ID: 1160821128

View in Genome Browser
Species Human (GRCh38)
Location 19:1058693-1058715
Sequence TAGTGTGAAGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 752}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160821128_1160821135 26 Left 1160821128 19:1058693-1058715 CCCTCTTCCTTCTCTTCACACTA 0: 1
1: 0
2: 7
3: 72
4: 752
Right 1160821135 19:1058742-1058764 GCCACAGTTAGTGAGGTCTATGG 0: 1
1: 0
2: 0
3: 5
4: 115
1160821128_1160821133 19 Left 1160821128 19:1058693-1058715 CCCTCTTCCTTCTCTTCACACTA 0: 1
1: 0
2: 7
3: 72
4: 752
Right 1160821133 19:1058735-1058757 AACTCCTGCCACAGTTAGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160821128 Original CRISPR TAGTGTGAAGAGAAGGAAGA GGG (reversed) Exonic
902222121 1:14972992-14973014 TAATGTGAAGAGAAGGCATATGG - Intronic
903018709 1:20378741-20378763 TGGGGTGGAGACAAGGAAGAAGG - Intergenic
903083965 1:20838297-20838319 TAGTTTGAAGAGACAGAAAATGG + Intronic
903976657 1:27154662-27154684 TAGTGCAAAGGAAAGGAAGAAGG + Exonic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904692232 1:32302047-32302069 TAGTGTGAATTGAAGGTAGAGGG + Intronic
904960250 1:34327083-34327105 TAGTGAGAAGAGAGAGATGATGG - Intergenic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905410846 1:37766848-37766870 GAGCGTGAGGAGAATGAAGATGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905780567 1:40705392-40705414 TCCTGGGAAGAGAAGGCAGAAGG - Intronic
905884928 1:41486606-41486628 GACCGTGAAGAGAAGAAAGAAGG + Intergenic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906304659 1:44709260-44709282 TACAGAGATGAGAAGGAAGAGGG - Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907363563 1:53941628-53941650 TAGTTTTAAGAGGAGAAAGATGG + Intronic
907364505 1:53946972-53946994 TAGTGAGGCGTGAAGGAAGAGGG + Intronic
907588393 1:55642328-55642350 TAGAGAGAAGAGAATGAATAAGG - Intergenic
908427978 1:64026937-64026959 TACTTTGAAAAGAAGCAAGAAGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
908897662 1:68918680-68918702 GAAGGTGAAGAGGAGGAAGAGGG + Intergenic
908941578 1:69441221-69441243 TACTTTAAAGAGAAAGAAGAGGG - Intergenic
909388320 1:75086633-75086655 TTGTGGGAAGTGGAGGAAGAGGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909714288 1:78689155-78689177 TAGAATGAAAAGAAAGAAGAAGG - Intergenic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
910523934 1:88155884-88155906 TAGTGTGAAGTGGAGGATGGAGG - Intergenic
911005264 1:93214265-93214287 TAGTTTGGAGAGAAAGACGATGG + Intronic
911110470 1:94178742-94178764 TAGTGGGTACTGAAGGAAGATGG + Intronic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912600545 1:110928385-110928407 TAGTTTTAAGACCAGGAAGAAGG - Intergenic
912804973 1:112748506-112748528 TATTGGGAAGAGAAGGGAGGAGG - Intergenic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913449493 1:118983557-118983579 TTGTGTGAAGGGAAGCGAGAGGG - Intronic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914736741 1:150424960-150424982 TAGTCTGAAGTGAATGAAAAAGG - Intronic
914760525 1:150594842-150594864 TAGAGTGAAGAGAAAGCAGAAGG + Intergenic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
916821700 1:168404986-168405008 TAGTTTGGGGAAAAGGAAGAAGG - Intergenic
916831296 1:168494056-168494078 TATTGTGAAATGAAGGATGAAGG + Intergenic
916953708 1:169809437-169809459 TGGTGTCAAGAGAAGCAAGAAGG - Intronic
917039296 1:170786157-170786179 TATTGTGAAGGAAAGAAAGAAGG + Intergenic
917222323 1:172745159-172745181 TACTGTGAAGAGAAGTCACAAGG + Intergenic
917503704 1:175609192-175609214 TAGTGGGAAGAAGAGAAAGAAGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918526422 1:185469582-185469604 GAGCATGAAGATAAGGAAGAAGG + Intergenic
918555060 1:185789229-185789251 TTCTGTTAAGAGAAGGAACAAGG + Intronic
919260047 1:195180540-195180562 GAGTGGGGAGAGAAGAAAGAGGG - Intergenic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921332988 1:214058532-214058554 TAGTATGAAGAAAAGGAACTTGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921933583 1:220775669-220775691 GAGGGTGGAGAGTAGGAAGAGGG - Intronic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
923110543 1:230886417-230886439 GAGTGGGAAGAGAAGGAACCTGG - Intergenic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923407915 1:233681016-233681038 TAGTGTGTAGAAAATGAATATGG + Intergenic
923422771 1:233835514-233835536 TATTGAAAAGATAAGGAAGAGGG - Intergenic
924672407 1:246142861-246142883 TAGTGTGAAGACAAGTAAGAAGG + Intronic
924819737 1:247477332-247477354 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1064347691 10:14547992-14548014 TGGTCTGAAGAGAGGGAAGTGGG - Intronic
1064402582 10:15033944-15033966 TAGGGAGAAAGGAAGGAAGAAGG + Intronic
1064414821 10:15139982-15140004 TAGAGAGAAGAGAAGGAACTGGG + Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065204520 10:23344256-23344278 AGGTGTGGAGGGAAGGAAGAGGG + Intronic
1065334816 10:24645876-24645898 GAGTGAGAAGGAAAGGAAGAGGG + Intronic
1065954537 10:30682155-30682177 AAGTGTGAAAACAAAGAAGATGG - Intergenic
1066096569 10:32077876-32077898 TAGTATGAAAAGTGGGAAGAGGG + Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1067202479 10:44185346-44185368 AATTGAGAAAAGAAGGAAGAAGG + Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067316087 10:45164373-45164395 TAGGGTGAAGGGAAGCAACAGGG + Intergenic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1068749086 10:60570732-60570754 GAGTGTGGAATGAAGGAAGAAGG + Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1070544023 10:77438739-77438761 TGTTGTGGAGAGAAGGAATAAGG - Intronic
1070771087 10:79082700-79082722 TTGTGTGGAGTGAAGGACGATGG + Intronic
1071374261 10:84986547-84986569 TGGTTTGAAGAGTAGGAAGGAGG + Intergenic
1071503519 10:86219550-86219572 TAGTGTGCAGAGCAGGGAGAAGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072128360 10:92467599-92467621 TAGAGTCAAAAGAAGTAAGAAGG + Intronic
1072643137 10:97229155-97229177 TGGTCTGAAGGGAAGAAAGAGGG - Exonic
