ID: 1160820384

View in Genome Browser
Species Human (GRCh38)
Location 19:1055044-1055066
Sequence GCGCTGCAGGGTCAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160820384_1160820390 8 Left 1160820384 19:1055044-1055066 CCTTCACCTTGACCCTGCAGCGC 0: 1
1: 0
2: 1
3: 8
4: 204
Right 1160820390 19:1055075-1055097 GTGCACAGCCCATTGTCTGCAGG 0: 1
1: 0
2: 3
3: 9
4: 118
1160820384_1160820391 15 Left 1160820384 19:1055044-1055066 CCTTCACCTTGACCCTGCAGCGC 0: 1
1: 0
2: 1
3: 8
4: 204
Right 1160820391 19:1055082-1055104 GCCCATTGTCTGCAGGTTCTCGG 0: 1
1: 0
2: 2
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160820384 Original CRISPR GCGCTGCAGGGTCAAGGTGA AGG (reversed) Intronic
900230672 1:1555450-1555472 GTGCTGCAGGGGCCAGGTGGCGG + Intronic
900333454 1:2148767-2148789 CCTCTGCAGGGTGACGGTGAAGG - Intronic
900350974 1:2234371-2234393 GGGCAGCAGGGTCACGGTGGGGG + Intronic
900646819 1:3712853-3712875 GGGCTGCAAGGGCAAGGTTAGGG - Intronic
900900831 1:5514526-5514548 GTGCTTCAGGGTCTTGGTGATGG - Intergenic
901146573 1:7069064-7069086 GCCCAGCAGGGTCAAGGGCATGG - Intronic
902098147 1:13963171-13963193 GGGCTGGAGAGTCAAGGAGATGG + Intergenic
902475040 1:16679291-16679313 GCTCTGCGAGGTCAATGTGAAGG - Intergenic
902483604 1:16726317-16726339 GCTCTGCGAGGTCAATGTGAAGG + Intergenic
902494562 1:16860946-16860968 GCTCTGCGAGGTCAATGTGAAGG + Intronic
910034953 1:82778181-82778203 GTGCTGCAGAGTCAACATGATGG - Intergenic
910803045 1:91164425-91164447 GAGCTGCAGGACCCAGGTGAAGG + Intergenic
912088049 1:106034693-106034715 GCCCTGAAGGGTCATGATGATGG + Intergenic
913667548 1:121062426-121062448 GCTCTGCAAGGTCAATGTGAAGG - Intergenic
914019240 1:143849569-143849591 GCTCTGCAAGGTCAATATGAAGG - Intergenic
915603546 1:156937242-156937264 GCTCAACAGGCTCAAGGTGAGGG - Exonic
916188086 1:162152385-162152407 GCTGTGCAGTGTCAAGGAGAGGG + Intronic
917444957 1:175099368-175099390 GAGGTGAAGGGTCAAGGGGAAGG + Intronic
917591718 1:176482988-176483010 ATGCTGCATGGTAAAGGTGACGG + Intronic
919761476 1:201100689-201100711 GCTCTGCATGCTCAGGGTGAAGG + Intronic
922930452 1:229385218-229385240 GCACAGCAGGGTGAGGGTGAGGG - Intergenic
924931838 1:248739238-248739260 GGGCTGCAAGGTCAAGGGGTCGG + Intronic
1064374960 10:14786962-14786984 GGTCTGAAAGGTCAAGGTGAGGG + Intergenic
1066477846 10:35765128-35765150 GCCCGGCATGGTCAAGGCGAGGG - Intergenic
1067017419 10:42768636-42768658 ACGCTGCAGGTTCAAGGCCAAGG + Intergenic
1067208618 10:44240402-44240424 GAACTGCAGAGTCAAGGGGACGG + Intergenic
