ID: 1160823013

View in Genome Browser
Species Human (GRCh38)
Location 19:1067097-1067119
Sequence CTCCCGAAGGCGGAAGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 577}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160823002_1160823013 4 Left 1160823002 19:1067070-1067092 CCACCCCGCGAGCGGCGCGGCTC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160823003_1160823013 1 Left 1160823003 19:1067073-1067095 CCCCGCGAGCGGCGCGGCTCCGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160822999_1160823013 10 Left 1160822999 19:1067064-1067086 CCGGTCCCACCCCGCGAGCGGCG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160823001_1160823013 5 Left 1160823001 19:1067069-1067091 CCCACCCCGCGAGCGGCGCGGCT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160822998_1160823013 11 Left 1160822998 19:1067063-1067085 CCCGGTCCCACCCCGCGAGCGGC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160822995_1160823013 30 Left 1160822995 19:1067044-1067066 CCAGCGTCAGGCAGGGGCTCCCG 0: 1
1: 0
2: 0
3: 49
4: 245
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160823005_1160823013 -1 Left 1160823005 19:1067075-1067097 CCGCGAGCGGCGCGGCTCCGAGC 0: 1
1: 0
2: 1
3: 13
4: 97
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577
1160823004_1160823013 0 Left 1160823004 19:1067074-1067096 CCCGCGAGCGGCGCGGCTCCGAG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG 0: 1
1: 0
2: 1
3: 23
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160823013 Original CRISPR CTCCCGAAGGCGGAAGCGGG GGG Intronic
900112916 1:1016302-1016324 CTTTGGAAGGCTGAAGCGGGCGG - Intergenic
900304306 1:1996226-1996248 CTTCGGAAGGCTGAGGCGGGCGG - Intronic
900792449 1:4689430-4689452 CCCAGGAAGGCGGAGGCGGGGGG + Intronic
901021517 1:6258370-6258392 CTTCGGGAGGCCGAAGCGGGTGG - Intronic
901120831 1:6892031-6892053 CTCCTGATGGCAGAAGTGGGTGG - Intronic
901311900 1:8275972-8275994 CTCCGGGAGGCCGAGGCGGGCGG - Intergenic
901766103 1:11501155-11501177 CTCCAGAAGCCCGAAGCTGGGGG - Exonic
902167077 1:14581239-14581261 TTCCCGAATGCGGAAGGCGGTGG - Intergenic
902236199 1:15059178-15059200 CTTCGGGAGGCGGAAGAGGGAGG - Intronic
902432450 1:16373844-16373866 CTCCGGGAGGCTGAAACGGGAGG - Intronic
903046334 1:20566747-20566769 CTCTGGGAGGCCGAAGCGGGAGG + Intergenic
903061688 1:20672979-20673001 CTTTGGAAGGCCGAAGCGGGCGG + Intronic
903501203 1:23800921-23800943 CCGCGGAAGGCGGAAGTGGGCGG + Intergenic
903587288 1:24425826-24425848 TTTCCGAAGGCAGAAGCAGGGGG - Intronic
903683836 1:25116598-25116620 CTCCCGAAGGCTTGAGTGGGAGG + Intergenic
904115447 1:28158454-28158476 CTTCGGGAGGCCGAAGCGGGTGG + Intronic
904189661 1:28733807-28733829 CTGCGGGAGGCCGAAGCGGGCGG - Intergenic
905572822 1:39019311-39019333 CTTTGGGAGGCGGAAGCGGGTGG - Intergenic
905579582 1:39073989-39074011 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
907055072 1:51358945-51358967 CTTTGGAAGGCCGAAGCGGGCGG - Intronic
907122112 1:52016999-52017021 CTTCGGGAGGCCGAAGCGGGTGG + Intergenic
907202812 1:52742597-52742619 CTTTCGGAGGCGGAGGCGGGCGG + Intronic
907766225 1:57413496-57413518 CTTTGGGAGGCGGAAGCGGGTGG + Intronic
907806774 1:57828186-57828208 CTTTGGAAGGCGGAGGCGGGCGG - Intronic
908317523 1:62947885-62947907 CTTTGGAAGGCCGAAGCGGGCGG + Intergenic
909087040 1:71180620-71180642 CTCTGGGAGGCTGAAGCGGGTGG + Intergenic
909649479 1:77958033-77958055 CTTCGGAAGGCTGAGGCGGGCGG - Intronic
910867376 1:91800839-91800861 CTTCAGGAGGCCGAAGCGGGTGG + Intronic
912382464 1:109254846-109254868 CTCCAGGAGGCGGAAGAGGGAGG + Intronic
912767679 1:112430479-112430501 CTCTGGAAGGCCGAGGCGGGTGG - Intronic
913178402 1:116296327-116296349 CTTCCAAAGGCTGAGGCGGGTGG + Intergenic
913576514 1:120180666-120180688 CTCCGGAAGGCCGAGGCGGGTGG + Intergenic
914227165 1:145730209-145730231 ATTCGGAAGGCGGAAGCAGGAGG + Intronic
914267613 1:146051519-146051541 CTTTGGGAGGCGGAAGCGGGTGG - Intergenic
914389669 1:147208680-147208702 CTCTGGGAGGCGGAGGCGGGTGG - Intronic
914558420 1:148792104-148792126 CTCCGGAAGGCCGAGGCGGGTGG + Intergenic
914614415 1:149338126-149338148 CTCCGGAAGGCCGAGGCGGGTGG - Intergenic
914795553 1:150917224-150917246 CTTCAGGAGGCCGAAGCGGGTGG - Intergenic
915151507 1:153835964-153835986 CTCTGGAAGGCTGAGGCGGGAGG - Intronic
915547826 1:156612265-156612287 CTTTGGAAGGCAGAAGCGGGTGG - Intergenic
915930559 1:160058194-160058216 CTTCCGAAGGATGAAGTGGGTGG - Intronic
916306915 1:163346609-163346631 CTTCGGAAGGCTGAGGCGGGAGG + Intronic
916542909 1:165774397-165774419 CTCTGGAAGGCCGAGGCGGGTGG - Intronic
918629204 1:186695515-186695537 CTTTGGAAGGCCGAAGCGGGCGG + Intergenic
918643126 1:186868319-186868341 CTTTGGGAGGCGGAAGCGGGCGG - Intronic
919796012 1:201322039-201322061 CTCCAGCTGGCGGTAGCGGGTGG - Exonic
922308957 1:224369915-224369937 CTCCAGGAGGCCGAGGCGGGAGG - Intronic
922969138 1:229719569-229719591 CTCATGAAGGCTGAAGTGGGAGG - Intergenic
923125938 1:231034527-231034549 CTCTGGGAGGCTGAAGCGGGCGG + Intronic
923140484 1:231158325-231158347 CTCTGGAAGGCCGAGGCGGGTGG - Intergenic
923332564 1:232939257-232939279 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
923389106 1:233496214-233496236 CTTCGGAAGGCGGAGGCAGGAGG - Intergenic
923815305 1:237370901-237370923 CTCCGGAAGGCCGAGGCAGGCGG - Intronic
923816117 1:237380832-237380854 CTCTGGAAGGCCGAGGCGGGTGG + Intronic
924293225 1:242559516-242559538 CTTTGGAAGGCCGAAGCGGGCGG - Intergenic
924534617 1:244924210-244924232 CTCCGGGAGGCCGAGGCGGGCGG - Intergenic
