergenic
1121127637 14:91418036-91418058 GGCCCGAGGCGGGTGGGTCGCGG + Intergenic
1122354099 14:101113013-101113035 GGGCCCAGGCGGGTGGGCAAGGG + Intergenic
1122450499 14:101802370-101802392 GTCACAAGGCTGGTGTGCAGTGG - Intronic
1122883265 14:104699551-104699573 GGCCCAGAGTGGGTGGGCAGAGG + Intronic
1122957173 14:105076266-105076288 GACCCAAGGCTTCTGGGCTGCGG + Intergenic
1202941268 14_KI270725v1_random:149026-149048 TAACCAAGGCGGGAGTGCAGTGG + Intergenic
1124157365 15:27237768-27237790 GACACAAGCTGGGTGGGAAGAGG - Intronic
1124799809 15:32821490-32821512 CACCCCAGGCTGGAGGGCAGTGG + Intronic
1125586686 15:40825626-40825648 GAGCCCTGGTGGGTGGGCAGGGG + Intronic
1125930405 15:43595656-43595678 GACCCAAGGTGGGTGGTTTGGGG + Intronic
1125943573 15:43695488-43695510 GACCCAAGGTGGGTGGTTTGGGG + Intronic
1126063777 15:44809464-44809486 GACCCAAGGCTGTGGGGCATAGG - Intergenic
1126168265 15:45672198-45672220 ACCCCCAGGCAGGTGGGCAGAGG + Intronic
1127332022 15:57948985-57949007 GTGCCAAGGCGGGTGGGGACAGG - Intergenic
1127455566 15:59153431-59153453 GACCCAAGGCTGTGGGGCTGTGG - Intronic
1128635601 15:69300141-69300163 GAACCTAGGGGGGTGGGGAGTGG - Intronic
1129350830 15:74955210-74955232 GACGCAAGGCTGGAGGGGAGGGG + Exonic
1129721822 15:77881735-77881757 TGCCCAGGACGGGTGGGCAGGGG + Intergenic
1132400971 15:101505074-101505096 GACCCCAGGCGGGAGGCCACGGG + Intronic
1132854795 16:2039929-2039951 GACCCTGGGCGGCCGGGCAGAGG + Exonic
1132913289 16:2326946-2326968 GCCCCCAGGCTGGAGGGCAGTGG - Intronic
1132971559 16:2691726-2691748 GAGCCAAGGCTGCAGGGCAGAGG - Intronic
1133833930 16:9350455-9350477 GACGAAGGGCGGCTGGGCAGAGG + Intergenic
1134320135 16:13155407-13155429 GTCCCAGGGCAGGTGGGGAGGGG - Intronic
1136534636 16:30892651-30892673 GACACAGGGCGGCTGGGCTGGGG + Exonic
1137670546 16:50275885-50275907 TACCCAAGGGTGGTGGGCGGGGG - Intronic
1138584361 16:57960612-57960634 GGCCCAAGGCGGGTGAGCCGGGG + Intronic
1139409537 16:66748192-66748214 GACCCGAGGCTGGGAGGCAGAGG + Intronic
1141880024 16:86851645-86851667 GACCCCAAGTGGCTGGGCAGGGG + Intergenic
1141948776 16:87327368-87327390 GCCCCAAGGCTGGGGCGCAGGGG + Exonic
1141979444 16:87540965-87540987 GACCCAGGGTGGCTGGGTAGAGG - Intergenic
1142086862 16:88187936-88187958 GAAGAAAAGCGGGTGGGCAGGGG + Intergenic
1142186694 16:88698118-88698140 GACCCGCGGCGGGTGGGAAAAGG + Intronic
1142195582 16:88737899-88737921 CACCCATGGTGGGTGGGCTGAGG - Intronic
1142376913 16:89711277-89711299 TGCCCAAGGCCGGTGCGCAGGGG + Intronic
1142865268 17:2786988-2787010 GTCCCCAGGCTGGTGCGCAGGGG + Intronic
1143646710 17:8235016-8235038 GGCCCAGGGCGGGGAGGCAGTGG - Intronic
1144568444 17:16379839-16379861 GTCCCCAGGCTGGTGTGCAGTGG - Intergenic
1145030339 17:19500448-19500470 GTCCCAAGGCTGGAGTGCAGTGG + Intronic
1145096600 17:20034135-20034157 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1145883918 17:28369895-28369917 GAGCCCAGGTGGGTGGGCTGGGG - Intronic