1070866256 10:79709599-79709621 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1070880050 10:79847730-79847752 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1071633162 10:87231820-87231842 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1071646611 10:87364038-87364060 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1073423700 10:103443503-103443525 GGCCTGTGGGGTCAAGGTGAGGG + Intronic
1074147343 10:110728509-110728531 ATGCCTCAGGGTCAAGGTGAGGG + Intronic
1075561846 10:123473898-123473920 TCCCTGAAGGGTCAGGGTGAGGG - Intergenic
1076785684 10:132748820-132748842 GTGCTGCAGGGTCAGGGTTGCGG - Intronic
1077187929 11:1243752-1243774 GGGCAGCAGGGTCGAGGTGCGGG - Exonic
1077188356 11:1245423-1245445 GGGCAGCAGGGTCGAGGTGCGGG - Exonic
1077188886 11:1247523-1247545 GGGCAGCAGGGTCGAGGTGCGGG - Exonic
1077189311 11:1249194-1249216 GGGCAGCAGGGTCGAGGTGCGGG - Exonic
1077233850 11:1470585-1470607 GGGTGGCAGGGTCAAGGTGTGGG - Intronic
1078849121 11:15148054-15148076 GCACAGCAGGGACAAGGCGAGGG + Intronic
1080835737 11:35938837-35938859 GCACTACAGGGTCAAGAGGAAGG - Intergenic
1083176239 11:60951865-60951887 GCGAGGAAGGGTCAAGGTGGAGG - Intronic
1083365540 11:62139667-62139689 CCGCTGCAGGGTCAACATGGAGG - Intronic
1084336310 11:68460061-68460083 TCGTAGCGGGGTCAAGGTGAGGG - Intergenic
1084485429 11:69445136-69445158 GTGCTGCAGAGCCAACGTGAGGG - Intergenic
1084818994 11:71670913-71670935 GCGATGCAGGTTCAAGCTTAAGG + Intergenic
1084849684 11:71928882-71928904 ACGTTTCAGGGTCAAGGAGAGGG - Exonic
1085040969 11:73326106-73326128 GGGCCGCAGGGTGAAGGAGAAGG + Intronic
1085454120 11:76656189-76656211 GGGCTGCAGGGCCAAGGGGAGGG + Intergenic
1085672522 11:78481311-78481333 GTGATACAGGCTCAAGGTGAAGG - Intronic
1086458583 11:86983437-86983459 GGGCTGATGTGTCAAGGTGAGGG - Intergenic
1086927874 11:92660258-92660280 GTGCTGCTGGGACAAGGTGGGGG + Intronic
1088849060 11:113690598-113690620 GCGCTCCTGGGACAAGGGGAGGG + Intronic
1089565764 11:119370835-119370857 CGGCTCCAGGGCCAAGGTGAAGG - Intronic
1091671696 12:2456723-2456745 GCTCTGCAGAGACAGGGTGAGGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092226766 12:6752990-6753012 ACGCTGCAGGGTCAGGGTCGCGG + Exonic
1092423956 12:8358401-8358423 GCGATGCAGGTTCAAGCTTAAGG - Intergenic
1097186506 12:57199192-57199214 GCACTGCAGGGCCAAGGGGCAGG - Exonic
1097805457 12:63960342-63960364 GCGGTGGAGGGGCAAGGAGAAGG - Intronic
1101259640 12:103014902-103014924 GCTCTGCCGGGGTAAGGTGAAGG + Intergenic
1102301565 12:111775274-111775296 TGGCTGCAGGGTGTAGGTGAGGG - Intronic
1102454382 12:113062834-113062856 GCCCAGCAGGGGAAAGGTGAGGG - Intronic
1103443545 12:120980025-120980047 GCGCTGTAGGGTGGAGGTCAGGG - Intronic