1062887783 10:1032106-1032128 CTTCAGGAGGCTGAAGCGGGCGG - Intergenic
1063413494 10:5854645-5854667 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
1064200764 10:13283062-13283084 CTTCCGGAGGCTGAGGCGGGAGG - Intronic
1064254767 10:13734155-13734177 CACCTGTAGGCGGAAGAGGGAGG - Intronic
1064355179 10:14610098-14610120 CTTCCGGAGGCCGAGGCGGGTGG + Intronic
1064956117 10:20912341-20912363 CTCCAGGAGGCCGAAGTGGGAGG + Intronic
1064972188 10:21077359-21077381 CTTTGGAAGGCTGAAGCGGGTGG + Intronic
1065525289 10:26613944-26613966 CTTCGGGAGGCTGAAGCGGGTGG + Intergenic
1065536318 10:26718284-26718306 CTCTGGAAGGCTGAGGCGGGCGG - Intronic
1067028020 10:42860466-42860488 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1068174865 10:53445164-53445186 CTTTCGGAGGCCGAAGCGGGCGG - Intergenic
1068481235 10:57591152-57591174 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
1068542535 10:58311776-58311798 CTTCGGGAGGCTGAAGCGGGCGG + Intergenic
1068871553 10:61950423-61950445 CTCCGGAAGGCCGAGGTGGGAGG + Intronic
1069441684 10:68434402-68434424 CTTCAGAAGGCTGAAGCAGGAGG + Intronic
1069441984 10:68437390-68437412 CTCCAGGAGGCCGAGGCGGGTGG + Intronic
1069445860 10:68472489-68472511 CTTCGGAAGGCTGAGGCGGGAGG + Intergenic
1070897186 10:79995046-79995068 CTCTGGGAGGCTGAAGCGGGTGG - Intergenic
1071856498 10:89630733-89630755 CTTCGGAAGGCCGAGGCGGGCGG - Intronic
1073544562 10:104337684-104337706 GTCCCGAAAGAGGAAGCGGCGGG + Intronic
1074491534 10:113943473-113943495 CTTTGGAAGGCGGAGGCGGGTGG + Intergenic
1076149148 10:128149241-128149263 CTTTGGAAGGCGGAGGCGGGCGG - Intergenic
1077064298 11:632962-632984 CTTCGGAAGGCCGAGGCGGGTGG - Intergenic
1077609004 11:3632577-3632599 CTTTCGAAGGCAGAAGCAGGAGG - Intergenic
1077644759 11:3913429-3913451 CTTTGGAAGGCTGAAGCGGGAGG - Intronic
1077949804 11:6944030-6944052 CTTTGGAAGGCGGAGGCGGGCGG + Intronic
1078573725 11:12481362-12481384 CTCCCAATGGCCGAAGCTGGAGG - Intronic
1078782935 11:14456998-14457020 CTCCGGGAGGCTGAGGCGGGCGG + Intronic
1078788041 11:14515795-14515817 CTCTGGGAGGCTGAAGCGGGTGG - Intronic
1079366518 11:19814706-19814728 CTCCAGAAGGCTGAGGCAGGAGG - Intronic
1080831696 11:35899769-35899791 CTTCAGGAGGCTGAAGCGGGTGG + Intergenic
1081624240 11:44638210-44638232 CTTCCGGAGGCAGAGGCGGGCGG + Intergenic
1083347881 11:62006166-62006188 CTTCGGAAGGCCGAGGCGGGTGG + Intergenic
1083356584 11:62070761-62070783 CTTCAGGAGGCTGAAGCGGGTGG + Intergenic
1083795382 11:65013962-65013984 CTCCCGAGGGCTGAGGCTGGGGG - Intergenic
1084260299 11:67973076-67973098 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
1084378210 11:68792803-68792825 CTTCGGGAGGCCGAAGCGGGCGG + Intronic
1085103993 11:73826261-73826283 CTTCCGGAGGCTGAAGCAGGAGG - Intronic
1085583963 11:77683047-77683069 CTTCGGGAGGCTGAAGCGGGTGG + Intronic
1085616213 11:78001120-78001142 CTTTCGGAGGCCGAAGCGGGTGG - Intergenic
1087473981 11:98614362-98614384 CTCTGGAAGGCCGAAGTGGGCGG - Intergenic
1087742219 11:101901118-101901140 CTCTGGGAGGCGGAGGCGGGAGG - Intronic
1088089461 11:106021735-106021757 GTCCCAAAGGAGGCAGCGGGAGG - Exonic
1088251194 11:107862161-107862183 CTTTGGAAGGCTGAAGCGGGTGG + Intronic
1088270431 11:108028593-108028615 CTTTCGGAGGCCGAAGCGGGCGG + Intronic
1089601890 11:119621398-119621420 CTTTGGAAGGCTGAAGCGGGAGG - Intergenic
1089848013 11:121473649-121473671 CTTCGGAAGGCCGAGGCGGGTGG + Intronic
1090142151 11:124276986-124277008 GTCCCTAAGGCTGAAGCGAGGGG + Intergenic
1091214761 11:133893965-133893987 CTTCCGGAGGCCGAGGCGGGCGG - Intergenic
1092136985 12:6156335-6156357 CTTCCGGAGGCTGAGGCGGGTGG - Intergenic
1092340574 12:7672495-7672517 CTTTGGAAGGCAGAAGCGGGTGG + Intergenic
1092374226 12:7942038-7942060 CTCTGGGAGGCCGAAGCGGGCGG + Intergenic
1092434516 12:8436245-8436267 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
1092615999 12:10216125-10216147 CTTCCGGAGGCTGAGGCGGGTGG + Intronic
1092898499 12:13036701-13036723 CTTTGGAAGGCCGAAGCGGGTGG - Intergenic
1093340966 12:17973577-17973599 CTTCGGAAGGCTGAGGCGGGCGG - Intergenic
1094637207 12:32238157-32238179 CTTTGGAAGGCTGAAGCGGGTGG + Intronic
1094666801 12:32528178-32528200 CTCTGGGAGGCTGAAGCGGGAGG - Intronic
1094769407 12:33636856-33636878 CTTTGGAAGGCCGAAGCGGGCGG + Intergenic
1095484595 12:42671973-42671995 CTTTGGGAGGCGGAAGCGGGAGG - Intergenic
1096648942 12:53052657-53052679 CTCCAGAAGGCGGAGTAGGGTGG - Intronic
1096703781 12:53405423-53405445 CTTTCGAAGGCCGAGGCGGGTGG + Intronic
1097469281 12:59968119-59968141 CTTTGGGAGGCGGAAGCGGGCGG - Intergenic
1097852000 12:64421043-64421065 CTCTGGAAGGCCGAAGTGGGTGG - Intronic
1098273250 12:68789437-68789459 CTCTGGGAGGCTGAAGCGGGTGG + Intronic
1098277347 12:68826403-68826425 CTTTGGAAGGCCGAAGCGGGTGG + Intronic
1099034213 12:77565112-77565134 CTCCTGAAGGAGGAAGCTGTGGG - Intergenic
1099191736 12:79568346-79568368 CTCTGGGAGGCTGAAGCGGGTGG + Intergenic
1100986178 12:100203544-100203566 CTTTGGAAGGCGGAGGCGGGCGG - Intronic
1101910909 12:108859560-108859582 CTTTGGAAGGCGGAAGCAGGAGG - Intronic
1102337588 12:112095056-112095078 CTTAGGAAGGCTGAAGCGGGAGG + Intronic
1103357300 12:120331207-120331229 CTTCGGGAGGCCGAAGCGGGTGG + Intergenic
1103500444 12:121397744-121397766 CTTCAGGAGGCGGAGGCGGGCGG - Intronic
1103626661 12:122225570-122225592 CTCCCGAGGGCAGAAGGGGCCGG - Intronic
1103652660 12:122444884-122444906 CTTCCGGAGGCCGAGGCGGGTGG - Intergenic