1073004873 10:100315548-100315570 TAGTTTGCTGAGAATGAAGAGGG + Intronic
1073152769 10:101323097-101323119 TAGGGTGAAGTGGAGGCAGAGGG + Intergenic
1073222055 10:101883112-101883134 TAGTTTGAAAAGTAGGAATAGGG + Intronic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1073473823 10:103740057-103740079 TAGTGGGCAGAGGAGGAAGGAGG + Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1074064182 10:109998151-109998173 TACTCTGAAGAGAAGAAAGAGGG + Intronic
1074733400 10:116401620-116401642 TGGTCTGGAGAGAATGAAGAAGG + Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076656641 10:132028505-132028527 TTGCAAGAAGAGAAGGAAGAGGG - Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1078368864 11:10728756-10728778 AAGTATGGAGAGAAGGCAGAAGG - Intergenic
1078727907 11:13948399-13948421 TAGTTAGAAGAGAAGGAATTTGG + Intergenic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1078877793 11:15415461-15415483 TAGTGGGAGGAGAAGGGAGGAGG + Intergenic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080180960 11:29425727-29425749 TAGTGTGAGAAAAAGTAAGAAGG - Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080425893 11:32154018-32154040 TAGTGTACAGGGCAGGAAGAAGG + Intergenic
1080797210 11:35575882-35575904 TTGTGAGAAGAGAAGGGAGCTGG - Intergenic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081475195 11:43422836-43422858 TATAGTGAAGAGCAGGAAAATGG + Intronic
1081493390 11:43583521-43583543 TATTGTGAAGGGAAGGGGGAAGG - Intronic
1081710742 11:45213868-45213890 TAGTGGGAAGAGGAGGCAGGGGG + Intronic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1082044908 11:47717436-47717458 AAGGCTGAAGAGAAGGAAAATGG - Exonic
1082992022 11:59214945-59214967 TAGTTTGAAGAGAAGTATGTAGG - Intergenic
1084441855 11:69179126-69179148 TGGGGAGAAGAGAAGGAAGGAGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1086187461 11:84035722-84035744 TTGTGTGAAGAGACTGTAGAGGG + Intronic
1086227652 11:84531624-84531646 TATTGTGAAGAGGAGGGAAAGGG - Intronic
1086271617 11:85074091-85074113 GAGTGTGGAGAGTAGGAGGAAGG + Intronic
1086271935 11:85078457-85078479 TGGAGTGAAGTGAAGGAAAAGGG + Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086474548 11:87157798-87157820 TGGAGAGAAGGGAAGGAAGAGGG + Intronic
1086719069 11:90098151-90098173 TAGTGTGGAGAGAAGTCATATGG + Intergenic
1086737939 11:90329953-90329975 TAGGGTGAAGAAGAAGAAGAAGG - Intergenic
1086895982 11:92313321-92313343 TATTGTGAAGTGGTGGAAGAAGG - Intergenic
1086911345 11:92475946-92475968 TAATGTGGAGCAAAGGAAGAAGG + Intronic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087183964 11:95166819-95166841 AAATGTGAAGAGAAAGAGGAAGG + Exonic
1087663728 11:101017936-101017958 TAGAGTTCAGAGAAGGGAGAAGG - Intergenic
1087730478 11:101772896-101772918 TGATGTGAAGACAAGGCAGAAGG + Intronic
1087788658 11:102384340-102384362 TCCTGAGATGAGAAGGAAGAGGG + Intergenic
1087798973 11:102483603-102483625 TAGTCTGTGGTGAAGGAAGAGGG - Intronic
1087923977 11:103898497-103898519 TAGTGTGAGGAACAGCAAGACGG - Intergenic
1087999838 11:104864510-104864532 TAGTGTGGAGAGTGGGAGGAGGG - Intergenic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1089377442 11:118004634-118004656 TAGTGTGAAGGTAAGGACGCCGG + Intergenic
1089556604 11:119318736-119318758 TGGTGTTAAGTGAAGGAAGGGGG - Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090693735 11:129215102-129215124 TACTGTGAAGTGATGGAAGGAGG - Intronic
1090746653 11:129710774-129710796 TCCTGAGTAGAGAAGGAAGAGGG + Intergenic
1090870179 11:130737577-130737599 AAGTGAGAAGGGAAGGGAGATGG + Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091094919 11:132811286-132811308 TGCTGAGAAGAGAAGTAAGAGGG - Intronic
1091179424 11:133590031-133590053 TTGTGAGAAGAGCAGGAATAAGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091858831 12:3760495-3760517 AAGCAAGAAGAGAAGGAAGAAGG + Intronic
1091929905 12:4387384-4387406 TTGTGTGCAGAGTAGGGAGAAGG + Intergenic
1092005290 12:5064231-5064253 CATTGGGAAGAGAAAGAAGAAGG + Intergenic
1092553588 12:9530744-9530766 TAATTTGAAAAGAATGAAGAAGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093148056 12:15590184-15590206 TCGGGAGAAGAGGAGGAAGACGG - Intronic
1093530403 12:20155046-20155068 GAGGGGGAAGAGAAAGAAGAAGG + Intergenic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1094120639 12:26970370-26970392 CCGTGTGAAGAGCAGTAAGAGGG - Intergenic
1094313646 12:29114132-29114154 TAGTGGGAATAGAAAGAAAAGGG + Intergenic
1094329686 12:29277580-29277602 TACTGTGAAGACAAAGAACACGG + Intronic
1094518509 12:31159882-31159904 TAATCTGAAAAGAATGAAGAAGG - Intergenic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095240744 12:39856190-39856212 TATTGATAAGAGAAGGTAGATGG - Intronic
1095731333 12:45509801-45509823 TAGTGTGAATAGAACAAAGCCGG - Intergenic
1096019197 12:48308004-48308026 TAAAGTGAACAGAAGAAAGATGG + Intergenic
1096207776 12:49737865-49737887 TAGTGTTGAGAGACGGAAGCTGG - Intronic
1096560489 12:52432652-52432674 TAGAGTGAAGAGAGGTAACAAGG - Intronic
1097210231 12:57362251-57362273 TAGGCTGAAGAGGAAGAAGAGGG - Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097756015 12:63407472-63407494 TAGTTTGAAGTGAGGGAATAGGG + Intergenic
1097937960 12:65274938-65274960 TACTGTGAAAAGAAGGACAATGG + Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098035478 12:66297518-66297540 GAGGGAGAAGAGAAGGAAGGAGG + Intergenic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098762624 12:74444352-74444374 TAAACTGAAGAAAAGGAAGAAGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099077757 12:78132457-78132479 AAGTATGAAGAGAATCAAGAGGG - Intronic
1099843220 12:87993684-87993706 GTGTGTGAAGAGTAGGAAGGAGG - Intronic
1100895868 12:99181944-99181966 TAGTGGGAGGATAAGGAGGAAGG - Intronic
1102403500 12:112651743-112651765 TAGGGAGAAGAGAATGGAGATGG - Intronic
1104710863 12:130984881-130984903 GAGAGAGAAGAGAAGAAAGAAGG - Intronic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1105817210 13:24047513-24047535 TTGTGAGAATAGAAGCAAGATGG + Intronic