1105456380 13:20544862-20544884 GAGCTGCAGGGAGAAGCTGAGGG + Intergenic
1105472665 13:20706175-20706197 GCCCTGCAGGCTCCAGCTGAAGG - Intronic
1106218204 13:27721824-27721846 GGGCTGCATGGTCATGGTCAAGG - Intergenic
1106392851 13:29352247-29352269 ATGCTGCAGGGTTATGGTGAAGG + Intronic
1113593929 13:111518260-111518282 GAGCTGGAGGGGGAAGGTGAGGG - Intergenic
1114476194 14:22996787-22996809 CCGGGGCAGGATCAAGGTGAGGG - Intronic
1118836447 14:69481526-69481548 GTGCTGCAAGGTGAAGGGGAAGG + Intergenic
1119934572 14:78579630-78579652 CCTCTTCAGGGTCAATGTGATGG + Intronic
1121044909 14:90780686-90780708 GCGCTGCTGGCTCCAGGTCACGG + Intronic
1121670705 14:95708938-95708960 ACTCAGCAGGGACAAGGTGAAGG - Intergenic
1122097781 14:99384102-99384124 CCTATGCAGGGTCAAGGTTATGG + Intergenic
1122300924 14:100730634-100730656 GAGCTGCAGGGACAAGCTGGGGG + Intronic
1122645162 14:103189238-103189260 GGGCTGCGGGGTCGAGGGGAGGG + Intergenic
1122788790 14:104175832-104175854 CCGCTGCAGGGTCACTGTGGTGG - Exonic
1125328294 15:38559289-38559311 GCAATGCAGGGTCAAGGGGCTGG - Intronic
1129256990 15:74339285-74339307 TCTCTGCAGGGTCACGGAGATGG + Exonic
1129324162 15:74790797-74790819 GCTCTGCAGGGGGAAAGTGAGGG - Intronic
1130383260 15:83390244-83390266 GAGCTTCAGGGCCAAGTTGAAGG - Intergenic
1130972309 15:88742399-88742421 TCACTGCAGGGACAAGCTGATGG + Intergenic
1132220742 15:100103263-100103285 CAGCTGCAGGGTCACGGTGCAGG + Intronic
1132463048 16:64832-64854 GGGCAACAGGGTCATGGTGAGGG + Intronic
1132481253 16:167244-167266 GGGCTGCAGGGTCACAGGGAGGG - Intergenic
1135769906 16:25209837-25209859 CCCCTGCAGTGTCAAGGTCAAGG - Intergenic
1137788317 16:51154438-51154460 GCGCTGCAGTGTCAGGGCGCTGG + Intergenic
1139395446 16:66635061-66635083 TGGATGCAGGGTCAAGGTCAAGG - Intronic
1139960706 16:70715776-70715798 GGGCTGTCGGGCCAAGGTGAGGG + Intronic
1141420500 16:83912288-83912310 TCCCTGCTGGGTCAAGCTGATGG - Exonic
1142691028 17:1606164-1606186 GCTCTGGAGGGTCCAGGAGAGGG - Intronic
1144167192 17:12624676-12624698 GCGCTGCAGGGAGAAGCAGAGGG + Intergenic
1146652282 17:34614073-34614095 GTGCTGGGGGGTGAAGGTGAGGG + Intronic
1151305075 17:73257954-73257976 CCCCTACAGGGTCCAGGTGAAGG - Intronic
1151684974 17:75640956-75640978 GGGCTGCAGGGCCAGGCTGATGG - Exonic
1152057043 17:78037636-78037658 GCGCTGCAGGCTCATTGTGGCGG + Intronic
1152450167 17:80373490-80373512 CTGCTGTAGGGCCAAGGTGAGGG + Intronic
1152572366 17:81126486-81126508 GCGCTGCAGGGTCCGGGGGTCGG + Exonic
1160749781 19:728279-728301 GGGCAGCAGGGTCAGGGTGGAGG + Intronic
1160820384 19:1055044-1055066 GCGCTGCAGGGTCAAGGTGAAGG - Intronic
1162100379 19:8335295-8335317 GCGAAGCAGGGGCAAGGTTAGGG + Exonic
