ID: 1160820986

View in Genome Browser
Species Human (GRCh38)
Location 19:1057940-1057962
Sequence ACGGAGAAGAAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1290
Summary {0: 1, 1: 0, 2: 6, 3: 115, 4: 1168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160820986_1160820994 25 Left 1160820986 19:1057940-1057962 CCAGCCTCCTTCTTCTTCTCCGT 0: 1
1: 0
2: 6
3: 115
4: 1168
Right 1160820994 19:1057988-1058010 ACCTGCATAAACCTCTTTATTGG 0: 1
1: 0
2: 0
3: 6
4: 122
1160820986_1160820990 -3 Left 1160820986 19:1057940-1057962 CCAGCCTCCTTCTTCTTCTCCGT 0: 1
1: 0
2: 6
3: 115
4: 1168
Right 1160820990 19:1057960-1057982 CGTGCCCAGCACAGCCTATGTGG 0: 1
1: 0
2: 1
3: 20
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160820986 Original CRISPR ACGGAGAAGAAGAAGGAGGC TGG (reversed) Exonic
900108071 1:993973-993995 AAGGAGAAGAGGGAGCAGGCAGG - Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900274612 1:1816138-1816160 AGGGAGAGGAGGAAGGAAGCAGG - Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900832187 1:4973261-4973283 AGGGATGAGAAGAAGAAGGCTGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901058850 1:6462362-6462384 GGGGACAAGAGGAAGGAGGCGGG - Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901114948 1:6835966-6835988 ACGGATATGAAGAAGGAGTGGGG - Intronic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901501864 1:9657507-9657529 ACGGAAAGCAGGAAGGAGGCTGG - Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901836381 1:11926384-11926406 ACCGAGAAGAAGGAGGAAGCAGG - Exonic
901948278 1:12721104-12721126 AGAGAGAAAAAGAAGGCGGCTGG + Intronic
902159293 1:14516811-14516833 ATAGAAAAGAAGAAGAAGGCTGG - Intergenic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902755352 1:18545774-18545796 ACAGAGGAGGAGAGGGAGGCTGG - Intergenic
902833122 1:19030250-19030272 AGGGAGAAAAAGTGGGAGGCTGG + Intergenic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903296563 1:22347084-22347106 AAGGAGAAGAAGAAGAGGCCGGG + Intergenic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
903742428 1:25565949-25565971 AGGAAGAGGAAGGAGGAGGCAGG - Intronic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904007376 1:27370559-27370581 GGGGAGCAGAGGAAGGAGGCTGG - Intronic
904107472 1:28098006-28098028 AAGGAGAAGAAGAAGAAGACTGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904541670 1:31238072-31238094 ACAGATAAGAAGACTGAGGCCGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
904998543 1:34650343-34650365 AGAGAGAAAAAGAAGGAGGGAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905525727 1:38637671-38637693 AGGCTGGAGAAGAAGGAGGCAGG - Intergenic
905550184 1:38831232-38831254 ACAGAGAAGAGGAAGCTGGCAGG + Intergenic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
907228879 1:52976275-52976297 TCTGAGAAGAAGAGGAAGGCTGG - Intronic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
907745171 1:57206206-57206228 GAGGAGAAGAGGAGGGAGGCAGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908397870 1:63742817-63742839 AAGGAGAAGATGAAGCAGGGAGG + Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909890882 1:81005224-81005246 ACGGAGAAGAGGAAGAAAGCAGG - Intergenic
910219490 1:84876199-84876221 ACGGGGTAGGAGAGGGAGGCAGG - Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910929081 1:92424552-92424574 AAGGAGAAGAGGAAGCAGTCAGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914513286 1:148352971-148352993 GCAGAGAAGGAGGAGGAGGCAGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914725663 1:150325066-150325088 ATGGACAAGAAGAAGGCAGCCGG + Exonic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915123753 1:153649169-153649191 ACAGAGAAGAGAAAGGAGGTGGG + Intergenic
915183049 1:154080061-154080083 ACACAGAAGAAGGAAGAGGCTGG + Intronic
915265224 1:154712009-154712031 ACGGAGAGGAAGAGAGAGACAGG + Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915584308 1:156835928-156835950 ACGGAGAGGGAGAAGGGGCCTGG - Intronic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916839349 1:168583997-168584019 ACCCAGAGGAAGAAGGAGGCTGG + Intergenic
916848112 1:168674142-168674164 ACAGTGAAGATGAGGGAGGCTGG - Intergenic
917191642 1:172424685-172424707 AGAGATAAGAACAAGGAGGCCGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918551326 1:185745878-185745900 ACTGAGAAAAGGAAGGAGACAGG + Intronic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920666150 1:207964065-207964087 AGGGAGGAGGAGGAGGAGGCAGG + Intergenic
920812802 1:209302999-209303021 ACAGAGGAGAGGAAGGAGGGAGG + Intergenic
920852640 1:209638893-209638915 ACGGAGAAGAGGTACGAGGTGGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922240834 1:223754750-223754772 ACGCAGAACAAGAAAGAGTCTGG + Intronic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922741122 1:228014755-228014777 ATGCAGGGGAAGAAGGAGGCTGG - Intronic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923712014 1:236395453-236395475 AAGGAGGAGAAGAAGAAGGGAGG + Intronic
923765863 1:236891857-236891879 ACAGAGAAGATGAAGGATGATGG + Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063691815 10:8295123-8295145 AGTGGGAAGAAGAAGGAAGCTGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064124881 10:12651080-12651102 ACGGGGAGGAAGGAGGAGGTGGG - Intronic
1064278405 10:13928833-13928855 AGGGAGAGGAAAAAGGAAGCTGG - Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065965452 10:30766899-30766921 ATGGAGGAGAACGAGGAGGCGGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067269696 10:44779735-44779757 AGGGACAAGAAGAAGAGGGCTGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067528835 10:47055735-47055757 ACAGGGAAGAAGGAGGAGGGAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1068936817 10:62643782-62643804 AGGGTGAAGTAGAAGGAAGCTGG + Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069478736 10:68760961-68760983 ACGGAAAAAAAAAAGGTGGCGGG - Intronic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069963742 10:72096261-72096283 ACGGACCAGCAGAGGGAGGCGGG - Intronic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070148254 10:73789930-73789952 AGGGAGAAAGAGACGGAGGCAGG - Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074509661 10:114100902-114100924 CCGGAGCAGAAGGAGGAGGCGGG + Intergenic