1105836723 13:24218319-24218341 TAATCTGTAGGGAAGGAAGAGGG + Intronic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106487930 13:30189184-30189206 AGGTCTGAAAAGAAGGAAGATGG + Intergenic
1106610083 13:31270654-31270676 TAGTGTGGGGAGACGGAAGGAGG - Intronic
1107169776 13:37327151-37327173 TAGTGAGATGAGATTGAAGAGGG + Intergenic
1107285232 13:38782923-38782945 TAGTGGGAGGAAAAGGAGGAAGG - Intronic
1107387796 13:39931396-39931418 AAGTGAGAAGAGAAGAAGGAAGG + Intergenic
1107460899 13:40601110-40601132 TAGTCTGATGAAAGGGAAGATGG - Intronic
1107542347 13:41403046-41403068 GACTGTGAAGAGAAGGAAGCTGG - Intergenic
1108450469 13:50557571-50557593 TAGGTTGAAGAGAAAGATGAGGG - Intronic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1110459019 13:75723760-75723782 GAGTGAGAAGAAAAGGAAGGAGG + Intronic
1110527422 13:76555211-76555233 TACTGTGAAGAAAAGTAAGGTGG + Intergenic
1110559021 13:76890037-76890059 TGGTTTGAAGAGAAGGCAGTAGG - Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111623145 13:90749609-90749631 TAGTGTGAAGAAAATGAGGAGGG - Intergenic
1112446772 13:99471644-99471666 TAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1112527353 13:100163998-100164020 TGATGGGAAGAGAAGGAGGATGG - Intronic
1112979415 13:105363526-105363548 TACTGTGAAGAGACTGAAAAAGG - Intergenic
1113894546 13:113755294-113755316 GAGTGAGTAGAGAAGGAAGGTGG + Intergenic
1114430869 14:22659245-22659267 AAATGTTAAGAGAAGGCAGAGGG - Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1116070918 14:40044528-40044550 TTTTGTGAACAGAAGGCAGATGG - Intergenic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1119192872 14:72695696-72695718 AAGGGGGAAGGGAAGGAAGAGGG + Intronic
1119535826 14:75401718-75401740 GTGTGTCAAGGGAAGGAAGAGGG + Intergenic
1120022572 14:79547299-79547321 TAGTGTTAAAAGAAGATAGATGG - Intronic
1120111085 14:80557752-80557774 GAGTATGAAGAGAGGAAAGATGG - Intronic
1120117611 14:80638155-80638177 AAATATGAAGAGAAGGAAGAAGG - Intronic
1120119869 14:80666195-80666217 TAGTATGAAAAGAATAAAGAAGG + Intronic
1120241405 14:81953624-81953646 TAGTGTAGAGAGAAGGAAGCAGG - Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120856857 14:89220095-89220117 TAATGTGATGAGAAGAAAGGAGG - Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121066897 14:90975865-90975887 TAATGTGAACAGAAGATAGAAGG + Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121888046 14:97562576-97562598 TAGAAGGAAGAGATGGAAGAAGG + Intergenic
1121896019 14:97648555-97648577 TATTGTGAAGTGATGGAGGAAGG - Intergenic
1122107244 14:99467744-99467766 TACTGTTAAGAGAAGGGAAAGGG - Intronic
1122299403 14:100723404-100723426 TAGTGTTTAGAAAAGGAGGAGGG + Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122932074 14:104938208-104938230 TCCCCTGAAGAGAAGGAAGAGGG - Exonic
1123156730 14:106234456-106234478 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1123207503 14:106727557-106727579 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124192273 15:27590756-27590778 TAGCATGAAGGGAAGGAAGGAGG - Intergenic
1124196407 15:27634444-27634466 AAATGAGAAGAGAAGTAAGATGG - Intergenic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1124896238 15:33780051-33780073 TAGTGTCTAGAGAAAGAGGAGGG + Intronic
1125187480 15:36948124-36948146 AAGTGTGAAAATTAGGAAGATGG + Intronic
1125210130 15:37204940-37204962 TACTGTGGATAGAAGGAAAATGG + Intergenic
1125843087 15:42824024-42824046 TGGTGTGAAAGGAAGCAAGAAGG + Intronic
1126524019 15:49630185-49630207 TGGTGAGAGGAGAAGGAAGAAGG + Intronic
1126841701 15:52723567-52723589 TAGTGTGGAAAGGAGGGAGAAGG - Intergenic
1126937799 15:53730631-53730653 TAGGAAGAAGAGAAGGAAGTCGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127954338 15:63840025-63840047 TAGGGAGAAGGGAAAGAAGAAGG + Intergenic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128656113 15:69463142-69463164 TACTGGGAAGTGAAGGAAGAGGG - Intergenic
1128699863 15:69796302-69796324 TTGTGAGAAGAGATGGAAGAAGG + Intergenic
1128802128 15:70503653-70503675 TGGTGTGAAGAAAAGGGACAGGG - Intergenic
1129503557 15:76061819-76061841 TAGTGTGAAGGGCAGCAAGGAGG - Intronic
1130354789 15:83119301-83119323 TACTGTGATGCGAAGGCAGATGG - Intronic
1130428568 15:83823402-83823424 TAGTTTGAAAAGCAGGATGAAGG - Intronic
1130830125 15:87590873-87590895 TTGTGTGAAGAATAGTAAGAAGG + Intergenic
1130873303 15:87989976-87989998 GAGTGAGAAGAAAAGGAAAAGGG - Intronic
1130987546 15:88854629-88854651 TAGGGAGAAAAGAAGGCAGAAGG - Intronic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131177883 15:90221247-90221269 TGGTGGGCAGAGAAGGAAGCTGG - Intronic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1131958403 15:97762717-97762739 TCGTGGGATGAGAAGGAAGTCGG + Intergenic
1133371811 16:5251031-5251053 TAGTGTGAATAAAAGAAAGAGGG - Intergenic
1134745965 16:16588590-16588612 TAGACTGAAGAGCAGAAAGAGGG - Intergenic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1134999512 16:18765151-18765173 TAGACTGAAGAGCAGAAAGAGGG + Intergenic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135765417 16:25173596-25173618 TATTGTGAATAGTAGGAATATGG + Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138291877 16:55854866-55854888 GACTGAGAACAGAAGGAAGAAGG - Intronic
1138819936 16:60246743-60246765 TATTCTGAAGGGAAAGAAGATGG + Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139649911 16:68357028-68357050 TAGGAAGAAGAGCAGGAAGATGG - Intronic
1139821475 16:69724758-69724780 AAGTGAGAAGAGAAGGCAGAAGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140344140 16:74195817-74195839 TATTGGGAAGGGTAGGAAGATGG - Intergenic
1140416692 16:74778682-74778704 CAGTCCGAAGAGAAGGGAGAGGG - Intergenic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141476750 16:84279231-84279253 GAGTCTGAAGGGGAGGAAGAGGG + Intergenic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1143364380 17:6396310-6396332 GACTGGGCAGAGAAGGAAGAAGG + Intronic