1163125492 19:15242236-15242258 GTGCTGCAGGGTTAGGGTGGAGG - Intronic
1166226550 19:41399270-41399292 GGGCTGCAGGAGCAAGGTGTGGG + Intronic
1167468525 19:49662900-49662922 CCTCAGCAGGATCAAGGTGAGGG + Intronic
925317406 2:2936766-2936788 GGGGTGCACGCTCAAGGTGATGG + Intergenic
926119223 2:10232522-10232544 GAGCTTCAGGGTCAAGGTGGGGG + Intergenic
927173929 2:20392259-20392281 CTGCTGCAGGGTCAGGGAGAAGG - Intergenic
929455319 2:42061094-42061116 GGGCTGCAGAGTCAAGGGGTGGG - Intergenic
929876027 2:45797291-45797313 AAGCTGCAGGGTGAAGGGGAGGG + Intronic
929887669 2:45893257-45893279 GTCCGGCAGGGTCAATGTGATGG + Intronic
935695068 2:105764190-105764212 GTGCTGCAGGGTCAAGGCTGTGG - Intronic
936569498 2:113602669-113602691 GCATTGCAGGGTGAGGGTGAGGG + Intergenic
937953147 2:127403678-127403700 AGACTGCAGGGTCCAGGTGAGGG - Intergenic
945516817 2:210772715-210772737 GGGCTGCAGAGTCAAGGGAAAGG + Intergenic
948275732 2:236706498-236706520 GGGCTGCCGGGTGCAGGTGAGGG - Intergenic
948599753 2:239101515-239101537 GGGTTGCAGGGGCAAGGAGAGGG - Intronic
948845314 2:240680263-240680285 GTCCTGCAGGGTGGAGGTGAGGG - Intronic
948848547 2:240694616-240694638 GTCCTGCAGGGTGGAGGTGAGGG + Intronic
1168819858 20:765535-765557 GCCCAGCAGGGTGAAGATGATGG + Exonic
1169141558 20:3229860-3229882 GGGCTCCAGGGGGAAGGTGAGGG + Intronic
1171110259 20:22474175-22474197 TCCCTGCAGGGTCAGGCTGAAGG + Intergenic
1171444083 20:25191264-25191286 GCCCTGCAGGCAGAAGGTGAAGG - Intergenic
1174001592 20:47378826-47378848 GCCCTGCAGGGACCAGGTGTTGG + Intergenic
1174378757 20:50143100-50143122 ACGGTGCAGGGCAAAGGTGAAGG + Intronic
1175677702 20:60961013-60961035 ATGCTAGAGGGTCAAGGTGAGGG - Intergenic
1175841408 20:62029991-62030013 GCGCCGCAGGGGCATGGTCACGG + Intronic
1176088684 20:63309482-63309504 CCGCGGCAGGGCCCAGGTGAGGG + Exonic
1176097314 20:63350059-63350081 GGGCGGCAGGGTCCAGGCGAGGG + Exonic
1179348177 21:40581208-40581230 GCGCTGCAGCCTCAAGGAGGTGG + Intronic
1179987671 21:44930517-44930539 GCACTGCAGGGGCAGGGTGGGGG + Intronic
1180052372 21:45337135-45337157 GGGCTGCAGGGTCCAGGTCCAGG - Intergenic
1181038004 22:20179161-20179183 ACGCTGCAGCATCAAGGTGGGGG + Intergenic
1183327721 22:37203504-37203526 GGGCTGCCGGGGCTAGGTGAGGG + Intergenic
1183423710 22:37726280-37726302 GAGCTGCCCGGTGAAGGTGAGGG - Exonic
1184116481 22:42425665-42425687 GGTCTGCAGGGTCATGGTCAAGG - Intronic
1184807053 22:46802117-46802139 GCCCTGCAGGGTCCTCGTGAAGG + Intronic
1185010579 22:48310707-48310729 GTGCTGCAGGGTCTAGAGGAGGG + Intergenic
1185142805 22:49112764-49112786 GCTGAGCAGGGTCAAGGGGAGGG + Intergenic