1074532123 10:114305183-114305205 ACGCAGATGAAGGAGGGGGCGGG + Intronic
1074724081 10:116289688-116289710 AGGGAGAAAAAGAAGGAAGGAGG - Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074995442 10:118754236-118754258 ACGGTGAGGGGGAAGGAGGCAGG + Intronic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1075452517 10:122561827-122561849 ACAGAGAAGGAGGAGGAGGGAGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076494497 10:130888080-130888102 ACGCAGATGGAGGAGGAGGCAGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077073226 11:687333-687355 AGCGAGAAGAAGCAGGAGGGAGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077392552 11:2306854-2306876 AGGGGGGAGAAGAAGGAGGGAGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077782591 11:5347791-5347813 AGGGAGCAGAAGAGGGAGGGAGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078423846 11:11233749-11233771 AGAGAGGAGATGAAGGAGGCGGG + Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079094639 11:17502492-17502514 ACGGACAACAAGAAGAAAGCAGG + Intronic
1079310427 11:19360727-19360749 AAGGGGAGGAAGAAGAAGGCTGG + Intronic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080004579 11:27393251-27393273 AGGGAGAAGAATCAGGATGCAGG + Intronic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080461965 11:32462583-32462605 ACAGAGAAAAGGAAGGAGGGAGG + Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1081992436 11:47345164-47345186 AAGGAGGAAAAGATGGAGGCTGG - Intronic
1082028731 11:47590113-47590135 AAGGAGAAGAAGTAGGCGCCGGG + Exonic
1082028815 11:47590572-47590594 AAGGAGAAGAAGTAGGCGCCGGG + Exonic
1082139523 11:48591977-48591999 ATGGATAAGAAGAAGGACCCAGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084104872 11:66974972-66974994 AAGGAGGAGAAGGAGGAGGGGGG + Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084598633 11:70132040-70132062 ACAGAGAAGAAGACCGTGGCGGG - Exonic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085036985 11:73306730-73306752 AAGGAGGAGAAGGAGGAGACTGG + Intergenic
1085750348 11:79155758-79155780 AGGAAGAAGAGAAAGGAGGCAGG - Intronic
1085807655 11:79651032-79651054 AGGAAGAAGAAGAAGGAAGGAGG - Intergenic
1085863501 11:80261100-80261122 AAGGAGAGGAAAAAGAAGGCAGG - Intergenic
1085925827 11:81019336-81019358 AGGGAGAGGAAGAAGGAAGGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086285813 11:85249584-85249606 ACTGAAATGAAGAAAGAGGCAGG + Intronic
1087151294 11:94861965-94861987 ACGGAGGATAAGAACAAGGCTGG - Intronic
1087700942 11:101435711-101435733 AATGAGAGGATGAAGGAGGCAGG - Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1087940910 11:104095588-104095610 TGAGAGAAGAAGAAGGAGGGAGG + Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089881404 11:121777057-121777079 ACAGAGAAAAAGAGGGAGGCAGG + Intergenic
1090007730 11:123017639-123017661 ATGGTGGAGAAGGAGGAGGCTGG + Intergenic
1090023960 11:123151944-123151966 AGAGGGAAGAGGAAGGAGGCAGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1090969246 11:131625521-131625543 ACTGAAAAGATGAAGGAGGGAGG + Intronic
1091127447 11:133113407-133113429 AGGGAGAAGAACAAGGAAGCAGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092764400 12:11839581-11839603 ACTAAGAAGAAAAAGAAGGCTGG + Intronic
1093007678 12:14068188-14068210 AGGGAGAAAAAGAGGGAGGGAGG - Intergenic
1093145985 12:15567433-15567455 AAGGAGAAGAAAAAGAAAGCTGG - Intronic
1093447511 12:19277127-19277149 ACAGAAAAGAAGCAGGAAGCAGG + Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1093779762 12:23121736-23121758 ACGGAGAAGAGGACAGGGGCAGG + Intergenic
1093959540 12:25257102-25257124 ACTGGGAAGAAAAAGGTGGCTGG - Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094365094 12:29671859-29671881 ACAGAGAAGATGAAAGAGTCTGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1094745863 12:33343475-33343497 AGGAAGAAGAAGAAGAAAGCAGG - Intergenic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096254846 12:50056704-50056726 TCAGAGAAGAGGAGGGAGGCAGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096553474 12:52389442-52389464 ACAGAGAAGAAAAGGGAGGAAGG - Intergenic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096910273 12:54976539-54976561 AAGGAGGAAAAGAAGGAGGGAGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097142293 12:56912168-56912190 ACAGAGAGGAAGATGGGGGCTGG + Intergenic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098176602 12:67798539-67798561 AGAGAGAAGAAAAAGAAGGCAGG - Intergenic
1098449293 12:70601295-70601317 ACGGAAAATAAGGAAGAGGCGGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102385400 12:112504912-112504934 AGGGAGAGGAAAAAGGAGCCTGG - Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102792322 12:115657807-115657829 ACGAGGAAGAAGGAGGAGGAGGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103298773 12:119910697-119910719 ACTGAGAAGATGAGGGAGGGAGG - Intergenic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104041353 12:125133430-125133452 ACGGGGAAGAGGAAAGAGCCAGG - Intronic
1104085155 12:125467435-125467457 AAGGAGAAGAAGAAGAGGGTGGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104613443 12:130249446-130249468 ACGGATGTGAAGTAGGAGGCGGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1104704699 12:130934315-130934337 ACAGAGCACAGGAAGGAGGCTGG - Intergenic
1105408380 13:20150335-20150357 ACAGAGATGAAGAGGGAGGCAGG + Intronic
1105828345 13:24142705-24142727 AAGGAGGAGAAGAAGAAGGGAGG - Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106828842 13:33556249-33556271 AAGGAAAAGAAAAGGGAGGCGGG - Intergenic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107733838 13:43375241-43375263 AGGGAGAAAAAGAACGGGGCGGG + Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107965861 13:45597694-45597716 ATGGAGCAGAAGAGGGAGCCTGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109217450 13:59605725-59605747 AACGAGAAGAAGAGGGAGGGAGG + Intergenic