1105970543 13:25425817-25425839 CTCTGGGAGGCGGAGGCGGGCGG - Intronic
1106154392 13:27139370-27139392 CTTTGGAAGGCGGAGGCGGGAGG + Intronic
1106515726 13:30451647-30451669 CTCCGGGAGGCCGAGGCGGGCGG + Intergenic
1106699922 13:32218435-32218457 CTCTGGGAGGCCGAAGCGGGCGG + Intronic
1107916142 13:45153259-45153281 CTCCGGGAGGCCGAGGCGGGCGG - Intronic
1110429984 13:75412546-75412568 CTTTCGAAGGCTGAAGTGGGAGG - Intronic
1110780104 13:79455454-79455476 CTTTGGAAGGCGGAGGCGGGCGG - Intergenic
1113085757 13:106567972-106567994 CGTCCGAAGGCGGAGGCGAGGGG - Exonic
1113582235 13:111437765-111437787 CTCCCCAGGGCGGAAGCAGGAGG - Intergenic
1114362695 14:21992388-21992410 CTTCGGGAGGCTGAAGCGGGTGG - Intergenic
1114441789 14:22754374-22754396 CTTCGGGAGGCGGAGGCGGGTGG - Intergenic
1115160351 14:30386975-30386997 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
1115552939 14:34520744-34520766 CTTTGGGAGGCGGAAGCGGGTGG - Intronic
1115599846 14:34945011-34945033 CTCCGGAAGGCTGAGGTGGGTGG + Intergenic
1116810319 14:49533785-49533807 CTTCGGAAGGCCGAGGCGGGTGG + Intergenic
1116851869 14:49916868-49916890 CTTCAGGAGGCTGAAGCGGGAGG - Intergenic
1117339990 14:54784463-54784485 CTCCTGAAGGTGGAACCAGGTGG + Intronic
1117393025 14:55280767-55280789 CTTCGGAAGGCTGAGGCGGGAGG - Intronic
1117553642 14:56862090-56862112 CTCTGGAAGGCCGAAGTGGGAGG + Intergenic
1117682102 14:58214732-58214754 CTCTGGGAGGCTGAAGCGGGTGG - Intronic
1117846347 14:59915476-59915498 CTCAGGAAGGCTGAGGCGGGTGG - Intergenic
1117983171 14:61362091-61362113 CTTCGGGAGGCTGAAGCGGGAGG + Intronic
1118413628 14:65508743-65508765 CTTTGGGAGGCGGAAGCGGGTGG - Intronic
1119539234 14:75428023-75428045 CTCCCGCAGGCTGTGGCGGGCGG - Intronic
1119865682 14:77971480-77971502 CTTCGGGAGGCGGAGGCGGGTGG + Intergenic
1120414069 14:84196790-84196812 CTCTGGGAGGCTGAAGCGGGCGG + Intergenic
1120873325 14:89357361-89357383 CTTCAGGAGGCTGAAGCGGGTGG + Intronic
1121136925 14:91507876-91507898 CTCCGGGAGGCCGAGGCGGGTGG + Intronic
1121653699 14:95579102-95579124 CTTCGGAAGGCCGAGGCGGGCGG - Intergenic
1121910923 14:97791757-97791779 CTCTGGAAGGCCGAGGCGGGTGG + Intergenic
1122039221 14:98971021-98971043 CTCCGGGAGGCTGAGGCGGGCGG - Intergenic
1122171885 14:99883285-99883307 CTTCAGCAGGCCGAAGCGGGTGG + Intronic
1122520082 14:102337410-102337432 CTTCGGAAGGCTGAGGCGGGCGG - Intronic
1122709389 14:103644500-103644522 CTTCGGGAGGCTGAAGCGGGTGG - Intronic
1123025837 14:105423458-105423480 CTTTCGGAGGCCGAAGCGGGTGG - Intronic
1123108177 14:105852609-105852631 CTCCTGGAGGGGGAAGCAGGGGG + Intergenic
1124028505 15:25988868-25988890 CTCCAGGAGGCAGAGGCGGGTGG - Intergenic
1126067116 15:44834543-44834565 CTCGGGAAGGCTGAGGCGGGTGG - Intergenic
1126478326 15:49090520-49090542 CTTCGGAAGGCCGAAGCAGGTGG + Intergenic
1126629603 15:50720761-50720783 CTTCGGGAGGCTGAAGCGGGTGG - Intronic
1126662317 15:51045255-51045277 CTTCAGAAGGCTGAGGCGGGCGG + Intergenic
1126759563 15:51956932-51956954 CTCCAGGAGGCTGAGGCGGGAGG - Intronic
1127421868 15:58814181-58814203 CTCTGGGAGGCCGAAGCGGGTGG - Intronic
1127557354 15:60100443-60100465 CTCTGGAAGGCGGAGGCAGGAGG + Intergenic
1128312074 15:66637146-66637168 CTTTGGAAGGCCGAAGCGGGCGG - Intronic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129350423 15:74952796-74952818 CTCCAGGAGGCTGAGGCGGGTGG + Intergenic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1130957003 15:88634222-88634244 CTTCGGAAGGCCGAGGCGGGTGG - Intergenic
1130996856 15:88908893-88908915 CTCCAGAAGGAGGGGGCGGGGGG - Intronic
1131484172 15:92806925-92806947 CTTCGGAAGGCTGAGGCGGGCGG - Intronic
1132098597 15:99006705-99006727 CTCAGGGAGGCTGAAGCGGGAGG + Intronic
1132435974 15:101802976-101802998 CTTTGGGAGGCGGAAGCGGGTGG + Intergenic
1132484280 16:182170-182192 CTCCGGGAGGCCGAGGCGGGCGG + Intergenic
1132596811 16:755304-755326 CTTCGGAAGGCTGAGGCGGGCGG - Intronic
1133052512 16:3125200-3125222 CTTCGGGAGGCTGAAGCGGGCGG - Intergenic
1133122372 16:3617700-3617722 CTTTGGAAGGCGGAGGCGGGAGG + Intronic
1133218536 16:4307874-4307896 CTCCCCGAGGCGGAAGCTGGGGG - Intergenic
1133328571 16:4957498-4957520 CTTTAGGAGGCGGAAGCGGGAGG - Intronic
1133457478 16:5955035-5955057 CTTGCGGAGGCCGAAGCGGGTGG + Intergenic
1133791301 16:9011513-9011535 CTTTGGAAGGCTGAAGCGGGTGG - Intergenic
1133929991 16:10224287-10224309 CTTCGGAAGGCTGAGGCGGGCGG - Intergenic
1134162133 16:11900088-11900110 CTTTGGGAGGCGGAAGCGGGGGG + Intronic
1134277976 16:12793350-12793372 CACCAGAAGGCTGGAGCGGGAGG + Intronic
1134364559 16:13564936-13564958 CTCTGGAAGGCCGAAGTGGGTGG + Intergenic
1134655319 16:15943903-15943925 CTCTGGGAGGCCGAAGCGGGTGG - Intergenic
1136633377 16:31502871-31502893 CTTCGGAAGGCCGAGGCGGGTGG - Intronic
1137892876 16:52180721-52180743 CTTTGGAAGGCGGAGGCGGGTGG + Intergenic
1139406101 16:66718899-66718921 CTCTGGGAGGCGGAGGCGGGCGG + Intergenic
1141165468 16:81657843-81657865 CTCCAGGAGGCGGAGGTGGGTGG - Intronic
1141587384 16:85043787-85043809 CTCTGGGAGGCCGAAGCGGGCGG + Intronic
1141942392 16:87285994-87286016 CTCTGGGAGGCTGAAGCGGGTGG + Intronic
1142375504 16:89704961-89704983 CTTCGGAAGGCTGAGGCGGGGGG - Intergenic
1142955389 17:3518060-3518082 CTTTGGAAGGCCGAAGCGGGTGG - Intronic
1143171926 17:4935369-4935391 CTCTGGAAGGCTGAGGCGGGTGG + Intergenic
1143468560 17:7155992-7156014 CTCCGGGAGGCTGAGGCGGGCGG + Intergenic
1144119142 17:12133323-12133345 CTCTGGGAGGCTGAAGCGGGCGG - Intronic
1144466750 17:15503156-15503178 CTTTGGAAGGCGGAAGCGGGAGG + Exonic