1144184134 17:12780511-12780533 AATAGTGATGAGAAGGAAGAAGG - Intergenic
1144319529 17:14100776-14100798 CACTCTGAAGAGAAGCAAGATGG + Intronic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1145762568 17:27434374-27434396 AAATGTGCAGAGAAGAAAGATGG + Intergenic
1145838382 17:27972247-27972269 TAATTTACAGAGAAGGAAGAAGG + Intergenic
1146727435 17:35167743-35167765 TCTTGGGAAGAGAAGGAAGCAGG - Intronic
1146817666 17:35956135-35956157 AAGGGTGGAGAGTAGGAAGAGGG - Intergenic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147526887 17:41233356-41233378 TATCGTGAAAAGAAGAAAGAAGG - Exonic
1147726457 17:42568728-42568750 TGGTGTCCAGAGAAGGCAGATGG - Intronic
1148106790 17:45123217-45123239 TAGGAGGAAGAGAAGGGAGAAGG - Intronic
1148723483 17:49771954-49771976 TGGTGTGAAGGGAAGGGAGTGGG - Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1152558007 17:81064138-81064160 GAATGAGAAGAGGAGGAAGAAGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1153170725 18:2312829-2312851 AAGTGACAAGACAAGGAAGAGGG - Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153765732 18:8373050-8373072 TGGAGGGAAGAGAAGGAATAAGG + Intronic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1154481465 18:14830524-14830546 TAGGGTGAAGGGAAGCAACAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156111571 18:33733407-33733429 AGGTGTGGAGAAAAGGAAGAGGG - Intronic
1156163150 18:34384721-34384743 TAGTGGCAAGAGAAAGAGGAAGG - Intergenic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156721396 18:40074363-40074385 AAGTGTGAAAAGAACCAAGATGG + Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156874413 18:41990513-41990535 AAGTGTGATGATAAGGAATATGG + Exonic
1156920207 18:42513135-42513157 TAGTGTGGAAAGAAGGAGCAGGG + Intergenic
1157323768 18:46654639-46654661 GAGTGTGATGGGGAGGAAGAAGG - Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1158292779 18:55960047-55960069 TTGTTGGAAGAGAAGGGAGACGG + Intergenic
1158413662 18:57230862-57230884 CAGTATGAAGTGAAGGCAGAGGG - Intergenic
1158722745 18:59940244-59940266 TTGTATGTAGAGAAGGAATAAGG - Intergenic
1158794908 18:60833244-60833266 TACTGTGCAGTGGAGGAAGAAGG + Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159111433 18:64061218-64061240 TGTTATGAAGAAAAGGAAGACGG + Intergenic
1159478322 18:68953762-68953784 TAGTCTGAGGAGAAGGCAAATGG + Intronic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1160011131 18:75107796-75107818 GAGTCGGAAGAGAAGGAGGAAGG - Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162044690 19:7990801-7990823 TAGAGGGAAGAGGAGGAAGAGGG + Intronic
1162459371 19:10805332-10805354 TGATGAGAAGAGTAGGAAGAAGG + Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162603101 19:11684893-11684915 GAGTCTGAAGGTAAGGAAGATGG + Intergenic
1163327985 19:16617602-16617624 TGGGGTGGAGAGAAGGGAGAGGG - Intronic
1163389309 19:17020698-17020720 AAGGGTGGAGAGAAAGAAGAGGG + Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1164191440 19:22920884-22920906 GACTGTGTAGACAAGGAAGAAGG + Intergenic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1164591424 19:29509663-29509685 TGCTGTGCAGGGAAGGAAGATGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166397938 19:42456163-42456185 TAGTGTGATGAGAAGGAAGCAGG - Intergenic
1166735136 19:45079485-45079507 TGGGGTGAGGAGAAGGGAGAAGG + Intronic
1167809882 19:51820138-51820160 TAGTTTGAGGAGAAAGCAGAAGG + Intronic
1168461390 19:56561833-56561855 TGGTGTGAATAGAAGCAATATGG + Intergenic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925060657 2:887549-887571 TTGGGTCAAGACAAGGAAGAGGG - Intergenic
926303416 2:11619563-11619585 TAGTGTGAGGGTATGGAAGAAGG - Intronic
926349427 2:11981921-11981943 TACAGGGAAGAGAAGGAAGCAGG + Intergenic
926800377 2:16655032-16655054 TAGTGTGAAAGGGAGAAAGAGGG + Intronic
927127228 2:20022909-20022931 TGGTGTGGAGAGAAGGAGGTGGG - Intergenic
927420495 2:22925800-22925822 TAGTGTTATAAGAAGGTAGAGGG - Intergenic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
928855784 2:35801098-35801120 TAGTGAGAAGAGGAGGAGTATGG - Intergenic
928893819 2:36238300-36238322 TTGGAAGAAGAGAAGGAAGATGG - Intergenic
929227768 2:39527989-39528011 TAGGGTGAAGAAGAAGAAGAAGG - Intergenic
929855243 2:45632101-45632123 TGGTCTGAAGAGCAGGAAGAGGG + Intergenic
930047154 2:47182792-47182814 TATGGAGAAGAGAAAGAAGATGG - Intergenic
930495079 2:52131202-52131224 TCCTATGAAGAGAAGGAGGAAGG - Intergenic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
930872203 2:56181872-56181894 TGTTGGGAAGACAAGGAAGAAGG - Intergenic
931174072 2:59835313-59835335 AAGGGGGAAGGGAAGGAAGAAGG - Intergenic
931403888 2:61957061-61957083 TAGTTTTAATTGAAGGAAGATGG + Intronic
931769900 2:65488433-65488455 TGGTGTGAAAGGAAGGAAGATGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931982438 2:67708447-67708469 TATTGTAAAGTGAAGGAAGTAGG + Intergenic
932220550 2:69995734-69995756 AGGTGGGAAGAGCAGGAAGAAGG + Intergenic
932279337 2:70476211-70476233 TGGTTTGAAGAGATGAAAGAAGG - Intronic
932417513 2:71582577-71582599 TATAGTGAAGAGAGTGAAGATGG + Intronic
932646633 2:73509930-73509952 AAGTGTGAAGACAAGAAATATGG - Intronic
932730668 2:74219830-74219852 AAGTGGGATGAGAAGGAAGGTGG + Intronic
933158017 2:78995191-78995213 AAGTGGGGAGAGAATGAAGATGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
933560560 2:83880403-83880425 CAATGTGGAGAGTAGGAAGAGGG - Intergenic
933692959 2:85194011-85194033 TAGTGTGAAAAGATGGGAGAGGG + Intronic
934046788 2:88179093-88179115 AACTGTGAGGAGAAGGAAGGTGG + Intronic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
935402141 2:102671200-102671222 CAGTGAGAAGAGAAGAAACAAGG - Intronic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936625135 2:114140736-114140758 TTGTGTGATGAAAAGGAATAGGG - Intergenic
936853389 2:116928993-116929015 TAATGTGAAGAATGGGAAGATGG + Intergenic