1109245034 13:59943913-59943935 AGGGAAAAGATGATGGAGGCTGG + Intronic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110506556 13:76294684-76294706 ACGGAGAGGGAGAAGGAGAGGGG - Intergenic
1110639564 13:77806522-77806544 TCTGTGAAGAGGAAGGAGGCAGG + Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111856472 13:93643848-93643870 AGGGTGAAGAAGGAGAAGGCTGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1113074353 13:106453222-106453244 CCAGAGAAGAAGACAGAGGCAGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113795092 13:113052284-113052306 GCAGAGAAGAGGAAGGAGCCCGG + Intronic
1113929014 13:113956723-113956745 GCGAAGAAGAGGAAGGAGACGGG - Intergenic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1115028493 14:28767736-28767758 GGGGAGGAGAAGAAGGGGGCGGG + Exonic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116289982 14:43022375-43022397 AGGGAGGAGAAGAGGGAGGGAGG - Intergenic
1116779286 14:49218412-49218434 ACTGAGAAGGAGAATAAGGCAGG - Intergenic
1116866611 14:50036560-50036582 AAGGAGGTGATGAAGGAGGCTGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1118058889 14:62114360-62114382 ACAGATAAGAAGTAGGAGACAGG + Intergenic
1118275312 14:64381301-64381323 AAAGAGAAGAAGAAATAGGCCGG + Intergenic
1118375031 14:65169426-65169448 GCTGAAATGAAGAAGGAGGCTGG + Intergenic
1118434538 14:65757499-65757521 TCGGAGAATAGCAAGGAGGCTGG + Intergenic
1118765943 14:68909407-68909429 AGAGAGAAGAAGGAGCAGGCTGG + Intronic
1119382548 14:74238541-74238563 AGGGAGAGGAAGGAGGAAGCGGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120513038 14:85438485-85438507 TCTGAGAAGAAGGAGGAGGGCGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121612850 14:95293265-95293287 AGGGAGGAAAAGAAGGAGGGAGG - Intronic
1121612878 14:95293341-95293363 AGGGAGGAAAAGAAGGAGGGAGG - Intronic
1121631685 14:95425670-95425692 ATGGGGAAGATGGAGGAGGCTGG + Intronic
1121743002 14:96267157-96267179 AGAGGGAAGAAGAAGGAGGTTGG + Intronic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122863637 14:104593762-104593784 ACTCAGAGGAAGGAGGAGGCCGG + Intronic
1124013498 15:25858435-25858457 ACGGAGAAGGAGTAGGAGAGGGG + Intronic
1124658546 15:31527176-31527198 ACGCAGCAGAATAAGGAGGTTGG - Exonic
1124875859 15:33592613-33592635 AAGGAGAAGAAAATGGAGTCTGG + Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126939087 15:53746180-53746202 ACGGGGAAGAAGATGAAGGCGGG - Intronic
1126980742 15:54239748-54239770 ACAGATAAGAATAAGGAGGTGGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128389790 15:67175110-67175132 ATGGAGGGGAAGGAGGAGGCAGG + Intronic
1128743270 15:70097311-70097333 GGCGAGAAGAGGAAGGAGGCGGG + Exonic
1128981340 15:72189128-72189150 AAGGAGGAGAAGGAGAAGGCAGG + Intronic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129065500 15:72900651-72900673 ACGGAGGGGAAGAAAGATGCTGG - Intergenic
1129265176 15:74389486-74389508 AGGGAGACGAAGCTGGAGGCAGG + Intergenic
1129360622 15:75021703-75021725 AGGAAGTAGAAGAAGCAGGCTGG + Intergenic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1129605690 15:77023970-77023992 AGGGAGAGGAAGAAGGAGAGGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129683499 15:77671593-77671615 AGGGAGAATAGGAAGGAGACCGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132415390 15:101615365-101615387 CCTGAGTAGAAGAGGGAGGCTGG + Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132736567 16:1388871-1388893 ACAGAGAAGAAAAACCAGGCAGG - Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133460685 16:5983986-5984008 AAGGAGAAGAAGAAGAATGTGGG - Intergenic
1133759365 16:8786045-8786067 ACGGTGAAGAACAGGGAGGCAGG + Intronic
1133760815 16:8797165-8797187 GCGGAGAAGGAGAAGGAGCGAGG + Intronic
1134031877 16:10998652-10998674 AAGGAGAAGAAGGAGAAGGGAGG - Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134105585 16:11483969-11483991 ACAGAGGAGAAGCAGGAGGAAGG + Intronic
1134287182 16:12872038-12872060 AGGAAGAAGAAGGAGGAGGGGGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134691161 16:16191788-16191810 AAGGAGGAGAGGAAGGAGGGAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135186070 16:20316942-20316964 ACGAGGAAGGAGAAGGAGGGAGG - Intronic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136039015 16:27563350-27563372 ACGGAGCAGAAGAGGGATGTGGG + Intronic
1136403340 16:30030161-30030183 ACGGGGAAGAAGAGAGAGGCGGG + Intronic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1137270895 16:46901710-46901732 ACGGAGCAGAAAAAGTTGGCGGG - Intronic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137507145 16:49064008-49064030 ACAGATAAGAAAAATGAGGCTGG + Intergenic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137840629 16:51637480-51637502 AGGGAGAAGAAGGAGGGGGGAGG + Intergenic
1138083536 16:54114228-54114250 ACGGAGAAAAAGAGGGAGTATGG - Exonic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139209941 16:65067686-65067708 ACAGAGAAAGAGAAGGAGGGAGG + Intronic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139872620 16:70119550-70119572 ACCAAGAACAAAAAGGAGGCCGG - Intronic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140315003 16:73888072-73888094 AGGGAGAGGAAGACGGAGGTGGG - Intergenic
1140363156 16:74361765-74361787 ACCAAGAACAAAAAGGAGGCCGG + Intergenic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140814179 16:78605262-78605284 AGGAAGAGGAAGCAGGAGGCTGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141667987 16:85475720-85475742 ACTGGGAAGAAAGAGGAGGCAGG + Intergenic
1141704492 16:85657273-85657295 ACAGAGAAGCTGAAGGATGCCGG + Exonic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1142482261 17:226331-226353 ACGGAGATGAAGAACAAGCCAGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143157565 17:4848038-4848060 AGAGAGAGGAAGAAGGAGGGAGG + Intronic