1147231971 17:39026203-39026225 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1147384691 17:40074300-40074322 GCCCCAAGGGGGGCGGGCGGTGG - Exonic
1147822516 17:43250066-43250088 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1147965753 17:44193467-44193489 GACCCAGGGCTGGTGAGGAGTGG - Exonic
1148129579 17:45254871-45254893 GGACCAAGGAGGGTGGGCACAGG - Intronic
1148442143 17:47716939-47716961 GACCCACTGCGGGTGGGGAGTGG + Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1151698053 17:75728051-75728073 GGCCCAGGGCAGGCGGGCAGTGG + Intronic
1151913892 17:77103479-77103501 CACCCCAGGCTGGAGGGCAGTGG + Intronic
1152724757 17:81939722-81939744 AGTCCAAGCCGGGTGGGCAGTGG - Exonic
1152765048 17:82132076-82132098 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1154066355 18:11110701-11110723 GACCCGGGGCGGGCGGGCCGGGG - Intronic
1157492737 18:48135947-48135969 GCCGGCAGGCGGGTGGGCAGCGG - Intronic
1157692711 18:49697151-49697173 GACCCCAGGCGGGTGGGGGAGGG - Intergenic
1157869002 18:51212159-51212181 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1160146255 18:76367499-76367521 GAGCCAGAGTGGGTGGGCAGAGG - Intronic
1160669116 19:348335-348357 GCCCCGAGGCGGGGAGGCAGGGG + Intergenic
1160819696 19:1052305-1052327 GACCCAAGGCGGGTGGGCAGTGG + Intronic
1160899009 19:1417533-1417555 GACCCAAGGTAGGTGGGGAAGGG + Exonic
1161087000 19:2339973-2339995 GGCCCCGGGCGGGTGGGCCGCGG + Intronic
1161087248 19:2340824-2340846 GTCCCAAGGGTGGTGGGCAGTGG + Intronic
1161276954 19:3423746-3423768 CACCCAAGCTGGGCGGGCAGTGG + Intronic
1161388737 19:4010368-4010390 GGCCGAAGGCAGGTGGGCTGGGG - Intronic
1161596754 19:5154552-5154574 GCCCCAAGGCAGGTGGTCAGGGG + Intergenic
1161845468 19:6709649-6709671 GACCCAAGGCTGCTGAGAAGAGG - Intronic
1162126058 19:8500046-8500068 CACCCATGGGGGGAGGGCAGTGG - Intronic
1162142821 19:8595115-8595137 GAATCGAGGCAGGTGGGCAGAGG + Intronic
1162499388 19:11042933-11042955 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1163526275 19:17823526-17823548 GTCCCCAGGCTGGTGTGCAGCGG - Intergenic
1163587883 19:18173723-18173745 GACCCGAGGGGCGTGGGCATCGG + Exonic
1163822160 19:19502218-19502240 GACCCCATGTGGGTGGGAAGAGG + Intronic
1163957898 19:20661135-20661157 GACCAGGGGAGGGTGGGCAGGGG - Intronic
1163968866 19:20773403-20773425 GACCCAATGCTGGAGGGCTGTGG - Intronic
1164158499 19:22611034-22611056 GAGAGAAGGAGGGTGGGCAGGGG + Intergenic
1165845173 19:38813269-38813291 GACCCAGGACAGGTGGGCAGCGG + Exonic
1165914029 19:39247235-39247257 GAGCCAGGGAGGGAGGGCAGCGG + Intergenic
1165916832 19:39265693-39265715 GAGCCAGGGAGGGAGGGCAGCGG - Intergenic
1165959433 19:39522042-39522064 GCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1166230416 19:41423109-41423131 GAGCCAAGGCTGGTGGGATGAGG + Exonic
1166370122 19:42295647-42295669 AACCCAAGTTGGGAGGGCAGAGG - Exonic