1144815935 17:18034991-18035013 CTCTGGAAGGCCGAAGCAGGAGG + Intronic
1146187876 17:30737169-30737191 CTTCAGAAGGCCGAGGCGGGTGG - Intergenic
1147009958 17:37437628-37437650 CTTTGGAAGGCGGAGGCGGGCGG - Intronic
1148791278 17:50174588-50174610 CTTCGGGAGGCCGAAGCGGGTGG - Intronic
1149618454 17:58022283-58022305 CTCTGGGAGGCGGAAGCGGGTGG + Intergenic
1149635723 17:58167769-58167791 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
1150105823 17:62461825-62461847 CTTCCGGAGGCTGAGGCGGGTGG - Intronic
1150113109 17:62519568-62519590 CTTCGGGAGGCGGAGGCGGGTGG + Intronic
1150372036 17:64647435-64647457 CTCTGGGAGGCTGAAGCGGGCGG + Intronic
1150420005 17:65025139-65025161 CTCCCGGAGGCCGAAGTGGGTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150698911 17:67430572-67430594 CTCTAGAGGGTGGAAGCGGGAGG + Intronic
1150740896 17:67778370-67778392 CTTTGGAAGGCCGAAGCGGGTGG + Intergenic
1150760365 17:67955902-67955924 CTCTAGAAGGCTGAGGCGGGTGG + Intronic
1152107265 17:78337890-78337912 CTTCAGAAGGCCGAAGCCGGAGG + Intergenic
1152359285 17:79823472-79823494 CTCTGGAAGGCTGAGGCGGGCGG - Intergenic
1152520717 17:80854648-80854670 CTTCGGGAGGCTGAAGCGGGAGG + Intronic
1152539874 17:80969504-80969526 CTTCCGCAGGCGGATGTGGGAGG - Intergenic
1153022013 18:637729-637751 CTCTGGAAGGCCGAGGCGGGCGG + Intronic
1153231548 18:2941681-2941703 CTTCGGAAGGCCGAGGCGGGTGG + Intronic
1153633456 18:7093881-7093903 CTCCCGGAGGCTGAAGTGGGAGG - Intronic
1153670929 18:7411509-7411531 CTCTGGGAGGCTGAAGCGGGTGG - Intergenic
1153873215 18:9340123-9340145 CTTCAGAAGGCCGAGGCGGGCGG + Intronic
1154944497 18:21148297-21148319 CTCTGGAAGGCCGAGGCGGGTGG - Intergenic
1154969533 18:21393670-21393692 CTTTGGAAGGCAGAAGCGGGCGG - Intronic
1155230359 18:23767814-23767836 CTTCGGGAGGCTGAAGCGGGTGG - Intronic
1155287876 18:24309801-24309823 CTTTGGGAGGCGGAAGCGGGAGG + Intronic
1156502197 18:37566923-37566945 CTTCCGAAGGCGGAAGGTGGGGG + Intergenic
1156589610 18:38471156-38471178 CTTTCGAAGGCTGAGGCGGGCGG - Intergenic
1156774513 18:40770802-40770824 CTCTGGGAGGCTGAAGCGGGTGG - Intergenic
1157098874 18:44711781-44711803 CTTCAGGAGGCCGAAGCGGGAGG - Intronic
1157657152 18:49401780-49401802 CTCTGGGAGGCTGAAGCGGGTGG + Intronic
1157872160 18:51240292-51240314 CTTCAGGAGGCTGAAGCGGGTGG + Intergenic
1158300655 18:56048302-56048324 CTTCCGGAGGCTGAGGCGGGTGG - Intergenic
1158341672 18:56473078-56473100 CTTCGGGAGGCCGAAGCGGGTGG - Intergenic
1159048930 18:63398592-63398614 CTCTCGGAGGCTGAGGCGGGTGG + Intronic
1160227084 18:77019841-77019863 CTCCCGGTGGCGGAAGCAGCAGG + Intronic
1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG + Intronic
1160937126 19:1601916-1601938 CTTCCGGAGGCCGAGGCGGGTGG + Intronic
1160999038 19:1899986-1900008 CTTCGGAAGGCTGAGGCGGGTGG - Intergenic
1161123268 19:2541804-2541826 CTCCGGGAGGCTGAGGCGGGAGG + Intronic
1161175656 19:2841101-2841123 GTCCCGGAGGAGGACGCGGGCGG + Intergenic
1161184873 19:2910835-2910857 CTTCCGGAGGCCGAGGCGGGCGG - Intronic
1161450685 19:4343794-4343816 CGGCCGAATGCGGGAGCGGGCGG + Exonic
1161702483 19:5803059-5803081 CTTCGGGAGGCCGAAGCGGGCGG + Intergenic
1161722272 19:5909731-5909753 CTTTCGAAGGCCGAGGCGGGTGG - Exonic
1162035212 19:7934737-7934759 CTCCCGAGGGTAGAGGCGGGAGG - Intronic
1162115254 19:8425487-8425509 CTTTGGAAGGCTGAAGCGGGAGG - Intronic
1162962871 19:14138070-14138092 CTCTGGAAGGCCGAGGCGGGCGG - Intergenic
1163106951 19:15129248-15129270 CTTTGGAAGGCGGAGGCGGGTGG + Intergenic
1163897455 19:20071969-20071991 CTCCGGGAGGCCGAGGCGGGCGG + Intergenic
1164890286 19:31817574-31817596 CTTTGGAAGGCCGAAGCGGGCGG + Intergenic
1165215784 19:34271489-34271511 CTCTGGAAGGCCGAGGCGGGTGG - Intronic
1165268084 19:34678179-34678201 CTTCGGAAGGCGGAGGCGGGCGG - Intronic
1165962981 19:39551015-39551037 CTTTGGAAGGCTGAAGCGGGCGG - Intergenic
1166062290 19:40334203-40334225 CTTCGGGAGGCCGAAGCGGGTGG + Intronic
1166091026 19:40509163-40509185 CTCTGGGAGGTGGAAGCGGGAGG - Intronic
1166323291 19:42033074-42033096 CTCTGGGAGGCTGAAGCGGGTGG + Intronic
1167809406 19:51815316-51815338 CTCTCGAAGGCCGAGGTGGGTGG + Intronic
1167974672 19:53215418-53215440 CTTTGGAAGGCGGAGGCGGGCGG - Intergenic
1168111024 19:54191352-54191374 CTCCCGCAGGAGGATGCTGGTGG + Exonic
1168225921 19:54995068-54995090 CTTCGGGAGGCCGAAGCGGGCGG + Intronic
1168638054 19:58011551-58011573 CTTCGGAAGGCTGAGGCGGGTGG - Intergenic
925290291 2:2743554-2743576 CTCCTGAAGGCAGAAGCTGCAGG + Intergenic
926202481 2:10812151-10812173 CTTTGGAAGGCCGAAGCGGGTGG - Intronic
927126652 2:20018361-20018383 CTTCGGAAGGCCGAGGCGGGCGG - Intergenic
927793473 2:26029022-26029044 CTCCGGAAGGCTGAGGTGGGAGG - Intergenic
928146940 2:28787214-28787236 CTCTGGGAGGCCGAAGCGGGCGG + Intronic
929222619 2:39480288-39480310 CTCTGGAAGGCTGAGGCGGGAGG + Intergenic
929521878 2:42660328-42660350 CTTCGGAAGGCCGAGGCGGGTGG - Intronic
930016607 2:46975006-46975028 CTCTGTCAGGCGGAAGCGGGAGG - Exonic
930017398 2:46980453-46980475 CTTTAGAAGGCTGAAGCGGGAGG - Intronic
930132103 2:47862530-47862552 CTCTGGAAGGCTGAAGCAGGAGG - Intronic
931368735 2:61642189-61642211 CTTTGGAAGGCTGAAGCGGGTGG - Intergenic
931723809 2:65089319-65089341 ATCCCGGAGGCGGAGGCGGGAGG - Intronic
932036853 2:68253920-68253942 CTCCTGAAGGGGGAAGGGGAGGG - Intronic
932628476 2:73318163-73318185 CTTTGGAAGGCCGAAGCGGGAGG - Intergenic
932713763 2:74086680-74086702 CTCAAGAAGGCTGAAGTGGGAGG + Intronic