1143177974 17:4967501-4967523 CGGGAGAAGAGGCAGGAGGCTGG + Intronic
1143309072 17:5973312-5973334 ACAGAGAAGAGGAAGGAAGGTGG + Intronic
1143370657 17:6436935-6436957 AGGAAGAAGAAGAAGAAGACTGG + Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143622943 17:8091368-8091390 AGGGAGACGGAGATGGAGGCAGG + Intergenic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146587767 17:34097302-34097324 ACAGACAAGAAGTAGGATGCAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146987315 17:37232497-37232519 AGGGAGAGGAAGAAGGAAGGGGG + Intronic
1147031705 17:37643280-37643302 ACTGAGAAGGAGCAGGAGCCCGG - Intronic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147686118 17:42287873-42287895 CCGGAGTAAAAGAAGGAGGGAGG + Intronic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1148141731 17:45333851-45333873 AGGGAGGAGAAGAAGGAATCAGG + Intergenic
1148324778 17:46776898-46776920 AGGGGGAGGAAGGAGGAGGCAGG - Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1148891870 17:50813432-50813454 ACGGAGCTGGAGAAGTAGGCAGG + Intergenic
1148955539 17:51350770-51350792 AGGCAGAAGAAGAAGGAAACTGG + Intergenic
1149099564 17:52887541-52887563 ATTGAAAACAAGAAGGAGGCTGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149548446 17:57521880-57521902 ACGGAGAAGAAGGAGCAGACTGG - Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150482501 17:65521423-65521445 AGGAAGAAGAAGAAGAAGCCAGG + Intergenic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151267489 17:72967995-72968017 GAGGTGGAGAAGAAGGAGGCTGG - Intronic
1151335219 17:73435674-73435696 GCGGAGAGGAGGCAGGAGGCAGG - Intronic
1151368546 17:73632370-73632392 ACGGGGAGAAAGATGGAGGCTGG - Intronic
1151948048 17:77330108-77330130 AAGGAGAGGAGGCAGGAGGCAGG - Intronic
1151999996 17:77639251-77639273 AGGGAGGAGAGGAAGGATGCTGG - Intergenic
1152055352 17:78021122-78021144 AGGTAGCTGAAGAAGGAGGCTGG + Intronic
1152084072 17:78206692-78206714 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1152261581 17:79270100-79270122 ACGGAGGAGAACCAGGAGGGTGG - Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1153166462 18:2267188-2267210 AGGCAGAACAAGAAGGAGGGAGG + Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153463276 18:5361180-5361202 AGGGAGAAGAAGCAGGAGTATGG + Intergenic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1155368925 18:25077820-25077842 ACAACGAAGAAGAGGGAGGCGGG + Intronic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155608222 18:27632621-27632643 ATAGAGGAGAATAAGGAGGCTGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157237598 18:45979151-45979173 AGGGAGAAGAAGAAGAAGAGAGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157330396 18:46699924-46699946 ACTGAGACCAAGAAAGAGGCTGG - Intronic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158410324 18:57199519-57199541 GCGGGGAAGTAGAAGGAGGTAGG - Intergenic
1158542475 18:58369649-58369671 AAGGAGCAGAAGCAGGAGCCTGG + Intronic
1158650155 18:59276739-59276761 ACGGAGAAGGAGAGGGAGAGCGG + Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160363550 18:78304977-78304999 GCGGAGATGAAGCACGAGGCGGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160822562 19:1065312-1065334 ACCGAAGAGCAGAAGGAGGCAGG + Exonic
1161158536 19:2748274-2748296 AAGGAGAAGAAGGAGAAGCCTGG + Intergenic
1161349644 19:3784772-3784794 ACGGAGTTGAAGAAGGACCCGGG + Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162022282 19:7873391-7873413 GCGGAGCTGAGGAAGGAGGCTGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162846062 19:13393564-13393586 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163026978 19:14518231-14518253 CCGGACAAGAACAAGGAGCCCGG - Exonic
1163104346 19:15114913-15114935 GCGGAAAAGAAGAGGGAGACAGG - Exonic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163312364 19:16522055-16522077 ACGGAGCAGAAGAAGGATACAGG - Intronic
1163463506 19:17453432-17453454 GCTGACAGGAAGAAGGAGGCTGG - Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1164131124 19:22362641-22362663 ACGGAGTTGATGAAGGAGTCTGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164771861 19:30815907-30815929 AGGGAGGAAAGGAAGGAGGCAGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1164922840 19:32102555-32102577 AAGGAGGAGAAGAAGAAGACAGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166171435 19:41030058-41030080 AGGGAGAAGAGGAAGGACCCAGG - Intergenic
1166882133 19:45936072-45936094 ACAGGGCAGAAGAAGGTGGCTGG + Exonic
1166929395 19:46292702-46292724 TCAGAGAGCAAGAAGGAGGCTGG - Intergenic
1167058850 19:47130931-47130953 ATGGTGGAGAAGGAGGAGGCTGG + Exonic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167217689 19:48175652-48175674 AGGGATATGAAGGAGGAGGCTGG + Intronic
1167280349 19:48563984-48564006 AGGAAGAAGAAGAAGAAGACTGG + Intronic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925173685 2:1767739-1767761 AGGGTGAATAAGAAGGAAGCAGG - Intergenic
925640609 2:5982885-5982907 AAGGAACAGAAGACGGAGGCAGG - Intergenic
925891261 2:8436879-8436901 AGGGAGGAAAGGAAGGAGGCAGG + Intergenic
925898752 2:8493882-8493904 TCAGAGAGGAGGAAGGAGGCAGG - Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926109370 2:10172262-10172284 TCGGATGAGATGAAGGAGGCTGG + Intronic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926334892 2:11855612-11855634 ATGGCAAAGAAGAAGAAGGCAGG + Intergenic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927197228 2:20556800-20556822 AGGCAGAACAAGAAGGAGCCAGG - Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
927267987 2:21174453-21174475 ACTGAGAAGACTAAGGAGGGAGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927292828 2:21421467-21421489 AGGAAGAAGAAGAAGGAGCTTGG + Intergenic
927583474 2:24277161-24277183 AGAGAGTAGAAAAAGGAGGCTGG + Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927754516 2:25698053-25698075 ACGCAGGAGGAGAGGGAGGCTGG + Intergenic