1166550016 19:43659201-43659223 GTCCCAAGGCTGGAGTGCAGTGG + Intronic
1167338021 19:48898476-48898498 GATCCCAGGCAGGTGGGCAGTGG - Intronic
1168145752 19:54419315-54419337 GCCCCAGGGTGGGTGGGCGGTGG + Intronic
1168289014 19:55347942-55347964 GACCCACGGGGGGTGGTGAGGGG - Exonic
1168382367 19:55934748-55934770 GAGCCAAGGAGGGTGGGAAGAGG + Intergenic
926109934 2:10175635-10175657 TACCCCAGGCGGGAGTGCAGTGG + Intronic
926731733 2:16040694-16040716 GACCCAGGAGAGGTGGGCAGGGG + Intergenic
927823836 2:26293362-26293384 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
930519718 2:52449422-52449444 GACCCCAGGCTGGAGTGCAGTGG + Intergenic
931244698 2:60482282-60482304 GACAGAAGGAGGGTGTGCAGTGG + Intronic
932446358 2:71784088-71784110 GACCCAAGGCAGCAGGACAGGGG - Intergenic
932570535 2:72936166-72936188 GACACAAGTGAGGTGGGCAGAGG - Intergenic
932726196 2:74181888-74181910 GATGAAAGGCGGGTGGGGAGAGG - Intergenic
933468830 2:82693653-82693675 GAGCCAAGGGGAGTGGGGAGTGG + Intergenic
934520805 2:95019026-95019048 AACCAGAGGCTGGTGGGCAGAGG - Intergenic
936287117 2:111189394-111189416 GACCCAAGGCAGGAGGGCACAGG - Intergenic
936955959 2:118022602-118022624 TACCCCAGGCTGGAGGGCAGTGG + Intergenic
938143356 2:128813553-128813575 GAGCCAAGGGGAATGGGCAGGGG - Intergenic
943639636 2:190344007-190344029 GATCCAAGGAGGAGGGGCAGCGG - Intronic
944720390 2:202417669-202417691 GTCCCAAGGCAGGAGTGCAGGGG + Intronic
947586925 2:231362123-231362145 GTCCCCAGGCAGGTTGGCAGTGG - Intronic
948465595 2:238150279-238150301 GAGCCCGGGCGGGTGGGAAGCGG - Intronic
1169345070 20:4823042-4823064 GACCCAAGGCAGGCCGGCTGGGG + Intronic
1171824511 20:29881986-29882008 GTCGCAAGGCGGGAGTGCAGTGG - Intergenic
1172391291 20:34567162-34567184 GATCCCAGGCAGGTGGGCAGAGG - Intronic
1173170424 20:40718929-40718951 GACCCATGGAGAGTGGGCTGGGG - Intergenic
1173589129 20:44210593-44210615 GACCCAAGGCGGGCGGGCCCGGG + Intronic
1173729890 20:45320740-45320762 GACCCTAGGCTGGAGTGCAGTGG - Intergenic
1173949434 20:46978707-46978729 GGCCCCAGGGAGGTGGGCAGGGG + Intronic
1174256655 20:49261192-49261214 GAGCCCAGGCTGGAGGGCAGTGG - Intronic
1174365443 20:50053618-50053640 GACCCGAGGAGGGAGGGAAGGGG + Intergenic
1175248605 20:57595969-57595991 GCCCCAAGCCTGGTGGACAGCGG - Intergenic
1175299429 20:57932448-57932470 GACGCCAGGTGGGTGAGCAGAGG + Intergenic
1176034079 20:63028017-63028039 GAACCAACGCGGGCGGGGAGTGG + Intergenic
1176581896 21:8537909-8537931 TAACCAAGGCGGGAGTGCAGTGG - Intergenic
1178298610 21:31432138-31432160 GACACCAGGCTGGAGGGCAGTGG + Intronic
1178478252 21:32956479-32956501 CACCTGTGGCGGGTGGGCAGGGG + Intergenic
1178947848 21:36962751-36962773 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1180067248 21:45418635-45418657 GAGCCAAGGAGGGCGGGCTGTGG - Intronic
1180214000 21:46313496-46313518 GACACCAGGTGGGTGAGCAGGGG - Intronic