933101718 2:78268058-78268080 CTCTGGGAGGCGGAGGCGGGCGG - Intergenic
933179196 2:79210908-79210930 CTCCCCCAGGCGGGAGAGGGAGG - Intronic
933434840 2:82235476-82235498 CTTTGGAAGGCGGAGGCGGGTGG - Intergenic
933829618 2:86196180-86196202 CTTCGGGAGGCCGAAGCGGGAGG + Intergenic
934313092 2:91888120-91888142 CTCTGGGAGGCCGAAGCGGGCGG - Intergenic
934696983 2:96407067-96407089 CTCTGGGAGGCTGAAGCGGGAGG - Intergenic
936104652 2:109614189-109614211 CTCGCGAGGCCGGAAGTGGGCGG + Exonic
936630541 2:114198057-114198079 CTTTCGGAGGCCGAAGCGGGCGG - Intergenic
936855220 2:116949643-116949665 CTTCGGGAGGCCGAAGCGGGTGG + Intergenic
937352672 2:121176109-121176131 CTCCGGGAGGCCGAGGCGGGCGG - Intergenic
938061966 2:128261596-128261618 CTGCTGAAGGCAGAAGCTGGCGG + Intronic
938371992 2:130775685-130775707 CTTCCGGAGGCTGAGGCGGGCGG + Intergenic
939317816 2:140575678-140575700 CTTTCGGAGGCTGAAGCGGGAGG + Intronic
940040759 2:149358027-149358049 CTCTGGGAGGCCGAAGCGGGCGG - Intronic
941807850 2:169726889-169726911 CTCTCGGAGGCCGAAGTGGGAGG + Intronic
941955015 2:171195258-171195280 CTTTGGAAGGCGGAGGCGGGCGG + Intronic
942099566 2:172566309-172566331 CTTTGGAAGGCTGAAGCGGGTGG + Intronic
944252790 2:197594255-197594277 CTCTGGGAGGCGGAAGTGGGCGG - Intronic
944766061 2:202865223-202865245 CTCTGGAAGGCCGAGGCGGGCGG + Intronic
945051548 2:205828594-205828616 CTCTGGGAGGCCGAAGCGGGTGG + Intergenic
945315866 2:208370198-208370220 CTTCGGGAGGCCGAAGCGGGCGG + Intronic
945606506 2:211939702-211939724 CTTCGGAAGGCCGAGGCGGGCGG + Intronic
945963465 2:216160935-216160957 CTTCGGGAGGCTGAAGCGGGAGG - Intronic
946003052 2:216499021-216499043 CTCCCCAAGGCGGAGGGGCGGGG + Intronic
946250372 2:218407733-218407755 CTCCTACAGGCTGAAGCGGGAGG - Intergenic
946267929 2:218564635-218564657 CTCCCTAAGGTGGGAGTGGGGGG + Intronic
947560646 2:231147247-231147269 CTCCCGGAGGCTGAGGTGGGAGG + Intronic
947632663 2:231664024-231664046 CTCTGGAAGGCCGAGGCGGGTGG - Intergenic
947953835 2:234170817-234170839 CTTCCGGAGGCCGAGGCGGGCGG - Intergenic
948384221 2:237571696-237571718 CTTCGGGAGGCCGAAGCGGGAGG - Intergenic
1168898453 20:1339993-1340015 CTTTCGGAGGCCGAAGCGGGTGG - Intronic
1169994478 20:11541427-11541449 TTCCCGAAGGATGAAGCTGGAGG - Intergenic
1170022795 20:11854456-11854478 CTTTGGAAGGCGGAGGCGGGTGG + Intergenic
1170492139 20:16887965-16887987 CTTTCGAAGGCTGAGGCGGGTGG - Intergenic
1170524750 20:17226826-17226848 CCCCAGAAGGCGGAGGCGGCCGG + Intronic
1172394576 20:34591942-34591964 CTCTGGGAGGCCGAAGCGGGTGG + Intronic
1173980304 20:47218971-47218993 CTTCCGGAGGCAGAGGCGGGAGG + Intronic
1174092656 20:48061646-48061668 CTTTGGAAGGCGGAGGCGGGTGG + Intergenic
1174736675 20:52972113-52972135 CTCCGGGAGGCGGAAGGGGCGGG - Intergenic
1174819501 20:53714345-53714367 CTCCCAAAGTCCGAGGCGGGTGG + Intergenic
1175844929 20:62053149-62053171 CACCCGAAAGTGGAAGAGGGTGG + Intronic
1176016434 20:62936167-62936189 CTCCCAGAGGCCGAGGCGGGAGG + Intronic
1176186135 20:63780557-63780579 CTCTCGGAGGCTGAGGCGGGCGG + Intronic
1176551208 21:8223010-8223032 CTCCGGGAGGCCGATGCGGGAGG - Intergenic
1176570117 21:8406009-8406031 CTCCGGGAGGCCGATGCGGGAGG - Intergenic
1176578026 21:8450196-8450218 CTCCGGGAGGCCGATGCGGGAGG - Intergenic
1177008961 21:15708374-15708396 CTTTCGGAGGCTGAAGCGGGCGG + Intergenic
1177626191 21:23663492-23663514 CTTCGGGAGGCCGAAGCGGGTGG + Intergenic
1178863600 21:36309558-36309580 CTTTGGAAGGCGGAAGCGGATGG - Intergenic
1178914490 21:36699055-36699077 GTCCCGGAGGGGGGAGCGGGAGG - Intergenic
1179265289 21:39797623-39797645 CTCCGGAAGGCTGAGGCAGGAGG - Intronic
1180205784 21:46259210-46259232 CTTTGGAAGGCCGAAGCGGGTGG + Intronic
1180837450 22:18937276-18937298 CTCTGGGAGGCGGAGGCGGGCGG - Intergenic
1180871530 22:19149675-19149697 CTCGCGAAGGCGGATGCGGCCGG + Exonic
1180886577 22:19249113-19249135 CTCTGGGAGGCCGAAGCGGGCGG + Intronic
1181111067 22:20603239-20603261 CTCCGGGAGGCCGAGGCGGGCGG + Intergenic
1181573883 22:23782054-23782076 CACCCGCAGAGGGAAGCGGGAGG - Intronic
1182260497 22:29070648-29070670 ATCCAGGAGGCTGAAGCGGGAGG + Intergenic
1182625820 22:31645294-31645316 CTCCAGAAGGCTGAGGTGGGAGG + Intronic
1183098063 22:35566211-35566233 CTCTGGGAGGCGGAGGCGGGCGG + Intergenic
1183767167 22:39888812-39888834 CTTCAGAAGGCTGAAGTGGGAGG - Intronic
1183953190 22:41363887-41363909 CTCCGGGAGGCCGAGGCGGGTGG + Intergenic
1184707952 22:46228289-46228311 CTCTGGGAGGCTGAAGCGGGTGG + Intronic
1203256235 22_KI270733v1_random:139967-139989 CTCCGGGAGGCCGATGCGGGAGG - Intergenic
1203287543 22_KI270734v1_random:162575-162597 CTCTGGGAGGCGGAGGCGGGCGG - Intergenic
949104941 3:192632-192654 CTCTGGGAGGCCGAAGCGGGCGG + Intergenic
949186861 3:1202295-1202317 CTTCGGAAGGCCGAGGCGGGCGG + Intronic
950236550 3:11326539-11326561 CTCTGGAAGGCAGAGGCGGGTGG - Intronic
950338855 3:12223919-12223941 CTCTGGGAGGCTGAAGCGGGAGG - Intergenic
952764427 3:36942935-36942957 CTCTGGCAGGCAGAAGCGGGTGG + Intronic
953940067 3:47086787-47086809 CTTTCGAAGGTGGAAGAGGGAGG + Intronic
954078529 3:48198760-48198782 CTTCGGGAGGCCGAAGCGGGTGG - Intergenic
954404786 3:50339610-50339632 CTTCGGAAGGCGGAGGCGGGTGG - Intronic
954818856 3:53307190-53307212 CTTTGGAAGGCTGAAGCGGGTGG - Intronic
957932462 3:86898978-86899000 CTTTCGAAGGCTGAGGCGGGCGG + Intergenic
958190848 3:90182571-90182593 CTCTGGGAGGCCGAAGCGGGAGG - Intergenic
958798450 3:98731411-98731433 CTTTCGAAGGCCGAGGCGGGCGG - Intergenic
959093236 3:101926130-101926152 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