928098050 2:28417536-28417558 AGGGAAAAGAAGAATGAGACGGG - Intergenic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
928826436 2:35427024-35427046 TAGGAGGAGAAGGAGGAGGCAGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931473441 2:62563830-62563852 AAAGTGAAGTAGAAGGAGGCAGG + Intergenic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931683075 2:64768718-64768740 AAGGAGGAAAAGAAGGAGGGAGG - Intergenic
932011433 2:67981613-67981635 ACAGAGAAGAACAAAGAGACTGG - Intergenic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932715036 2:74094598-74094620 AAGGAGGCGAAGGAGGAGGCTGG + Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933826690 2:86167776-86167798 ACAGAAAAGAAAAAGTAGGCTGG - Intronic
934605578 2:95692706-95692728 ACAGAGGAGAAGAAACAGGCAGG + Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934759583 2:96846441-96846463 ACAGAGCAGAAGCAGGAGGGTGG - Intronic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
935809169 2:106779908-106779930 AAGGAGAAGAAAAAGAATGCTGG + Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936379438 2:111970825-111970847 AAGGAGGAGAAGGAGGAGGGAGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936539043 2:113335246-113335268 ACAGAGGAGAAGAAACAGGCAGG + Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937430184 2:121831793-121831815 ACGGGGAAGAGGAAGGAGCCAGG - Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942017771 2:171833748-171833770 AGGGAGAAGAAGATGGAGGGAGG - Intronic
942074623 2:172345340-172345362 ACAGAGAAAGAGAACGAGGCTGG + Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
943214707 2:185015665-185015687 AGGGACAAGAAGAAAGATGCTGG + Intergenic
943785983 2:191879733-191879755 AGGGAGAAGATGAGGGAGCCAGG + Intergenic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
944279935 2:197884446-197884468 ACGTAGCAACAGAAGGAGGCTGG + Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
947235004 2:227932049-227932071 AAGGAGAAGAAGGTGGGGGCGGG - Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947536287 2:230942273-230942295 AGGAGGCAGAAGAAGGAGGCAGG - Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947641963 2:231711930-231711952 ACGAAGAAGAGGAAGAAGGTGGG + Exonic
947826957 2:233113084-233113106 ATGGGGAAGAAGCAGGAGCCAGG - Intronic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949003818 2:241633873-241633895 ACCGAGAAGAAGAGGGGGGCTGG - Exonic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1169014409 20:2279990-2280012 ACCTACAAGAAGAAGGAGGTTGG - Intergenic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169052960 20:2595960-2595982 AAGGAAAAGAACAAGGAGACAGG + Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170708339 20:18766445-18766467 TCAGAAAAGAAGAGGGAGGCCGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171178743 20:23075575-23075597 ATGGAAAAGAAAAAGAAGGCCGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172210958 20:33198225-33198247 ACAGAGGAGAACAAAGAGGCCGG - Intergenic
1172271762 20:33659166-33659188 AGGGAGAAGAGGATGGAGACAGG - Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172540012 20:35705312-35705334 ACAGAGAAGAAGAAGTTGGATGG - Exonic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173662878 20:44746151-44746173 ATGGCGAAGTAGAAGGAGCCGGG - Exonic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174183121 20:48687328-48687350 AAGGAGAAGAAGATGGCGGGAGG - Intronic
1174258762 20:49278159-49278181 GAGGAGGAGAAGGAGGAGGCGGG + Exonic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1174828340 20:53789852-53789874 AATGGGAAGAAGAAAGAGGCAGG - Intergenic
1174845348 20:53938047-53938069 ACGGATAAGAGGATGGAAGCTGG - Intronic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175963065 20:62646787-62646809 TTTGAGAAGAAGACGGAGGCTGG - Intronic
1175986523 20:62766661-62766683 ACGGAGTGGAAGGAGGAGGGCGG - Intergenic
1176869514 21:14074138-14074160 ACGGAAAAAAAAAAGGGGGCGGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177160710 21:17545115-17545137 AGGGAGAGGAAGAGAGAGGCAGG + Intronic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178150823 21:29791483-29791505 ACAAAGAAGAAGAAGGAGAAGGG + Intronic
1178191526 21:30287543-30287565 AGGGAGAGGAAGAAGGAAGGAGG + Intergenic
1178361025 21:31948598-31948620 AGGGAGGAGAAAAAGGAGGTGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179634131 21:42696586-42696608 ACTGAGAAGAGGAAGGAAGGAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180013087 21:45064252-45064274 AGGGAGAGGAAGAAGAAGGGTGG - Intergenic
1180155854 21:45977216-45977238 AGGGAGAGGAAGAAGGATGGAGG - Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181935883 22:26438022-26438044 GCGGAGAACAAGAAGCAGGGGGG + Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182051830 22:27318154-27318176 AGCGAGGAGAAGCAGGAGGCGGG + Intergenic
1182087999 22:27574673-27574695 AAGGGGAAGAGGAAGGAGACAGG + Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182383890 22:29919040-29919062 AGGGAGAATAAGAAATAGGCTGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182997357 22:34826465-34826487 AAGCAGAAAAAAAAGGAGGCTGG + Intergenic
1183521852 22:38300229-38300251 ACAGAGAAGAAGCCTGAGGCAGG + Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184472498 22:44703593-44703615 ACGGAGAGGGAAACGGAGGCAGG - Intronic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1184821132 22:46909922-46909944 AGGGAGATGAAGAAGCAGGGCGG - Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184986408 22:48139173-48139195 ACAGAGAAGAATTTGGAGGCTGG + Intergenic
1184990895 22:48169341-48169363 ACAGGGAGGAAGAAGGAGGAGGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185179893 22:49353181-49353203 ACAGAGAAGAGGAAGGAGTGAGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949104927 3:192578-192600 AAGGAGAAAAAGAACTAGGCCGG + Intergenic
949575186 3:5331887-5331909 AAAGAGGAGAAGAAGGGGGCAGG - Intergenic