1180264732 22:10514981-10515003 TAACCAAGGCGGGAGTGCAGTGG - Intergenic
1180474034 22:15687398-15687420 GACACAAAGCTGGTGGGAAGAGG + Intergenic
1181038186 22:20179798-20179820 GTCCCAGGGCAGCTGGGCAGAGG - Intergenic
1181112026 22:20607831-20607853 CACCCACCGCGGGTGTGCAGCGG - Intergenic
1181277180 22:21694510-21694532 GCCCCAAGGCACGTGGGAAGAGG - Intronic
1181280624 22:21717334-21717356 TACCCAAGGCTGGAGTGCAGTGG - Intronic
1181545443 22:23599696-23599718 GAACCAGGGCTGGAGGGCAGAGG - Intergenic
1182070031 22:27457052-27457074 GACTCAGGTGGGGTGGGCAGTGG - Intergenic
1182093683 22:27612452-27612474 GTCCCAAGGCGGCTGAGGAGTGG - Intergenic
1182736409 22:32534428-32534450 GGCCCGGGGCGGGTGGGCTGGGG + Intronic
1182751021 22:32642247-32642269 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1182845059 22:33423638-33423660 GAGCCCAGGCTGGAGGGCAGTGG - Intronic
1182919757 22:34068507-34068529 GAGCCAAGGTGGGTGAGAAGCGG - Intergenic
1184206813 22:43009907-43009929 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1184369049 22:44070991-44071013 AGGCCAAGGCGGGCGGGCAGGGG - Intronic
1184770351 22:46593498-46593520 GTCCCATGGCGGGCGGGCAGAGG + Intronic
1185205456 22:49535641-49535663 AGCCCCAGGAGGGTGGGCAGAGG + Intronic
949514246 3:4792908-4792930 GACACAAAGCGAGTGTGCAGAGG + Intronic
950898670 3:16476632-16476654 GACCCAAGGCTTCTAGGCAGAGG + Intronic
951530804 3:23696308-23696330 GAACCCAGGCTGGAGGGCAGTGG - Intergenic
952777634 3:37061443-37061465 CACCCAAGGCTGGAGTGCAGTGG + Intronic
953307206 3:41841518-41841540 GACGAAGGGCGGCTGGGCAGAGG - Intronic
953627298 3:44581238-44581260 GGCCCACGGCGGCTGGGCGGCGG - Intronic
954808025 3:53231556-53231578 GACCCAACACGGGAGGACAGAGG + Intronic
955115097 3:55990466-55990488 GACCCCAGGCTGGAGTGCAGTGG + Intronic
956598629 3:70995214-70995236 GGCCCACGGCCGGTGGACAGTGG + Intronic
956780619 3:72600211-72600233 GACCCAAGGGTGGAGCGCAGGGG + Intergenic
957856526 3:85885640-85885662 GACCCCAGGCTGGAGTGCAGTGG - Intronic
957932498 3:86899182-86899204 GTCCCCAGGCTGGAGGGCAGTGG - Intergenic
958270747 3:91496262-91496284 AAGCAAAGGCAGGTGGGCAGGGG + Intergenic
958814565 3:98901530-98901552 GACCCCAGGCCGGAGCGCAGGGG + Exonic
959722421 3:109507633-109507655 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
961331128 3:126139100-126139122 GACACAATGCTGGTGGTCAGAGG - Intronic
961612764 3:128153682-128153704 GACCGCAGGCGCGCGGGCAGCGG - Exonic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
961737794 3:129013139-129013161 GACCCAAGCCGGGTGAGCTCTGG + Intronic
962908303 3:139825161-139825183 GATCAGAGGTGGGTGGGCAGTGG + Intergenic
962977492 3:140458355-140458377 GACCTGAGTTGGGTGGGCAGGGG - Intronic
963904705 3:150763527-150763549 GACCGGACGCGGGCGGGCAGGGG + Intergenic
964058158 3:152487473-152487495 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
964650867 3:159009709-159009731 GTCCAAAGGTGGATGGGCAGGGG - Intronic