937202060 2:120210094-120210116 TGGTGTGGAGAGAAGAAGGAAGG + Intergenic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
937777748 2:125800220-125800242 GAGTATGTTGAGAAGGAAGAGGG - Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
939058003 2:137385723-137385745 GAGTGAGAAGAGAAGGAGTAAGG + Intronic
939183682 2:138834389-138834411 TTTTGAAAAGAGAAGGAAGAAGG + Intergenic
939326667 2:140699602-140699624 TTGTGTGAAGAATAAGAAGATGG + Intronic
939472385 2:142640115-142640137 TAGAAAGAAAAGAAGGAAGAAGG - Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939834217 2:147108352-147108374 TAGTTGGAAGAGGAGGAAGCTGG - Intergenic
939895922 2:147791328-147791350 TAGTGTGCTTAGTAGGAAGAAGG - Intergenic
940437106 2:153668602-153668624 TAGGATGAAGGGAAGGAAGCTGG + Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
940686164 2:156853678-156853700 GAGGGTGAAGGGTAGGAAGAGGG + Intergenic
940687856 2:156876441-156876463 TACTGAAAGGAGAAGGAAGAAGG - Intergenic
940799983 2:158122890-158122912 TAATGAGAAGAGAAGGAACAAGG + Intronic
941561511 2:167051182-167051204 TAGTGTGAAGACACTGCAGATGG - Intronic
942337812 2:174909275-174909297 TTGTTTTAAGTGAAGGAAGAAGG - Intronic
942387179 2:175454892-175454914 TAGAGGGTAGAGTAGGAAGAGGG - Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943530218 2:189070453-189070475 TATGGTGGAGAGAAGCAAGAAGG + Intronic
943619594 2:190133483-190133505 TAGTGTGAAAAGCAGTATGAAGG + Intronic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943853890 2:192763543-192763565 AAGTGGGAAGAGTAGGGAGAAGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944825314 2:203477559-203477581 TCATATGAAGAGAGGGAAGAGGG - Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945141942 2:206696200-206696222 TAGAAAGAAGAGAAGGAATAAGG + Intronic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945488738 2:210429366-210429388 GAGTGTGAAGAGGAGGAGAAAGG + Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945685246 2:212960964-212960986 TACTGTAGAGACAAGGAAGAGGG + Intergenic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946927753 2:224642681-224642703 TGGTTTGAGGAGCAGGAAGAAGG + Intergenic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
948154535 2:235770814-235770836 TGGTGTGGTGAGCAGGAAGATGG + Intronic
948302035 2:236914749-236914771 TAATTTGAAGAAAATGAAGACGG + Intergenic
948480395 2:238246493-238246515 TACTGTGAAAACAAGGAAAAAGG - Exonic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948744448 2:240076702-240076724 TAGTAAGAAAAGAAGTAAGATGG + Intergenic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1169232590 20:3901573-3901595 AAGAGGGAAGAGAAGGGAGAAGG - Intronic
1169284856 20:4299471-4299493 CATTATGAAGAGAAAGAAGATGG + Intergenic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1170329519 20:15193127-15193149 GAGAGAGAAGAGAAAGAAGATGG - Intronic
1170358258 20:15516593-15516615 TGGTTTGAACAGAAGGTAGAGGG + Intronic
1170816725 20:19720490-19720512 TAGGGAGGAGAGAAGGAAAATGG + Intronic
1172523581 20:35584243-35584265 TAGGGTGGAGGGTAGGAAGAGGG - Intergenic
1172956564 20:38763847-38763869 TAATCTGAGGAGGAGGAAGATGG - Intronic
1173546555 20:43902497-43902519 AAGAGTGAAGGGAAGGCAGAAGG - Intergenic
1173575726 20:44112063-44112085 AAGTGTGAAGCTAAGGGAGAAGG + Exonic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174984913 20:55440281-55440303 TAGGGTGAAGAGGAGGAACTGGG + Intergenic
1175128840 20:56774127-56774149 TAGAGATCAGAGAAGGAAGAAGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1176799141 21:13406080-13406102 TAGGGTGAAGGGAAGCAACAAGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177101600 21:16903859-16903881 TAGTATGAAAATAAGGAAAATGG + Intergenic
1177507366 21:22036192-22036214 GAGGGTGAAGGGTAGGAAGAGGG - Intergenic
1177729837 21:25014647-25014669 AAGTGTGAAGAAATTGAAGAGGG - Intergenic
1178085428 21:29106974-29106996 GACTGCTAAGAGAAGGAAGATGG + Intronic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1179446133 21:41432052-41432074 TACTTTGCAAAGAAGGAAGATGG + Exonic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1181429879 22:22872856-22872878 TGGTGAGCAGAGAAGGACGAGGG - Intronic
1181506459 22:23361582-23361604 GACTGAGAACAGAAGGAAGAAGG - Intergenic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1182264202 22:29100056-29100078 TAGTGAGAAGGGAAGAAAGAAGG - Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183415164 22:37677469-37677491 GAATGAGAAGTGAAGGAAGAAGG - Intronic
1183806934 22:40219620-40219642 GAGTGTGAAGCGCAGGAAGGAGG - Intronic
1184661365 22:45967070-45967092 GAGTGGGAAGACAAGGAAGGGGG + Intronic
1184931223 22:47682594-47682616 GAGTGGGAAGAGAACCAAGAGGG - Intergenic
1185214325 22:49589843-49589865 GAGTGGGAAGAGAAGAAGGATGG - Intronic
1203293677 22_KI270736v1_random:19951-19973 GACTGTGATGAGAACGAAGAGGG - Intergenic
949977549 3:9474848-9474870 AAGGATGAAGAGAAAGAAGACGG + Intronic
950167627 3:10813820-10813842 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950167643 3:10813909-10813931 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950332831 3:12170037-12170059 TAAAGGGAAGGGAAGGAAGAGGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
953551036 3:43903237-43903259 TCTTTTTAAGAGAAGGAAGAAGG + Intergenic
954213657 3:49112209-49112231 TGGTGTGAAGGGAAGGAGCAGGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954747408 3:52794975-52794997 TGGAGTGAAGAGGAGGCAGAGGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955242057 3:57186949-57186971 GAGTGTGAGGGGAAGCAAGACGG + Intergenic
956880693 3:73508118-73508140 TATTGTGAAGAGTGGGAACAGGG - Intronic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
957901034 3:86490384-86490406 TAATGTGGGGAGAAGCAAGAAGG + Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
959053730 3:101549206-101549228 TAGAGTGAAGTCATGGAAGAAGG + Intergenic
959099000 3:101989157-101989179 TAGTTTGAAGTGATGGAGGAGGG + Intergenic