950224469 3:11222604-11222626 ACTGAGAAGAAGAAGATGGCAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
951387406 3:22059262-22059284 AGGGAAAAGAAGAAGAAGACAGG + Intronic
951475604 3:23102555-23102577 ACAGAGATTAAGAAGGAGGGGGG - Intergenic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
953041347 3:39257478-39257500 GGGGAGAAGAAGAGGGAAGCTGG + Intergenic
953365403 3:42340420-42340442 AAGGAGGAGAAGGAGGAGGGGGG + Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953660551 3:44888503-44888525 AGGGAGAGGAAGGAAGAGGCCGG - Intronic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954141060 3:48605798-48605820 ACTGAGAAGAATAATGGGGCAGG - Exonic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954941771 3:54379750-54379772 AAGGAGAACAGGAAGGATGCAGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956665430 3:71637601-71637623 AGGGAGAAAAAGAAGGATGTAGG + Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
956957842 3:74361405-74361427 ACTGAGATGAAGAAGCAGGATGG - Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959664524 3:108905885-108905907 ACGTAGAAAAAGAAGCAGGTGGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
960869038 3:122230825-122230847 ACAGAGAAGTAGAAGGGGCCAGG - Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961449173 3:126994802-126994824 CCTGAGAGCAAGAAGGAGGCAGG - Intronic
961669609 3:128519317-128519339 AGGGAGGAGAAGCAGGAAGCAGG - Intergenic
961726340 3:128933389-128933411 ATAGAGGAGAAGGAGGAGGCTGG + Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963923687 3:150929325-150929347 AGGGAGCAGAAGCAGGTGGCAGG + Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966441588 3:179950875-179950897 ACGGAGACGTAAGAGGAGGCAGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966781412 3:183587487-183587509 AGGGAGAACAGGAAGTAGGCAGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966917754 3:184594292-184594314 ACAGAGAAGAATAAGAAGGGGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968440891 4:623911-623933 CCGGAGAGGAAAAAGGAGGTGGG + Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968933517 4:3597247-3597269 CCGGACAAGAGGAAGGTGGCAGG + Intergenic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969258317 4:6017965-6017987 ACAGAGCAGAAGAAGGAGGGCGG + Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969349296 4:6589016-6589038 ACCGAGGAGAAGAATGAGGCTGG - Intronic
969643184 4:8411412-8411434 ACTGAGGAGAAGTAGGAGGTGGG + Intronic
969659323 4:8517395-8517417 AGGGAGCAGAAGAGGGAGGGGGG + Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970195578 4:13547600-13547622 GCGGAGGAGAAGCAGGAGGAGGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970848136 4:20567594-20567616 AAGGAGAAGAAGATGGATTCTGG + Exonic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971346319 4:25815084-25815106 AGGGAGAAGAGGAAGGCAGCTGG + Intronic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
972314422 4:37912711-37912733 ACATAGTAGAAGAAGGAAGCAGG - Intronic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974533801 4:63148413-63148435 ACGGAGAAGGAGAAGGAAAAAGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975124108 4:70762487-70762509 AAGGGGAAGAAGATGAAGGCTGG - Intronic
975391464 4:73822884-73822906 AGGGAGAAGAAGAGGGAGAAAGG + Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
977889855 4:102297187-102297209 ACGGAGATGATGAGGAAGGCTGG + Intronic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978604324 4:110462942-110462964 AGGGAGAAGAAGATGAGGGCAGG + Intronic
979113073 4:116783212-116783234 GCAGAGAAGAACAATGAGGCAGG + Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979715457 4:123832204-123832226 TGGGAAAAGAAGAAAGAGGCAGG - Intergenic
979743912 4:124185680-124185702 ACAGAGAAATAGAAGGAGACTGG + Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980098816 4:128520914-128520936 ACCGAACAGAAAAAGGAGGCGGG - Intergenic
980454557 4:133022493-133022515 AAGCCGAAGAAGAAGGAAGCTGG + Intergenic
980689893 4:136281524-136281546 AAGGACAAGAAGAAGAAGGTGGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981415667 4:144490285-144490307 ACAGAGAAGAAGAGGGAGAGTGG - Intergenic
982055559 4:151545671-151545693 ACTAAGAAGGATAAGGAGGCTGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982702430 4:158671741-158671763 AGGGAGAAGAGGGAGGCGGCGGG + Exonic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983644563 4:169976783-169976805 CCGGACAATAAGAAGGAGTCAGG + Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984423531 4:179554656-179554678 AGAGAGAACAAGAGGGAGGCAGG + Intergenic
984423582 4:179555456-179555478 AGAGAGAACAAGAGGGAGGCAGG - Intergenic
984610418 4:181830573-181830595 ACCGAGCAGAAGAAGCAAGCTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985196286 4:187433263-187433285 AAGGAGAAGAACAAGAGGGCTGG - Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985957449 5:3276108-3276130 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957464 5:3276156-3276178 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957482 5:3276203-3276225 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957493 5:3276235-3276257 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957504 5:3276267-3276289 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957515 5:3276299-3276321 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957546 5:3276379-3276401 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957557 5:3276411-3276433 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985968288 5:3354167-3354189 AGGGAGAATAAGATGGAGACGGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986463041 5:7992916-7992938 AAGGAGAAAAGGAGGGAGGCAGG + Intergenic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987288110 5:16480128-16480150 AGGGAGAAGAGGCAGGAGACTGG - Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
989224963 5:39016300-39016322 ACGGAGAAAAGGAAGGAGAGGGG + Intronic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