967082973 3:186067390-186067412 GTCACAAGGCTGGTGTGCAGTGG - Intronic
967185485 3:186941157-186941179 GGCCCAAGGATGGTGGGAAGGGG - Intronic
968451827 4:679529-679551 GACCTGAGGCAGGAGGGCAGGGG + Intronic
968554250 4:1239294-1239316 GCCCCACGGCAGCTGGGCAGAGG + Intronic
968745160 4:2356195-2356217 GAGCCCAGGCAGGGGGGCAGTGG - Intronic
968939923 4:3632436-3632458 GGCCCATGGCAGGAGGGCAGTGG - Intergenic
969297889 4:6280302-6280324 GCCCCAGGGCTGATGGGCAGGGG + Intronic
971332891 4:25697050-25697072 TTCCCCAGGAGGGTGGGCAGCGG - Intergenic
973699429 4:53521837-53521859 GACCCCAGGCTGGAGTGCAGTGG + Intronic
976567714 4:86570813-86570835 GAAACAAGGGGGATGGGCAGAGG + Intronic
982025161 4:151245639-151245661 GTCACCAGGCGGGTGTGCAGTGG + Intronic
985762527 5:1757620-1757642 GACCCGGGGCAGCTGGGCAGGGG - Intergenic
987252025 5:16109643-16109665 GACCCAAGGCAGGTGGGGGGAGG + Intronic
988540557 5:32104678-32104700 GACCCCAGGCTGGAGTGCAGTGG - Intronic
989991662 5:50774442-50774464 CAGCCAAGGCGGCCGGGCAGAGG + Intronic
991017742 5:61949590-61949612 GAGCCAAGCCAGATGGGCAGGGG - Intergenic
991578601 5:68130937-68130959 GAACCCAGGCTGGTGTGCAGTGG + Intergenic
995596678 5:113755112-113755134 GTCCCCAGGCTGGAGGGCAGTGG + Intergenic
996417194 5:123223049-123223071 GAGCAGAGGGGGGTGGGCAGAGG - Intergenic
996528703 5:124504498-124504520 CACCCAAGGCGGGTGGGTGGAGG - Intergenic
996824382 5:127664787-127664809 GACTCCAGGCTGGGGGGCAGTGG - Intergenic
999233921 5:150079231-150079253 GACCCCAGCTGTGTGGGCAGAGG - Intronic
1002451630 5:179322267-179322289 GACCCAGCGCAGGTGGGGAGAGG + Intronic
1003081133 6:3022667-3022689 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1003183057 6:3808260-3808282 GATCCCAGGTGGGTGGGGAGGGG + Intergenic
1003603888 6:7542320-7542342 GAGCCCGGGCGGGTGGTCAGAGG + Intronic
1004225891 6:13784076-13784098 GACCCAAGGAGGGTGGCCTTTGG - Intergenic
1005949886 6:30624130-30624152 CACCCAAGGCTGGAGTGCAGTGG + Intronic
1006150405 6:31983953-31983975 GACCCGGTGCTGGTGGGCAGAGG - Intronic
1006156706 6:32016691-32016713 GACCCGGTGCTGGTGGGCAGAGG - Intronic
1006357850 6:33571282-33571304 GAAGAAAGGCGGGTGGGCTGTGG - Intergenic
1006457441 6:34139979-34140001 GTCCCAAAGCGGGTGGGCACAGG + Intronic
1006516098 6:34546616-34546638 TGCACAAGGAGGGTGGGCAGAGG - Intronic
1007536699 6:42597555-42597577 CGCCCAAGGCTGGAGGGCAGTGG - Intronic
1008094086 6:47321153-47321175 GGGCAAAGGAGGGTGGGCAGAGG - Intergenic
1008619104 6:53254361-53254383 GACCCAGTGGAGGTGGGCAGGGG + Intergenic
1008984397 6:57525063-57525085 AAGCAAAGGCAGGTGGGCAGGGG - Intronic
1009172449 6:60417962-60417984 AAGCAAAGGCAGGTGGGCAGGGG - Intergenic
1011467876 6:87677035-87677057 CACCCAAGGCTGGAGTGCAGTGG - Intronic
1011597220 6:89027496-89027518 GACCCCAGGCTGGAGTGCAGTGG + Intergenic
1011765717 6:90617353-90617375 AACCCAAGGCAGGTGGTAAGGGG - Intergenic