959199730 3:103231464-103231486 TAGTTTCATGAGTAGGAAGAGGG - Intergenic
959233207 3:103684319-103684341 TAATGTGATGAGAAGGAGAAAGG + Intergenic
960018999 3:112928020-112928042 AAGTTTGAAGGAAAGGAAGAAGG + Intronic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960863809 3:122180564-122180586 ATGTGTGAAGACAAGGAAGCTGG + Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
962014996 3:131430676-131430698 TAATGTTAACAGAAGCAAGATGG + Intergenic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962273371 3:133994554-133994576 TCATGTGGGGAGAAGGAAGAGGG - Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
964237289 3:154546229-154546251 TAGTGTGAAAAAAAGGCATAGGG + Intergenic
964531790 3:157676121-157676143 TGGTGTGGGGAGAAGGGAGATGG - Intronic
965401310 3:168215985-168216007 TTGTGTGGAATGAAGGAAGAGGG + Intergenic
966114151 3:176441328-176441350 TAGTATGAATAGATGGAAAATGG + Intergenic
966649135 3:182279819-182279841 TATTGACAAGAGAATGAAGATGG + Intergenic
967107101 3:186262810-186262832 TAGTCTGCAAAGAAGGAAGTGGG - Intronic
967276925 3:187784865-187784887 TGGGGTGAGGAGAAGGGAGATGG + Intergenic
967426218 3:189330312-189330334 TAGTAGGAAGATCAGGAAGAAGG + Intergenic
968039649 3:195578566-195578588 TAGCGGGAGGGGAAGGAAGAGGG - Intronic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
969003509 4:4001594-4001616 TAATGTGTAGAGAAGGGAGGGGG + Intergenic
969174656 4:5389450-5389472 TCTTGTGAAGAGCAGCAAGAAGG - Intronic
969824203 4:9744076-9744098 TCATGTGAAGACAAGCAAGAAGG - Intergenic
969979682 4:11141814-11141836 TATTGTGAAGTTCAGGAAGAGGG - Intergenic
970266873 4:14297977-14297999 GAGTGAGAAGAGAAGGGAAAGGG + Intergenic
970459657 4:16260587-16260609 TAGTGAGAAGAAATGGAGGAAGG + Intergenic
970770563 4:19607208-19607230 AAGTGTGCAGGGAAGTAAGAGGG - Intergenic
971046346 4:22809438-22809460 TAGTGTGAAAAGAAAGAAGTGGG - Intergenic
971300958 4:25442170-25442192 TAGAGAGAAAGGAAGGAAGAGGG + Intergenic
971806341 4:31362746-31362768 TAATGAGAAAAGGAGGAAGATGG + Intergenic
972086123 4:35218870-35218892 TAGGCTGAGGAGAAGAAAGAGGG - Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972846291 4:42994646-42994668 TATTGTGAAGAAGAGGAATAGGG + Intronic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
974606043 4:64151825-64151847 TAGTGTGAAAGGAAGGATGTGGG - Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
974882410 4:67775894-67775916 GAGTGGGAAGAAAAGGAAAAGGG - Intergenic
975156911 4:71082372-71082394 GAGTAGGAAGACAAGGAAGATGG - Intergenic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
975936077 4:79582512-79582534 TGGTGTGAAGAGGAGGAGGATGG + Intergenic
975936648 4:79589302-79589324 TGGTGTGACGAGGAGGATGATGG + Intergenic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
977315034 4:95435697-95435719 TACTGTGAAGAGGTGGAAGGAGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978399203 4:108313210-108313232 TTATGTGAAGAGAAATAAGATGG - Intergenic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
978978790 4:114915841-114915863 GAGAGGGAAGGGAAGGAAGAGGG + Intronic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979370513 4:119880460-119880482 GAGGGTGAAGTGTAGGAAGAGGG + Intergenic
979444636 4:120797136-120797158 TAACTTGAAGAGAAAGAAGAAGG + Intronic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980061048 4:128130046-128130068 TACTGTCAAGAGAATGAGGAAGG + Intronic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980902640 4:138919569-138919591 TCGTGTGGAGAGAAGCAAGGGGG - Intergenic
981073617 4:140569447-140569469 TAGTGGGAAGAGAAGGAATCCGG - Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981983483 4:150825914-150825936 TATTGTAAAGAAAAGGAAGTTGG + Intronic
982123459 4:152163652-152163674 TGGTGAGCAGAGAAGGGAGAGGG - Intergenic
982629693 4:157816756-157816778 TAGTGGTGAGAGAAGGTAGATGG + Intergenic
982656893 4:158161449-158161471 AAGTGTGAAGTCAAGGAAGCAGG + Intronic
983151104 4:164282537-164282559 TAATGGGAAGTGAAGCAAGACGG - Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983595856 4:169467003-169467025 TAGGCTGAAGAGGAGGAAGTTGG - Intronic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
984894814 4:184528927-184528949 TGTTGTGAAGAGAAGTGAGATGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
986347105 5:6845890-6845912 TAGTGAGGAGAGAGGAAAGAAGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
986774917 5:11005576-11005598 TAGAGTGGAGATAAGAAAGAAGG + Intronic
987192564 5:15493258-15493280 TGGTCAGAACAGAAGGAAGAGGG - Intergenic
987733915 5:21813633-21813655 TGGAATGAAGTGAAGGAAGAGGG - Intronic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988418697 5:30978683-30978705 TAAGGTGAAGGGAGGGAAGAAGG + Intergenic
988716048 5:33829439-33829461 TGGTGAGAAGAGAAGAAGGATGG - Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989504518 5:42211719-42211741 GAGGGTGAAGGGTAGGAAGAAGG - Intergenic
990155690 5:52874606-52874628 TTGGGTGCAGAGAAGAAAGAGGG - Intronic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
990973741 5:61538788-61538810 TAATGAGAAGACAAGGAAGGTGG - Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991510061 5:67366131-67366153 GAGTGAGAAGAGGAGTAAGAAGG + Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992961574 5:81960902-81960924 TTCTATGAAGAGAAGGAAAAAGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
995615677 5:113960549-113960571 TAGTGTGAAGACAAGGGGAATGG + Intergenic
995778575 5:115751765-115751787 TTGCGTTAAGAGAAGAAAGAGGG + Intergenic
996432737 5:123399904-123399926 TAGTATGAGGAGACTGAAGAGGG + Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997231723 5:132250176-132250198 TAGGGTGAAAAGAAGAAATAAGG - Intronic
997393348 5:133534907-133534929 TAATGAGAAAAGAAGGAAAAAGG + Intronic
997420212 5:133760729-133760751 TAGAGTGAGAAAAAGGAAGAGGG + Intergenic
998355808 5:141535333-141535355 TAGTCTGAAAAGAATGCAGAAGG - Intronic