959682911 3:109116525-109116547 CTCCGGGAGGCCGAAGTGGGAGG + Intronic
959708630 3:109362211-109362233 CTTTGGAAGGCGGAGGCGGGTGG - Intergenic
960096609 3:113696248-113696270 CTCCCGGAGCAGGAAGGGGGTGG + Intronic
960803091 3:121558400-121558422 CTTCCGGAGGCTGAGGCGGGTGG + Intergenic
961081711 3:124033543-124033565 CTCCCTCAGGCGGAGGCGCGCGG - Intergenic
961875550 3:130020385-130020407 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
963140092 3:141939762-141939784 CTCTGGGAGGCTGAAGCGGGAGG + Intergenic
963253389 3:143121198-143121220 GCCCCGACGGCGGCAGCGGGAGG - Exonic
963936813 3:151062068-151062090 CTTCGGCAGGCGGAGGCGGGTGG + Intergenic
964207173 3:154187131-154187153 CTCTGGGAGGCCGAAGCGGGTGG - Intronic
965531997 3:169780299-169780321 CTTTGGAAGGCGGAGGCGGGCGG - Intronic
966565119 3:181370971-181370993 CTCCGGGAGGCCGAGGCGGGCGG - Intergenic
966696918 3:182799516-182799538 CTTCCGGAGGCCGAGGCGGGCGG - Intronic
967170202 3:186817340-186817362 CTCTGGGAGGCCGAAGCGGGTGG - Intergenic
967972187 3:195007186-195007208 CTTCGGGAGGCTGAAGCGGGAGG + Intergenic
968190952 3:196666750-196666772 CTCTGGAAGGCTGAAGCAGGCGG + Intronic
968202550 3:196767735-196767757 CTCTGGGAGGCCGAAGCGGGCGG - Intronic
968320732 3:197765751-197765773 CTCTCGGAGGCTGAGGCGGGCGG + Intronic
968434209 4:576446-576468 CTCCGGGAGGAGGAAGCGGAGGG - Intergenic
968455175 4:694153-694175 CTCTGGGAGGCCGAAGCGGGTGG + Intergenic
968471122 4:782816-782838 CTTCGGAAGGCCGAGGCGGGCGG + Intergenic
968546753 4:1202842-1202864 CTCCCAAAGGCACATGCGGGGGG - Intronic
969018904 4:4125450-4125472 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
969351608 4:6601258-6601280 CTTTCGGAGGCTGAAGCGGGTGG + Intronic
969555706 4:7907966-7907988 CTCTGGAAGGCTGAGGCGGGAGG + Intronic
969730262 4:8951755-8951777 CTTTGGGAGGCGGAAGCGGGCGG - Intergenic
969786436 4:9461385-9461407 CTTTGGTAGGCGGAAGCGGGCGG - Intergenic
970343750 4:15133264-15133286 ATCCCGAAGGCTGAGGAGGGAGG - Intergenic
971729138 4:30353638-30353660 CTCTGGGAGGCGGAGGCGGGCGG - Intergenic
972144376 4:36003267-36003289 CTTCCGGAGGCTGAAGTGGGCGG + Intronic
972432475 4:38996313-38996335 CTTCCGGAGGCCGAGGCGGGTGG + Intronic
972607726 4:40629767-40629789 CTCCCGAGGCCGGGAGCGCGCGG + Intronic
973643928 4:52931513-52931535 CACCCGGAGGCGGAGGGGGGTGG - Intronic
973968626 4:56188926-56188948 CTTCGGAAGGCCGAAGCGGGTGG + Intronic
974258829 4:59498096-59498118 TCCCAGAAGGCCGAAGCGGGCGG + Intergenic
974309912 4:60191970-60191992 CTCTGGGAGGCCGAAGCGGGCGG + Intergenic
974366584 4:60957873-60957895 CTCACAAAGGAGGCAGCGGGTGG + Intergenic
975558838 4:75690805-75690827 CTCCAGAAGGCCGAGGCAGGTGG - Intronic
976524176 4:86067387-86067409 CTTTGGAAGGCGGAGGCGGGAGG - Intronic
978051906 4:104211295-104211317 CTTTCGAAGGCTGAGGCGGGTGG - Intergenic
979741821 4:124160509-124160531 CTCTGGGAGGCGGAAGCAGGTGG + Intergenic
980104649 4:128576075-128576097 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
980912271 4:139004688-139004710 CTCTGGGAGGCGGAGGCGGGTGG + Intergenic
980930657 4:139179316-139179338 CTCTAGAAGGCCGAGGCGGGCGG + Intergenic
980944345 4:139304159-139304181 CTTCGGAAGGCCGAGGCGGGCGG - Intronic
981995203 4:150966567-150966589 CTCTGGGAGGCCGAAGCGGGCGG - Intronic
982876353 4:160655544-160655566 CTCTGGAAGGCTGAAGTGGGCGG - Intergenic
982957115 4:161784649-161784671 CTTTGGAAGGCGGAGGCGGGTGG + Intronic
984638708 4:182141407-182141429 CATCCGAAGGAGGAAGCGTGTGG + Intergenic
984737331 4:183122026-183122048 CTTTGGGAGGCGGAAGCGGGCGG - Intronic
985049482 4:185974527-185974549 CTCTGGAAGGCCGAAGCGGGAGG - Intergenic
985128246 4:186716534-186716556 ACCCCGGAGGCGGAGGCGGGAGG - Intronic
985242315 4:187943616-187943638 CTCCGGGAGGCCGAGGCGGGTGG - Intergenic
985659148 5:1147253-1147275 CTCCTAAAGGCGGGGGCGGGGGG - Intergenic
987049826 5:14140126-14140148 CTTTGGAAGGCGGAGGCGGGCGG - Intergenic
987275256 5:16355472-16355494 CTCTGGGAGGCCGAAGCGGGTGG - Intergenic
988209820 5:28188675-28188697 CTTTGGAAGGCGGAGGCGGGAGG - Intergenic
988493845 5:31727757-31727779 CTTCCGGAGGCCGAGGCGGGCGG + Intronic
988565086 5:32314014-32314036 CTTCGGGAGGCCGAAGCGGGTGG - Intergenic
988736604 5:34028213-34028235 CTCTGGAAGGCCGAAGCAGGCGG - Intronic
990045287 5:51422678-51422700 CTTCGGAAGGCCGAGGCGGGCGG - Intergenic
990074470 5:51826372-51826394 CTTTGGAAGGCTGAAGCGGGTGG - Intergenic
990299013 5:54432082-54432104 CTTTAGAAGGCTGAAGCGGGAGG + Intergenic
990429641 5:55722040-55722062 CTTCGGGAGGCGGAGGCGGGTGG - Intronic
990459458 5:56017511-56017533 CTTTGGAAGGCCGAAGCGGGCGG - Intergenic
991601594 5:68356380-68356402 CTCCGGGAGGCTGAGGCGGGTGG - Intergenic
991965604 5:72087147-72087169 CTTCGGGAGGCGGAGGCGGGTGG + Intergenic
992286108 5:75236974-75236996 CTCCCGTGGCCGGAAGTGGGAGG + Intergenic
993377631 5:87168382-87168404 CTTTGGAAGGCTGAAGCGGGCGG + Intergenic
995571438 5:113486598-113486620 CTTCCTAAGGCCGAGGCGGGCGG + Intronic
996726346 5:126676013-126676035 CTTTGGAAGGCCGAAGCGGGTGG - Intergenic
996916251 5:128715306-128715328 CTTCGGGAGGCCGAAGCGGGCGG - Intronic
997150999 5:131495049-131495071 CTCTGGAAGGCCGAGGCGGGCGG + Intronic
997330083 5:133053591-133053613 CTCCAGAAGGCCGAGGCTGGAGG - Intronic
997577429 5:134992479-134992501 CTTTGGAAGGCCGAAGCGGGTGG + Intronic
997980489 5:138465141-138465163 CTCCCAGAGCCGGAAGCGGCCGG - Intergenic
998089708 5:139357587-139357609 CTCTGGGAGGCTGAAGCGGGCGG + Intronic