1012597766 6:101060002-101060024 CACCCCAGGGGGGTGTGCAGTGG + Intergenic
1016397821 6:143644972-143644994 GACTCAGGGTGGGTGGGAAGGGG - Intronic
1016795509 6:148113250-148113272 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1017128447 6:151088003-151088025 GACCCCAGGCGTGCGGCCAGAGG + Intronic
1018410000 6:163535435-163535457 AACCCAAGGAAGGGGGGCAGAGG - Intronic
1018553231 6:165022879-165022901 CACCCAAGGCTGGAGTGCAGGGG - Intergenic
1019194632 6:170273925-170273947 GAGCCAAGGTGGGGGCGCAGAGG + Intergenic
1019346299 7:532399-532421 GACCCAGGTGGGGTGGGCTGTGG - Intergenic
1021509160 7:21416510-21416532 GACCCCAGGCTGGAGTGCAGTGG - Intergenic
1022235284 7:28454847-28454869 GACCCAGGGCTGGTGGGCAGTGG + Intronic
1022507787 7:30917307-30917329 GACCCAAGGAGGGTTGGGCGGGG + Intronic
1023814539 7:43939429-43939451 GAGGCAAGGTGAGTGGGCAGAGG - Intronic
1023868124 7:44248511-44248533 GACCCCAGGCAGGTGGGCATCGG - Intronic
1025000997 7:55314396-55314418 GACCCCAGGCTGGAGTGCAGTGG - Intergenic
1026846998 7:73704026-73704048 GGCCCGAGGCGGGTGGCCCGAGG - Intronic
1028548264 7:92027495-92027517 GACGAAGGGCGGCTGGGCAGAGG - Intronic
1029557241 7:101278906-101278928 GACCCAAGGGGGGCTGTCAGGGG + Intergenic
1029650865 7:101890423-101890445 GACCCAAGGCGGGGGTGGAGGGG - Intronic
1030196362 7:106857477-106857499 GGCCCAAGGAGGGTGGGCTCTGG - Intergenic
1031206218 7:118761104-118761126 GACCACAGGTAGGTGGGCAGTGG + Intergenic
1032399220 7:131611948-131611970 GACCAAAGGAGTGTGGGCACTGG - Intergenic
1033596716 7:142864348-142864370 GACCCCACGGGGCTGGGCAGCGG + Exonic
1035322100 7:158037973-158037995 GACCCAAAGCGGGAGGTTAGCGG - Intronic
1035473800 7:159128457-159128479 GGCCCAAGGCAGGAGGGGAGTGG - Intronic
1036010620 8:4718015-4718037 TACCCCAGGCTGGAGGGCAGTGG + Intronic
1036480023 8:9131414-9131436 GCCCCAAGGCTGGAGTGCAGCGG + Intergenic
1036941158 8:13054007-13054029 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1037743111 8:21622850-21622872 GACCCAGGGCTGGTGGGCTCTGG - Intergenic
1037785274 8:21899266-21899288 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1038040304 8:23718550-23718572 GACCCAAGGGAGGTGGGGAAAGG + Intergenic
1038534971 8:28347298-28347320 TACCCGAGGCAGCTGGGCAGTGG + Exonic
1038791443 8:30671758-30671780 GGCCCAAGGCTGGAGTGCAGTGG - Intergenic
1041692676 8:60704291-60704313 TGCCCAAGGCTGGTGGACAGTGG + Intronic
1042031462 8:64480374-64480396 GACCCTAGGCTGGCAGGCAGTGG - Intergenic
1043343123 8:79266239-79266261 GACCAATGGCATGTGGGCAGAGG - Intergenic
1045192111 8:99893403-99893425 CACCGAAGCCGGGTGGGCTGCGG - Intronic
1045648947 8:104325442-104325464 GACCCCAGGCTGGAGTGCAGTGG - Intergenic
1046703681 8:117427224-117427246 GACGAAGGGCGGCTGGGCAGAGG - Intergenic
1046770293 8:118111302-118111324 CACCCAGGGCGGGCGAGCAGCGG + Exonic