950376452 3:12576380-12576402 TCGGTGCAGGGGCAAGGGGAGGG - Intronic
956897528 3:73678494-73678516 GCGCTGCAGGGGTTAGGTGGAGG + Intergenic
957067959 3:75541485-75541507 GCGATGCAGGTTCAAGCTTAAGG - Intergenic
961285200 3:125796496-125796518 GCGATGCAGGTTCAAGCTTAAGG + Intergenic
961426510 3:126852571-126852593 GTGCTGCAGGGAGAAGGCGACGG - Intronic
961775097 3:129278890-129278912 GCGCTGCCGGGGCGAGGTGAGGG + Exonic
963116972 3:141738494-141738516 CATCTGCAGGGTCCAGGTGATGG + Exonic
967410458 3:189161829-189161851 GATATGGAGGGTCAAGGTGAAGG + Intronic
968813589 4:2810760-2810782 GGGCTGCAGGGTCCAGAGGAGGG - Intronic
969012307 4:4076082-4076104 GCGATGCAGGTTCAAGCTTAAGG - Intergenic
969435584 4:7187380-7187402 GCGCTGCAGGGACAGGCTGGTGG - Intergenic
969589031 4:8110760-8110782 GGGCTGCAGGGTCATGGCGGAGG + Intronic
969800921 4:9564577-9564599 GCGATGCAGGTTCAAGCTTAAGG + Intergenic
970195870 4:13549296-13549318 TCGCTCCAGGGCCAAGGGGAAGG + Intergenic
975516555 4:75254425-75254447 GAGGCTCAGGGTCAAGGTGAAGG + Intergenic
978649075 4:110978720-110978742 GTTCTGCATGGTCTAGGTGAGGG + Intergenic
978985153 4:115003079-115003101 GGGCTGCAGGGACAAAGGGAGGG + Intronic
981031694 4:140131813-140131835 GCTGTGAAGGGTGAAGGTGAAGG + Intronic
983882836 4:172952346-172952368 TGGCTGCAGGGTAAAAGTGAAGG - Intronic
985144903 4:186886477-186886499 GCCCAGCAGGTTCAAGGTGCAGG + Intergenic
985760780 5:1747522-1747544 GCGAGGCTGGGTCAAGGTGGGGG - Intergenic
987927855 5:24365037-24365059 GGGCTGCAGGGGCAGGGAGACGG - Intergenic
992643430 5:78790007-78790029 GCGCTGTAGGGTGAACGGGAGGG + Intronic
1002779789 6:357405-357427 GAGCCGGAGGGTCACGGTGACGG - Intergenic
1003112235 6:3259780-3259802 GCGCGGCAGGGTGAAGGTGAGGG - Intronic
1003557323 6:7151700-7151722 TCCCTGCAGGGTCAGGGAGAAGG + Intronic
1006164609 6:32057068-32057090 GGGCAGGAGGGTCAGGGTGAGGG - Intronic
1007240249 6:40419720-40419742 GCTGTGCGGGGTCAGGGTGAGGG - Intronic
1008959958 6:57256306-57256328 GCCCTGTAGGGTGATGGTGAGGG - Intergenic
1012530745 6:100232807-100232829 GCACTGCAGAATTAAGGTGAAGG - Intergenic
1018029754 6:159832507-159832529 GAGCTGCAGGGCCAGGCTGAGGG + Intergenic
1022140346 7:27487998-27488020 GCAATGCAGGGTAAAGGAGACGG + Intergenic
1022973234 7:35536032-35536054 GCGCTGAAGGGAGAAGGGGAAGG + Intergenic
1024202535 7:47121549-47121571 GCGCCTCAGGGTCAAGGTTAGGG + Intergenic
1024681713 7:51696868-51696890 GCCCTAGAGGGTAAAGGTGAAGG + Intergenic
1026482384 7:70790144-70790166 GAGCTCCGAGGTCAAGGTGAAGG + Exonic
1028223097 7:88219746-88219768 GCCCTGCGGGGCCAAGGTGAGGG - Intronic
1031980780 7:128122977-128122999 GCGGGGCAGGGCCAAGGTCAGGG + Intergenic