998103765 5:139455503-139455525 CTTCCCTAGGGGGAAGCGGGAGG - Intronic
998221013 5:140279570-140279592 CTACGGGAGGCTGAAGCGGGAGG - Intronic
998824756 5:146089980-146090002 CTTCTGGAGGCTGAAGCGGGCGG - Intronic
999069280 5:148726397-148726419 CTCTGGAAGGCCGAGGCGGGCGG - Intergenic
999666535 5:153918292-153918314 CTCTGGGAGGCCGAAGCGGGCGG + Intergenic
1000899082 5:166891273-166891295 CTTCGGAAGGCCGAGGCGGGCGG + Intergenic
1001060008 5:168480066-168480088 CTCTGGAAGGCCGAGGCGGGAGG - Intergenic
1002376975 5:178795876-178795898 CTCCTGGAGGCTGAGGCGGGAGG + Intergenic
1002388771 5:178892671-178892693 CTTCAGAAGGCTGAGGCGGGGGG + Intergenic
1002495051 5:179606187-179606209 TTCCCTAAGGGGGAAGCAGGTGG + Intronic
1002655391 5:180742481-180742503 CTTCCGGAGGCCGAGGCGGGCGG - Intergenic
1002821285 6:727325-727347 CTTCGGGAGGCTGAAGCGGGAGG - Intergenic
1002897527 6:1388350-1388372 CTCCCAAGGGCTGAAGGGGGAGG - Intergenic
1004355705 6:14928341-14928363 CTTTGGGAGGCGGAAGCGGGTGG + Intergenic
1004375976 6:15091124-15091146 CTTCAGAAGGCTGAGGCGGGAGG + Intergenic
1004659132 6:17694413-17694435 CTTCCGGAGGCCGACGCGGGCGG + Intronic
1004720394 6:18264036-18264058 CTCCCGCAGGCAGGACCGGGCGG + Intronic
1007359925 6:41347568-41347590 CTCAAGAAGGCAGAAGTGGGAGG - Intronic
1007520208 6:42446155-42446177 CTTCGGGAGGCCGAAGCGGGTGG - Intronic
1007632608 6:43281128-43281150 CTCTGGGAGGCCGAAGCGGGTGG + Intronic
1007865404 6:44963754-44963776 CTTTCGAAGGCTGAGGCGGGTGG + Intronic
1008842992 6:55927224-55927246 CTCCCGAAGAGGGAAGTGAGAGG + Intergenic
1011075378 6:83432018-83432040 CTTTGGAAGGCGGAGGCGGGCGG - Intergenic
1011268867 6:85555063-85555085 CTTCGGAAGGCTGAAGCTGGAGG - Intronic
1012092945 6:94922244-94922266 CCCCCGAAGCAGGAAGAGGGAGG - Intergenic
1012443489 6:99284667-99284689 CTCTGGAAGGCTGAAGTGGGCGG + Intronic
1012621444 6:101349117-101349139 CTTTGGAAGGCTGAAGCGGGAGG + Intergenic
1013017610 6:106175298-106175320 CTTTCGGAGGCGGAGGCGGGTGG + Intergenic
1013892680 6:115044016-115044038 CTCTCGGAGGCCGAGGCGGGCGG - Intergenic
1014569930 6:122996450-122996472 CTCCCGAAGGCGAAAATGGCAGG + Exonic
1015251257 6:131130537-131130559 CTTTGGAAGGCCGAAGCGGGTGG - Intergenic
1015956275 6:138601568-138601590 CTCTCGGAGGCCGAGGCGGGCGG + Intronic
1017294438 6:152777400-152777422 CTTTGGAAGGCGGAGGCGGGAGG + Intergenic
1017460920 6:154649477-154649499 CTCTGGGAGGCGGAGGCGGGCGG + Intergenic
1017793888 6:157823851-157823873 GTCCCCCAGGCGGCAGCGGGAGG - Intronic
1018823761 6:167393927-167393949 CTCCGGAAGGCCGAGGTGGGGGG + Intergenic
1019373715 7:677172-677194 CTCCCGGAGGCCGAGGAGGGCGG + Intronic
1019395875 7:817201-817223 CTTCGGGAGGCGGAGGCGGGAGG - Intronic
1019689610 7:2403439-2403461 CTCGCGAGGGCGGGGGCGGGCGG + Intergenic
1020103107 7:5406605-5406627 CTTTGGAAGGCAGAAGCGGGCGG + Intronic
1021231085 7:18086871-18086893 CTCGGGAGGGCGGCAGCGGGCGG - Intergenic
1021377320 7:19923971-19923993 CTTCAGGAGGCTGAAGCGGGTGG + Intergenic
1021682780 7:23151560-23151582 CTCCCAAATGCTGAAGCAGGTGG + Intronic
1022517106 7:30982802-30982824 CTTGGGAAGGCTGAAGCGGGAGG - Intronic
1023016343 7:35971605-35971627 CTCCCGAAGGCGGCGGCGCAGGG - Intergenic
1023417251 7:39945147-39945169 CTTCGGAAGGCCGAGGCGGGTGG + Intergenic
1023419019 7:39959402-39959424 CTCTGGGAGGCTGAAGCGGGTGG - Intronic
1023942466 7:44778518-44778540 CTCTGGAAGGCCGAAGCAGGCGG + Intergenic
1024490495 7:49976857-49976879 CTCTGGGAGGCGGAGGCGGGCGG + Intronic
1025036187 7:55593848-55593870 CTCCCGAAGCAGGAAGCGGGAGG - Intergenic
1025773702 7:64538885-64538907 CTTTGGAAGGCGGAGGCGGGTGG + Intronic
1025960759 7:66219139-66219161 CTCTGGGAGGCTGAAGCGGGTGG - Intronic
1026013342 7:66653909-66653931 CTCTGGAAGGCCGAGGCGGGCGG - Intronic
1026739980 7:72973036-72973058 CTTCGGAAGGCGGAGGCAGGAGG + Intergenic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027103753 7:75392034-75392056 CTTCGGAAGGCGGAGGCAGGAGG - Intergenic
1027376644 7:77557208-77557230 CTCTGGGAGGTGGAAGCGGGAGG - Intronic
1027583997 7:80034152-80034174 CTCTGGAAGGCCGAAGTGGGTGG + Intergenic
1027796078 7:82695557-82695579 CTTTGGAAGGCGGAGGCGGGCGG - Intergenic
1028407728 7:90494636-90494658 CTCTGGAAGGCGGAAGAGGGAGG + Intronic
1028556646 7:92133508-92133530 CTTCGGGAGGCCGAAGCGGGCGG - Intronic
1029293549 7:99520754-99520776 CTTCCGGAGGCTGAGGCGGGTGG + Intronic
1029367540 7:100126393-100126415 CTCCAGGAGGCTGAAGCAGGAGG + Intergenic
1029977584 7:104849172-104849194 CTTCCGGAGGCCGAAGTGGGTGG - Intronic
1030048695 7:105520078-105520100 CTTCGGAAGGCTGAGGCGGGTGG + Intronic
1031003281 7:116442682-116442704 CTCTGGAAGGCCGAGGCGGGCGG - Intronic
1032791662 7:135247086-135247108 CTTCGGAAGGCCGAGGCGGGTGG - Intronic
1033244423 7:139706284-139706306 CCCCAAGAGGCGGAAGCGGGCGG + Intronic
1033427141 7:141254472-141254494 CTCTGGAAGGCCGAGGCGGGTGG + Intronic
1034085722 7:148320625-148320647 CTTTGGAAGGCGGAGGCGGGCGG - Intronic
1034135107 7:148760960-148760982 CTTCTGGAGGCTGAAGCGGGAGG - Intronic
1034485292 7:151357123-151357145 ACCCAGAAGGCGGAGGCGGGAGG - Intronic
1034603786 7:152290549-152290571 CTTCGGGAGGCTGAAGCGGGTGG - Intronic
1034706477 7:153150056-153150078 CTTTGGAAGGCGGAGGCGGGTGG - Intergenic
1035992925 8:4511871-4511893 CTCCCCAAGCTGGAAGCAGGAGG - Intronic
1036177794 8:6555704-6555726 CTTTCGGAGGCCGAAGCGGGTGG - Intronic
1036582506 8:10088489-10088511 CTTCGGGAGGCTGAAGCGGGTGG + Intronic
1036902695 8:12682984-12683006 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