998377110 5:141698482-141698504 AAGGCGGAAGAGAAGGAAGAGGG - Intergenic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
998633760 5:143929795-143929817 TATTTTGCAGAGAAGGAAAAAGG - Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999721348 5:154401277-154401299 TAATATGAAGACAAGGAAGCTGG + Intronic
999885027 5:155912742-155912764 GAAAGAGAAGAGAAGGAAGAGGG - Intronic
1000021519 5:157322911-157322933 TAGATAGGAGAGAAGGAAGAGGG - Intronic
1000357828 5:160417929-160417951 TAGTTAGTAGAGAAGGAAGCGGG - Intronic
1000513855 5:162216285-162216307 TAGTGTAAAGAGGGTGAAGAGGG - Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000850561 5:166334998-166335020 GAGTATGAAGAGAAGAAAGAAGG + Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1002874452 6:1199354-1199376 TCATGAGAAGAGATGGAAGAGGG + Intergenic
1003020929 6:2508827-2508849 TATTTTGGGGAGAAGGAAGAGGG + Intergenic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1004330838 6:14719306-14719328 TGGTAAGTAGAGAAGGAAGATGG - Intergenic
1005149089 6:22727726-22727748 TGGTGGTAAGAGAAGGGAGAAGG - Intergenic
1005441997 6:25880094-25880116 TAGATTTAAGAGAAGGGAGAAGG - Intronic
1006574904 6:35037905-35037927 TGGTGGTAAGAGAAGGGAGAGGG + Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1009633815 6:66236718-66236740 TAGAGTGAGTATAAGGAAGAGGG - Intergenic
1009993405 6:70871900-70871922 TATTTTGAAGAGAATGAAAATGG - Intronic
1010025752 6:71214359-71214381 TAGTCTGAAAAGATGAAAGAAGG + Intergenic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010456325 6:76060128-76060150 TATGGTGAAGAGAATTAAGATGG + Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010941111 6:81918681-81918703 TATTGAGAAGAGAAGCAAAAGGG - Intergenic
1010971776 6:82270546-82270568 AAGTGAGAAGAGTTGGAAGAGGG + Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011302140 6:85887600-85887622 AGGGGTGAAGAGAATGAAGAAGG - Intergenic
1011568840 6:88712018-88712040 TAGTCTAAAGAGAAGCAAGCTGG + Intronic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1011827424 6:91325859-91325881 TAGTATGAAGTGAATGAACAGGG - Intergenic
1011871815 6:91903977-91903999 TAGTGTGAAGGGTGGGAGGAGGG + Intergenic
1013423347 6:109986936-109986958 TAGAATGAAGAAAAGGAAAAGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013761599 6:113524831-113524853 TAATGAGAGAAGAAGGAAGAGGG + Intergenic
1013937657 6:115617454-115617476 TACTGTGAAGAGATAGAACAAGG - Intergenic
1013990829 6:116252659-116252681 CAGTATGAAGAGAAAGCAGATGG + Exonic
1014089207 6:117384626-117384648 TATTTTGAAGAGAAAGATGATGG - Intronic
1014311309 6:119805491-119805513 TAGTGGGAAGAGGAACAAGAGGG - Intergenic
1014760677 6:125353381-125353403 AAGGGTGAGGAAAAGGAAGAAGG + Intergenic
1014894675 6:126887346-126887368 TAGTGTTACAAGAAGGAATATGG + Intergenic
1015391772 6:132690414-132690436 TGGTGTGAAGAGCATGAACAAGG - Intronic
1015396777 6:132743292-132743314 TAGTATTAAGAGAAGAAATATGG - Intergenic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1015912233 6:138180480-138180502 TAGTAGGGAGAAAAGGAAGAAGG - Intronic
1016199643 6:141393098-141393120 TAGAAGGAAGAAAAGGAAGAGGG + Intergenic
1016583897 6:145662157-145662179 GAGAGAGAAGAGAAGGAAGTGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018604292 6:165580696-165580718 TGGTGTAATGAGAAAGAAGATGG + Intronic
1020470939 7:8533834-8533856 TGGTGTCAAGGGGAGGAAGAAGG + Intronic
1020617578 7:10478239-10478261 AAGTGGGAAGAGAAGTAATAAGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1020908819 7:14102177-14102199 AAGTGTGGAGAAAAAGAAGATGG - Intergenic
1021181767 7:17514607-17514629 TTATTTGAAGAGAAGGAAGTAGG - Intergenic
1021849296 7:24791896-24791918 TAGTGTTGGGAGAAGGAAGCTGG + Intergenic
1021956358 7:25828828-25828850 TAGTGTGGGGAGATGGAAAATGG + Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023357353 7:39380763-39380785 CACTGTGAAGAGAACCAAGAAGG - Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1023553746 7:41398601-41398623 TACTTTGAAGAGACTGAAGAAGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024525408 7:50344414-50344436 ATGTGTGAAGAGAAGGAACCTGG - Intronic
1024587441 7:50854224-50854246 TTGAGAGAAGAAAAGGAAGATGG + Intergenic
1026412254 7:70135833-70135855 TGGTGTGAAGAGATGCCAGATGG - Intronic
1026658078 7:72274903-72274925 TTGTGTAAAGAGAAGAAATAGGG + Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028600157 7:92592183-92592205 GCCTGTGAAGATAAGGAAGATGG + Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028793813 7:94881879-94881901 TAGTGTTGAGAGACGGAAGCTGG - Intergenic
1028889310 7:95969252-95969274 AAGACTGAAGATAAGGAAGATGG + Intronic
1029032414 7:97482842-97482864 TAGTGGGAAAAGAAGGTTGAAGG - Intergenic
1029154389 7:98504813-98504835 TGGTGGGGAGAGAAGGCAGATGG + Intergenic
1029634664 7:101775938-101775960 TATTGTGAAATGAGGGAAGATGG - Intergenic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1031437774 7:121753645-121753667 TGCTGAGAAGAGAAGGAATAGGG - Intergenic
1031490406 7:122380907-122380929 TAGCTTGAAGAGAAGGAAAACGG + Intronic
1032121232 7:129158534-129158556 TAGAGTGAAGGGTAGGAGGAAGG - Intronic
1032190034 7:129759596-129759618 TAGTGAGGAAAGGAGGAAGAAGG + Intergenic
1032856029 7:135834315-135834337 TCATGAGCAGAGAAGGAAGAAGG + Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033207517 7:139435711-139435733 TCGTGTTAAGGGAAGGAAGTCGG - Intergenic
1033483519 7:141764871-141764893 AAGTAAGAAGAGAAAGAAGAAGG - Exonic
1033546838 7:142408977-142408999 TAGTGGGCAGACAAGGAAGTAGG - Intergenic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1034870948 7:154683481-154683503 TGGTGGGAACAGAAAGAAGAAGG - Intronic
1034997062 7:155584255-155584277 TCGTATGGAGAGAAGGAAGCCGG + Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036517030 8:9453827-9453849 TAATAAGAAGAGGAGGAAGAAGG + Intergenic
1036962921 8:13265670-13265692 AAGGAAGAAGAGAAGGAAGAAGG - Intronic
1037446421 8:18970575-18970597 TGCTGTTAAGAGAAGGAAGATGG - Intronic