1033648317 7:143321674-143321696 TATGTGCAGGGTCAAGGTGAAGG - Intronic
1035262501 7:157670998-157671020 GCGCTGCAGGCTGAAGATGCGGG - Intronic
1036750092 8:11438242-11438264 GTCTTGCAGGGTCAAGGAGAAGG - Intronic
1036887512 8:12569728-12569750 GCGATGCAGGTTCAAGCTTAAGG - Intergenic
1037582321 8:20253009-20253031 GCGCTGCAGGGACGAGCTGGAGG - Exonic
1037707899 8:21331106-21331128 GAGCTCCAGGGTCCAGGTGGAGG - Intergenic
1039422182 8:37452401-37452423 GCGCTGTAGGGCTAAGCTGAAGG - Intergenic
1040634027 8:49251496-49251518 GCTCTGCAGAGTTAAGGAGAGGG - Intergenic
1042962221 8:74315668-74315690 GCGCTGGATGGTGCAGGTGACGG - Intronic
1049236387 8:141514459-141514481 GCCCTGCAGGGTCCAGGCGAGGG + Intergenic
1049588303 8:143441871-143441893 GCTCTGCAGGGTGAGGGGGAGGG - Intronic
1050614186 9:7384368-7384390 AAGCTGCAGGTTCAAGGGGAGGG + Intergenic
1052270227 9:26620827-26620849 GCCCTGAAGGGTCAGTGTGATGG + Intergenic
1054714174 9:68540832-68540854 GAGCAGCAGGGTCAGGGTGCTGG - Exonic
1056596596 9:88012900-88012922 GAACTGCAGGTTCCAGGTGAGGG - Intergenic
1056602178 9:88054899-88054921 GTGCTGGAGGGGCAAGGTGTGGG + Intergenic
1057354208 9:94321411-94321433 GCTCTGCAGGGGCCGGGTGAGGG - Intronic
1057653556 9:96936224-96936246 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1057725081 9:97562712-97562734 TCGCTGCAGGGACAAGGGAAGGG - Exonic
1058620353 9:106876662-106876684 GCTCTGCAAGGTCAGGTTGAAGG - Intronic
1059433931 9:114265402-114265424 GCCCTGCAGAGACAAGGTAAAGG - Exonic
1060213697 9:121725691-121725713 GGGCCACAGGGTGAAGGTGAAGG + Intronic
1061863194 9:133478404-133478426 GTTCTGCAGGGTCCTGGTGATGG + Exonic
1062118411 9:134821363-134821385 TTCCTGCAGGGACAAGGTGAAGG + Intronic
1062424163 9:136498332-136498354 GAGCTGCAGGGCCAGGATGAGGG + Intronic
1062511905 9:136910910-136910932 GCGCTCCAGTCTCCAGGTGAAGG - Intronic
1062671245 9:137711015-137711037 GAGCTGCTGGGAGAAGGTGAGGG + Exonic
1203774197 EBV:63600-63622 TCGCAGCACCGTCAAGGTGACGG + Intergenic
1186276334 X:7942222-7942244 GCTCCGCAGAGTCAAGGTAAAGG - Intergenic
1186512988 X:10144635-10144657 GGGCTGGAGGGTAAAGGAGAGGG - Intergenic
1187009993 X:15268969-15268991 GAGCAGCAGGGTGAGGGTGAAGG - Intronic
1189976194 X:46463111-46463133 CCCCTGCAGGCTGAAGGTGATGG - Intronic
1190844824 X:54182493-54182515 CCGCTTCCGGGTCAAGGTGAGGG - Exonic
1195471450 X:105234913-105234935 GACCTGCAGTGTCAAGGGGAAGG + Intronic
1202232197 Y:22669243-22669265 GGGCTGCAGGGTCATGTAGATGG - Intergenic
1202310959 Y:23526915-23526937 GGGCTGCAGGGTCATGTAGATGG + Intergenic
1202559843 Y:26143679-26143701 GGGCTGCAGGGTCATGTAGATGG - Intergenic