991433590 5:66573381-66573403 AAGGAGGAGAGGAAGGAGGGAGG + Intergenic
991433595 5:66573397-66573419 AGGGAGGAGAGGAAGGAGGGAGG + Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
993541439 5:89157708-89157730 AGGGAGAGGAAGATGGAGACAGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996441923 5:123500983-123501005 AGGGAACAGAAGAAGGAAGCTGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997602331 5:135149247-135149269 AGAGAGAAGAAGGGGGAGGCTGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998813697 5:145991568-145991590 ACGGAGAAAAAGAAGAAAGAGGG + Intronic
998883298 5:146667485-146667507 ATGGAGAAAAAGAAGAAAGCAGG + Intronic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999386307 5:151156661-151156683 AGGGAAAGGAAGGAGGAGGCAGG + Intronic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999708835 5:154298261-154298283 CCTGAAAAGAGGAAGGAGGCTGG - Intronic
999790419 5:154934643-154934665 AGGGAGAGGGAGAAGGAGACGGG - Intronic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000330188 5:160199674-160199696 ATGGAGACGAAGGAGGGGGCAGG - Intronic
1000793302 5:165633293-165633315 ACAGAAAGGAAGATGGAGGCAGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002521992 5:179797213-179797235 ACGGAGGGGAACAAGGAGGCTGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003610706 6:7612523-7612545 ACAGAGATGAAGCAGGAGCCTGG + Intergenic
1003797074 6:9616398-9616420 AGGGAGAAAAAGAAGGAAGCAGG + Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1004340809 6:14805892-14805914 AACTAGAAGAAGAAGGGGGCAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005285005 6:24315867-24315889 AAGGAGACCAAAAAGGAGGCTGG + Intronic
1005953372 6:30647308-30647330 GCGGAGGAGAAGAGGGAGGGAGG + Exonic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006078728 6:31551588-31551610 AAGGAAAAGAAAAAGGAAGCTGG - Intronic
1006373214 6:33657965-33657987 ACGGAGAACAAGAAGGTGCATGG + Exonic
1006445623 6:34078258-34078280 ACAGAGAAGAAGCAGAAGGTGGG - Intronic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006822306 6:36907045-36907067 AAGGAGGAAAAGAAGGAGGGAGG - Intronic
1006986225 6:38177399-38177421 ACAGATCAGTAGAAGGAGGCAGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007378501 6:41471862-41471884 ACGGAGAAAAAGTGGGAAGCAGG + Intergenic
1007511203 6:42375629-42375651 ACGAAGAACATGAAGGAGGAAGG + Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007531782 6:42549108-42549130 AAGGGGAAGAGGAGGGAGGCCGG + Intergenic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007815965 6:44525857-44525879 ACAGAGTAGTAGGAGGAGGCTGG - Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009403585 6:63285798-63285820 ACTGAGAAGCAAAAGGAGACTGG + Intronic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011305601 6:85922977-85922999 AAGGAGATGAAGAAGGGGGCGGG - Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012986167 6:105878432-105878454 ACGGAGAAGAAAAGAGAAGCTGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013815267 6:114090437-114090459 ACAGAGAAGAGGGAGGAGGGAGG - Intronic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014507475 6:122277663-122277685 ACAGAGATGAAAAAGCAGGCAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015542429 6:134328635-134328657 ACTTAGAAAAAGAATGAGGCTGG - Intergenic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016026413 6:139291947-139291969 AGAGAGGAGAGGAAGGAGGCAGG + Exonic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016694479 6:146976755-146976777 AAAGAGAAGAAGAAGGATGGGGG - Intergenic
1016701157 6:147055825-147055847 ACAGAGAAGAGAAAGGAGGTAGG - Intergenic
1016701189 6:147056042-147056064 ACGGGGAAGAAGAAGGAAAAAGG + Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017491163 6:154946451-154946473 AAAGAGAAGAAGAAGAAGACAGG - Intronic
1017972653 6:159326754-159326776 GAGGAGAAGAGGAAGGAGACAGG + Intergenic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018028415 6:159823118-159823140 AGGGAGAAGAGGAGGCAGGCAGG - Intergenic
1018163231 6:161068448-161068470 AAGGAGAAGAAGGTGGTGGCAGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019144841 6:169969959-169969981 AGTGAGAGGTAGAAGGAGGCTGG + Intergenic
1019273955 7:166219-166241 ACAGAGAATAGGAAGGAGGAAGG - Intergenic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019477895 7:1252756-1252778 AGGGACAAGAAGCAGGTGGCCGG + Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019802622 7:3099548-3099570 ACGAAGGAGAAGAAGGAACCAGG + Intergenic
1019849494 7:3540108-3540130 ACCCAAAAGAAGAGGGAGGCCGG + Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020748672 7:12111801-12111823 AGGGATCAGAAGCAGGAGGCAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1021850292 7:24801401-24801423 GAGGAGAAGAATCAGGAGGCTGG - Intronic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1021879664 7:25082438-25082460 AAGGTGAAGAGGGAGGAGGCAGG + Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022195998 7:28067884-28067906 ACTTAGAAGCAGAAGGAGACGGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1025142447 7:56477430-56477452 AAGGGGAAGAGGAAGCAGGCAGG - Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025610957 7:63075261-63075283 AAGGGGAAGAGGAAGCAGGCAGG + Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026226889 7:68450156-68450178 CGTGAGAAGAAAAAGGAGGCTGG - Intergenic
1026654575 7:72246014-72246036 AGGGAGAAAAGAAAGGAGGCTGG - Intronic
1026848800 7:73712234-73712256 ACGAAGAAGTAGAAGGACGTGGG - Intronic
1026890325 7:73977881-73977903 ACAGGGAAGAACAAGGAGCCAGG - Intergenic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028189955 7:87835707-87835729 GCGGGGAAGGAGAGGGAGGCGGG + Exonic
1028199527 7:87944893-87944915 AGGAAGAAGAAGAAGGAAGGAGG - Intronic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028567375 7:92247015-92247037 ACGGAGAAGAATAAGAATACAGG - Intronic