1047140206 8:122130064-122130086 GTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1049267143 8:141674199-141674221 GACCACAGGTGGGTGGGCGGGGG + Intergenic
1049514698 8:143047799-143047821 TACTCACAGCGGGTGGGCAGAGG - Intronic
1049686425 8:143941067-143941089 GACCCAGGGAGGGGCGGCAGAGG - Intronic
1049944227 9:579194-579216 GACCCAGGGTGGGTGGGTCGGGG - Intronic
1052771710 9:32696381-32696403 GACCCACTGCGGCTGGGCAAAGG + Intergenic
1053206194 9:36188592-36188614 GAACAAAGGTGGGTGGGCAATGG - Intergenic
1053598114 9:39584548-39584570 GATCCCAGGCGGGAGTGCAGGGG - Intergenic
1053856142 9:42341551-42341573 GAGCCCAGGCGGGAGTGCAGGGG - Intergenic
1054450828 9:65402839-65402861 GGCCCATGGCAGGAGGGCAGTGG + Intergenic
1055640523 9:78315736-78315758 GACCCAAGGCCTGGGTGCAGTGG - Intronic
1056569923 9:87806093-87806115 GACCAATGGAGGATGGGCAGGGG - Intergenic
1056574109 9:87842275-87842297 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1056689859 9:88798751-88798773 GCCCCAAGGTGGGTGGTGAGGGG + Intergenic
1056759240 9:89403376-89403398 GACCAGAGTTGGGTGGGCAGAGG - Intronic
1057723783 9:97554204-97554226 GGCTCGAGGCAGGTGGGCAGGGG + Intronic
1058049595 9:100392829-100392851 GACAATGGGCGGGTGGGCAGGGG - Intergenic
1059481143 9:114590833-114590855 GCCCCCAGGCAGGAGGGCAGTGG + Intronic
1061054259 9:128214050-128214072 AAGGCAAGGGGGGTGGGCAGGGG - Intronic
1061272794 9:129553076-129553098 AACCCATAGCAGGTGGGCAGGGG + Intergenic
1061497220 9:130981900-130981922 GCCGCATGGCGAGTGGGCAGAGG - Intergenic
1061717674 9:132531190-132531212 GACACATGGCGGGAGGGAAGGGG - Intronic
1061785750 9:133027222-133027244 GATCCAAAGCGGGAGGTCAGAGG - Intergenic
1061819379 9:133217651-133217673 CACCCAAGGCAGGTGGGCTGGGG - Intergenic
1062332384 9:136050515-136050537 GAGACATGGCGGGCGGGCAGCGG + Exonic
1062441910 9:136573989-136574011 GTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1062555785 9:137112886-137112908 GTCCCGAGGCTGGTGGTCAGCGG - Intronic
1185663101 X:1742634-1742656 CACCCAAGGCTGGAGTGCAGTGG - Intergenic
1186192733 X:7082268-7082290 GACCCAAGGTGGGTGAGAACAGG + Intronic
1187988328 X:24839578-24839600 GAGCCATGGCTGGTGGGGAGGGG + Intronic
1192658952 X:73022070-73022092 GACCATGGGCGGCTGGGCAGAGG + Intergenic
1195468963 X:105211816-105211838 AACCCATGGAGGGTGAGCAGAGG + Intronic
1196687281 X:118522277-118522299 GACCCCAGGCTGGAGTGCAGTGG - Intronic
1198106085 X:133462674-133462696 CACCCAAGGCTGGAGTGCAGTGG + Intergenic
1199673484 X:150165823-150165845 CACACAAGGCAGGTGGTCAGAGG - Intergenic
1200090945 X:153635692-153635714 GGCTCAAGGCTGGTGGCCAGGGG + Intergenic
1200124151 X:153805379-153805401 GATGGAGGGCGGGTGGGCAGGGG - Intronic
1200822927 Y:7606418-7606440 TACCCAATGCAGGTGGTCAGAGG + Intergenic
1201564574 Y:15353008-15353030 GACCCAAGGTGGGTGAGAACAGG + Intergenic
1201742155 Y:17335772-17335794 GTCCCAAGGCTGGAGTGCAGTGG - Intergenic
1202237128 Y:22724677-22724699 TACCCAATGCAGGTGGTCAGAGG - Intergenic