1036998098 8:13683697-13683719 CTTTGGGAGGCGGAAGCGGGTGG - Intergenic
1038038708 8:23706597-23706619 ATCCCGAAGGCGGATGGGGCGGG + Exonic
1038121351 8:24619815-24619837 CTTTGGGAGGCGGAAGCGGGCGG + Intergenic
1038442683 8:27583010-27583032 CTCCGGGAGGCTGAAGCGGGAGG - Intergenic
1039486019 8:37910467-37910489 CTCTGGGAGGCGGAGGCGGGTGG - Intergenic
1039818838 8:41118563-41118585 CTTCGGGAGGCCGAAGCGGGTGG - Intergenic
1041558516 8:59186913-59186935 CTTCCGGAGGCTGAGGCGGGCGG - Intergenic
1041749341 8:61242544-61242566 CTCTGGAAGGCCGAGGCGGGAGG + Intronic
1042250867 8:66755013-66755035 CTTTGGGAGGCGGAAGCGGGTGG + Intronic
1042777713 8:72452323-72452345 CTTGGGGAGGCGGAAGCGGGCGG - Intergenic
1042921709 8:73926610-73926632 CTTTGGAAGGCCGAAGCGGGAGG + Intergenic
1044152263 8:88796077-88796099 CTTTGGAAGGCCGAAGCGGGTGG - Intergenic
1045127052 8:99103740-99103762 CTTTGGAAGGCGGAGGCGGGTGG - Intronic
1045579846 8:103466807-103466829 CTTCCGGAGGCTGAGGCGGGTGG - Intergenic
1046013168 8:108574681-108574703 CTCTGGGAGGCCGAAGCGGGCGG + Intergenic
1046411624 8:113851500-113851522 CTTCCGGAGGCCGAGGCGGGCGG - Intergenic
1047079713 8:121446069-121446091 CTTTCGGAGGCTGAAGCGGGCGG + Intergenic
1047113210 8:121813781-121813803 CTCTGGGAGGCCGAAGCGGGCGG - Intergenic
1047278485 8:123424483-123424505 CTCTGGGAGGCCGAAGCGGGTGG - Intronic
1047403316 8:124563885-124563907 CTTCAGAAGGCCAAAGCGGGTGG + Intronic
1048212302 8:132465481-132465503 CTTTCGGAGGCGGAGGCGGGAGG + Intronic
1049077485 8:140410598-140410620 CTTCGGAAGGCCGAGGCGGGCGG + Intronic
1049166224 8:141128100-141128122 TTCCTGGAGGCGGCAGCGGGCGG + Intronic
1050477391 9:6054251-6054273 TTCCGGAAGGCCTAAGCGGGAGG + Intergenic
1051289726 9:15533072-15533094 CTCTGGGAGGCCGAAGCGGGCGG - Intergenic
1051892935 9:21961287-21961309 CTTTGGAAGGCAGAAGCGGGTGG - Intronic
1052712029 9:32068789-32068811 CTTAGGGAGGCGGAAGCGGGAGG - Intergenic
1053446311 9:38155814-38155836 CTTTGGAAGGCCGAAGCGGGTGG - Intergenic
1055195132 9:73581655-73581677 CTTTAGAAGGCCGAAGCGGGCGG + Intergenic
1055632392 9:78237222-78237244 CTTTGGAAGGCCGAAGCGGGCGG - Intronic
1055943372 9:81671268-81671290 CTTTGGAAGGCTGAAGCGGGCGG + Intronic
1056386621 9:86102121-86102143 CTCTCGAAGGCTGAGGCAGGTGG - Intergenic
1056528393 9:87465382-87465404 CTTTGGAAGGCGGAGGCGGGCGG + Intergenic
1056648321 9:88434811-88434833 CTCTGGGAGGCCGAAGCGGGTGG + Intronic
1056661447 9:88546656-88546678 CTCTGGGAGGCCGAAGCGGGTGG - Intronic
1056806653 9:89734139-89734161 CTCCCAGAGGCTGAGGCGGGCGG + Intergenic
1056950953 9:91040362-91040384 CTACGGAAGGCGGCAGTGGGAGG - Intergenic
1057302517 9:93895001-93895023 GTCCCCAAGGTGGAAGCAGGCGG - Intergenic
1057353115 9:94316713-94316735 TTCCCAAAGGCGAAAGCGGGTGG + Intergenic
1057654630 9:96940878-96940900 TTCCCAAAGGCGAAAGCGGGTGG - Intronic
1057665848 9:97044875-97044897 CTTTGGAAGGCGGAGGCGGGAGG + Intergenic
1057764296 9:97902543-97902565 CTCTGGGAGGCGGAGGCGGGTGG - Intergenic
1059975864 9:119716454-119716476 CTCTGGAAGGCTGAGGCGGGTGG - Intergenic
1060500871 9:124153716-124153738 CTTTGGAAGGCAGAAGCGGGCGG - Intergenic
1061286398 9:129625766-129625788 CTTCGGAAGGCAGAGGCGGGCGG + Intronic
1061380669 9:130254910-130254932 CTTTCGGAGGTGGAAGCGGGCGG - Intergenic
1061857494 9:133450187-133450209 CTATGGAAGGCTGAAGCGGGTGG + Intronic
1061980075 9:134097485-134097507 CTTCGGAAGGCCGAGGCGGGTGG - Intergenic
1062341490 9:136095521-136095543 CTCCGGAAGGAGGACGCGCGAGG - Intergenic
1062513318 9:136919959-136919981 CTTCAGAAGGCCAAAGCGGGAGG - Intronic
1062606023 9:137349209-137349231 CTCCGACAGGTGGAAGCGGGCGG + Exonic
1203472387 Un_GL000220v1:121654-121676 CTCCGGGAGGCCGATGCGGGAGG - Intergenic
1185618929 X:1440688-1440710 CTCCGGGAGGCCGAGGCGGGTGG + Intronic
1186841786 X:13491942-13491964 CTCAGGAAGGCTGAGGCGGGAGG - Intergenic
1187414109 X:19077251-19077273 CTTCGGGAGGCCGAAGCGGGTGG + Intronic
1188674845 X:32926504-32926526 CTTTGGGAGGCGGAAGCGGGCGG + Intronic
1189780890 X:44513490-44513512 CTCTCGGAGGCTGAGGCGGGCGG + Intergenic
1189873500 X:45409205-45409227 CTTCGGGAGGCGGAGGCGGGCGG + Intergenic
1190237767 X:48630531-48630553 CTCTGGGAGGCGGAGGCGGGCGG + Intergenic
1191797158 X:65033843-65033865 CTTCGGGAGGCGGAGGCGGGCGG + Intronic
1194670346 X:96724167-96724189 CTTTGGAAGGCGGAGGCGGGCGG - Intronic
1194713927 X:97269096-97269118 CTCTGGGAGGCGGATGCGGGTGG - Intronic
1194736313 X:97516008-97516030 CACCGGGAGGCGGAGGCGGGCGG + Intronic
1195309901 X:103622213-103622235 CTCTGGGAGGCGGAGGCGGGCGG - Intronic
1196185110 X:112737438-112737460 CTCCTGAAGGCGGAGGCAGGTGG - Intergenic
1196196065 X:112840005-112840027 CTCCCTGAGGCGGGAGCAGGAGG - Intronic
1196835113 X:119806782-119806804 CTTTGGAAGGCCGAAGCGGGGGG + Intergenic
1196858030 X:120001487-120001509 CTCCAGGAGGCTGAGGCGGGAGG + Intergenic
1196916133 X:120536750-120536772 CTTCGGAAGGCTGAGGCGGGGGG + Intronic
1197296229 X:124722595-124722617 CTTTGGAAGGCCGAAGCGGGCGG + Intronic
1197761756 X:130033004-130033026 CTTTGGAAGGCTGAAGCGGGTGG - Intronic
1199012817 X:142777476-142777498 CTCTGGAAGGCTGAAGTGGGAGG + Intergenic
1199774682 X:151000411-151000433 CTTCGGAAGGCCGAAGGGGGAGG + Intergenic
1199782611 X:151076473-151076495 CTTTGGAAGGCCGAAGCGGGCGG - Intergenic
1200160477 X:154005501-154005523 CTTCGGAAGGCCGAGGCGGGTGG - Intergenic
1200215346 X:154365802-154365824 CTTCCGAAGGTGAAAGCGTGAGG + Intronic
1201220171 Y:11761138-11761160 CTCCGGAAGGCCGAGGCGGGTGG - Intergenic