1029493533 7:100885019-100885041 GAGGAGGAGAAGGAGGAGGCCGG + Exonic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032218702 7:129977790-129977812 ACGGGGAAGAAGAACTAGGTTGG + Intergenic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034009880 7:147518387-147518409 AAGCAGAAGATGAAGGAGACAGG + Intronic
1034346495 7:150388505-150388527 AGAGAGAAGAAAGAGGAGGCAGG + Intronic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034709796 7:153181164-153181186 ACCCAGGAGAAGAAGGAGGCAGG - Intergenic
1034941406 7:155232663-155232685 GCTGGGAAGAGGAAGGAGGCAGG + Intergenic
1035639855 8:1176628-1176650 ACGGGGAAGAAGTTGGAGGCTGG + Intergenic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1035731650 8:1857712-1857734 ACAGAGAAGAAACAAGAGGCTGG - Intronic
1035760308 8:2064136-2064158 ACGGAGCAGATGCAGGAGGAAGG - Intronic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1036659425 8:10698413-10698435 GGGGAGAAGATGGAGGAGGCAGG + Intronic
1036776376 8:11615696-11615718 TCGGGAAACAAGAAGGAGGCAGG - Intergenic
1037266854 8:17072842-17072864 AAGGAGAACAAGAAGGAACCAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037568836 8:20141556-20141578 AAGGGGAAGAAGAAGCAGGGAGG + Intergenic
1037754682 8:21703249-21703271 AAGGAGAAAAAGAAGGGGGTGGG + Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041602146 8:59731749-59731771 GGGGAGAAGAAGAGGGAGGGTGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042216684 8:66435140-66435162 ACAGAGAACATAAAGGAGGCTGG + Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311110 8:67380170-67380192 ACTGAGCAGAAGAAGCAGGCTGG - Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042865938 8:73356775-73356797 ACACAGAGGAAGGAGGAGGCCGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043668104 8:82844042-82844064 ACAGAGATCAAGAAGAAGGCAGG - Intergenic
1044265087 8:90172618-90172640 CCGGAGAACAAAATGGAGGCTGG - Intergenic
1044371330 8:91414821-91414843 GCTGAGTAGAAGATGGAGGCGGG + Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045196342 8:99934841-99934863 ACGGATAAAGAAAAGGAGGCCGG + Intergenic
1045311607 8:101008052-101008074 GCACAGAAGAAGAAGGAGGTAGG + Intergenic
1045474660 8:102542616-102542638 ACGATGAAGAAGAAGAAGGAGGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046672825 8:117076026-117076048 AGAGAGAGGAAGAAGGAAGCAGG - Intronic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1047866478 8:129029492-129029514 ACGGGGAAGAAGGAGGAAGAAGG - Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1049623766 8:143611093-143611115 ACGGAGAAGCTGAACGGGGCTGG - Intergenic
1049740580 8:144239122-144239144 GCGCAGAAGAGGCAGGAGGCCGG + Exonic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1051497703 9:17743522-17743544 AGGGAAAGGAAGAAGGAGGGAGG - Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1051738153 9:20224683-20224705 GCAGAGAAGAAGAGGGAGGGAGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053417016 9:37953181-37953203 CCGGGGCAGAAAAAGGAGGCTGG + Intronic
1053512221 9:38697435-38697457 AAGGAGAAAAAGAAGGAGTTAGG - Intergenic
1053580548 9:39399494-39399516 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1053845044 9:42227568-42227590 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054102135 9:60958299-60958321 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054456625 9:65434570-65434592 CCGGACAAGAGGAAGGCGGCAGG - Intergenic
1054584224 9:66948564-66948586 ACTGAGAAGAAGGAGAAGGAGGG + Intergenic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055690639 9:78826707-78826729 AGAGAGCAGAAGAGGGAGGCAGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055752127 9:79518351-79518373 AAGGAAAAGAAGAAGGAAGTTGG - Intergenic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057428734 9:94975721-94975743 GCGGAGAAGAGGCTGGAGGCAGG - Intronic
1057499282 9:95584179-95584201 ATGGACAGGAAGAAGGAGACAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059623997 9:116041188-116041210 ATGGAAAAGAAAAAGGAGACGGG + Intergenic
1059775081 9:117466113-117466135 ATAGAGAGGAAGAAGGAGGGAGG + Intergenic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060283520 9:122228973-122228995 GAGGAGAAGAAGGAGGGGGCGGG - Intronic
1060543266 9:124446086-124446108 ACAGAGAAAAAGATGGAGTCTGG + Intergenic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061274169 9:129559795-129559817 AGGGAAGAGAAGAGGGAGGCAGG + Intergenic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061743545 9:132724031-132724053 ACAGGGAAGATGCAGGAGGCAGG + Intergenic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062097897 9:134712219-134712241 GGGGATAAGAAGAAGGGGGCAGG - Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062662702 9:137647105-137647127 ACTGGGAAGAAGGAGGCGGCAGG - Intronic
1203441970 Un_GL000219v1:17163-17185 ACTGAGAAGAACAAAAAGGCTGG + Intergenic
1203512778 Un_KI270741v1:136072-136094 ACTGAGAAGAACAAAAAGGCTGG + Intergenic
1185478457 X:429041-429063 ACGGAGGAAAGGAAGGAGGGAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186226605 X:7405625-7405647 ACAGAGACAAAGAAGGAGGGAGG + Intergenic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187288559 X:17930233-17930255 AGGGAGAAGAAACAGTAGGCAGG + Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188518330 X:31011163-31011185 ACAGAGACGAATAAGGAAGCAGG - Intergenic
1188737610 X:33738209-33738231 AAGGAGAAAAGGAGGGAGGCTGG + Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189674382 X:43445663-43445685 ACAGAGAAGAAGAAGTAGCTGGG - Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1194654744 X:96558839-96558861 ACTGAGATGAAGAAGGCTGCAGG - Intergenic
1195128568 X:101832462-101832484 AGGGCCAAGAAGATGGAGGCGGG - Intronic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195577549 X:106468143-106468165 AGGAAGAAGAAGAAGGAGAGGGG - Intergenic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201474283 Y:14364080-14364102 AAGGAGGAGAAGAAAGGGGCAGG + Intergenic
1201652669 Y:16307574-16307596 ACAGAGGAGAAGAGGGAGGGTGG + Intergenic