1037663929 8:20951497-20951519 AAGAGAGAAGGGAAGGAAGAAGG + Intergenic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1038110242 8:24488625-24488647 AAGTCAGAAGAAAAGGAAGATGG + Intronic
1038730684 8:30124286-30124308 TACTGGGTAGATAAGGAAGAAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040099731 8:43488177-43488199 TAGGCTGAAGAGGAGAAAGAGGG + Intergenic
1040702570 8:50085339-50085361 TAGAAGGAAGAGAAGAAAGAAGG - Intronic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1041443428 8:57924259-57924281 TAATGTGTAGAGAAGTGAGAAGG + Intergenic
1041548038 8:59068815-59068837 TAAAGTTAAGATAAGGAAGAGGG + Intronic
1041746147 8:61211308-61211330 AAAGGGGAAGAGAAGGAAGAGGG - Intronic
1042841845 8:73131827-73131849 AGTTGTGAAGAGAAGGAGGAAGG - Intergenic
1043074324 8:75676991-75677013 AAGTATGAAGGGAAGGAAGGAGG + Intergenic
1043701458 8:83293241-83293263 TGGTGTGACGATAAGGGAGAGGG - Intergenic
1043784298 8:84378182-84378204 TAGTTTGCAGAGAATTAAGAAGG - Intronic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1044426637 8:92059049-92059071 GAATGTAAAGAGAAGGGAGAGGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045248250 8:100461768-100461790 TCTTGTGCAGAGAAGGAAGCGGG + Intergenic
1045458166 8:102402584-102402606 AAGTGAGAAGTGGAGGAAGATGG - Intronic
1045989353 8:108287596-108287618 TAGTGTGATAAGCAAGAAGATGG - Intronic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046184472 8:110694611-110694633 AAGTATGAAAAGGAGGAAGAAGG + Intergenic
1046295334 8:112211992-112212014 TATTGTGTAGAGGAGGAACAAGG + Intergenic
1046778225 8:118186657-118186679 TAGTGAGAAAAGAAGAAAAAGGG - Intergenic
1046957897 8:120080670-120080692 AAGTGTGAAGAAGAGAAAGAGGG + Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047151767 8:122272088-122272110 AAGTTTGAAGGGAAGAAAGAAGG - Intergenic
1048132526 8:131713628-131713650 TAGTGTGAAAAATAGGAACATGG - Intergenic
1048213733 8:132478310-132478332 AGGTGGGAAGAGAAGAAAGAGGG + Intronic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048551653 8:135438887-135438909 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551657 8:135438914-135438936 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049198896 8:141330315-141330337 TTGTGAGAAGAAGAGGAAGAGGG - Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1051017270 9:12494006-12494028 TAGTATAAAGAAAATGAAGAGGG - Intergenic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051909372 9:22135336-22135358 TTGTGTGAAGAGAAGAAGGGTGG + Intergenic
1052432984 9:28391567-28391589 AATTGTGAAAAGAAGGAAAAAGG - Intronic
1052753896 9:32521340-32521362 TGGGGGGAAGAAAAGGAAGAGGG + Intronic
1053595026 9:39551818-39551840 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1053852808 9:42306846-42306868 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054454022 9:65420404-65420426 AAATGGGATGAGAAGGAAGAAGG + Intergenic
1054805978 9:69396081-69396103 TAGAATGCAGAGCAGGAAGAGGG + Intergenic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1056286437 9:85092079-85092101 GAGTGTGAAGAGAAGAGAGCAGG + Intergenic
1056517451 9:87368659-87368681 TAGTCTGCAGTGTAGGAAGAGGG - Intergenic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057575538 9:96239250-96239272 TAGTGAGAGGGGCAGGAAGAAGG + Intronic
1057698320 9:97343337-97343359 TAGGAAGAAGACAAGGAAGAGGG + Exonic
1057776550 9:98015354-98015376 TACTGTACAGAGGAGGAAGAAGG + Exonic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058721475 9:107768503-107768525 TAGGGTGGAGAGCAGGAAGGGGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059823210 9:117997170-117997192 GAATGTGAAGAAAAAGAAGAGGG - Intergenic
1060377602 9:123131201-123131223 TAGTGTGAAGAACAGGAGGTAGG - Intronic
1060846220 9:126839553-126839575 TCTTGTGAGGAGAAAGAAGATGG + Intergenic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1061791737 9:133062757-133062779 GAGTGTGGAGAGCAGGCAGACGG + Intronic
1061795413 9:133083323-133083345 GAGTGTGGAGAGCAGGCAGACGG + Intronic
1061900886 9:133671404-133671426 TGGTGTGGAAAGAAGGAAGCCGG + Intronic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1185586315 X:1244376-1244398 GAATGTGAAGGGAAGGAAGAAGG + Intergenic
1186402589 X:9273567-9273589 AAGGATGAAGAAAAGGAAGAAGG + Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187099688 X:16180729-16180751 TAATGTGTAGGGAAGGAAGGGGG + Intergenic
1187131321 X:16506037-16506059 AAGTGAAAAGACAAGGAAGAAGG + Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1189119211 X:38376053-38376075 TACTGCTAAGTGAAGGAAGAGGG + Intronic
1189296409 X:39921388-39921410 TTGTGTATAGAGGAGGAAGAGGG - Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190070723 X:47277080-47277102 GAGTGAGAAAAGCAGGAAGAAGG + Intergenic
1190462085 X:50686893-50686915 TCTTGTGAACAGAAGGAAGCAGG + Intronic
1190625562 X:52335215-52335237 TAGTGTTAAAATTAGGAAGAAGG - Intergenic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1192499625 X:71641438-71641460 TAGTTTAGAGAGAAAGAAGAAGG - Intergenic
1194530236 X:95038671-95038693 TAGAGTGAAGAAAATGAAGTAGG - Intergenic
1194752742 X:97702882-97702904 TATTGTTAAGAGAAAGCAGAAGG + Intergenic
1196124219 X:112082340-112082362 TAGTGTGAAGGAGAGGGAGAAGG + Exonic
1196885297 X:120239023-120239045 TAGAGTCAAGAGAAAGAACATGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197034020 X:121853535-121853557 TGGGCTGAAGAGAAGGAAGCTGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197826357 X:130594530-130594552 AAGTGTGCAGAGACAGAAGAAGG + Intergenic
1198236791 X:134742901-134742923 TAATGTAAAAAGAAAGAAGAAGG + Intronic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1198421675 X:136474701-136474723 GAGAGTGAAGGGAAGTAAGATGG + Intergenic
1198430000 X:136555929-136555951 TAATGTGCAGAGAAGGCAAATGG + Intronic
1198570345 X:137948327-137948349 TAGGTTGAAGACAATGAAGAGGG + Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201422858 Y:13819132-13819154 TTTTGTGAAGAAGAGGAAGAAGG - Intergenic