ID: 1160824918

View in Genome Browser
Species Human (GRCh38)
Location 19:1074988-1075010
Sequence CCGCGCATGCGCAGGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160824918_1160824929 16 Left 1160824918 19:1074988-1075010 CCCGGCCTCCTGCGCATGCGCGG 0: 1
1: 0
2: 3
3: 9
4: 130
Right 1160824929 19:1075027-1075049 GCCCCCCCCAACGCCAAGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 249
1160824918_1160824924 -10 Left 1160824918 19:1074988-1075010 CCCGGCCTCCTGCGCATGCGCGG 0: 1
1: 0
2: 3
3: 9
4: 130
Right 1160824924 19:1075001-1075023 GCATGCGCGGCCTCGCAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1160824918_1160824925 -9 Left 1160824918 19:1074988-1075010 CCCGGCCTCCTGCGCATGCGCGG 0: 1
1: 0
2: 3
3: 9
4: 130
Right 1160824925 19:1075002-1075024 CATGCGCGGCCTCGCAGGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 79
1160824918_1160824934 20 Left 1160824918 19:1074988-1075010 CCCGGCCTCCTGCGCATGCGCGG 0: 1
1: 0
2: 3
3: 9
4: 130
Right 1160824934 19:1075031-1075053 CCCCCAACGCCAAGCCGGGTCGG 0: 1
1: 0
2: 1
3: 5
4: 75
1160824918_1160824928 15 Left 1160824918 19:1074988-1075010 CCCGGCCTCCTGCGCATGCGCGG 0: 1
1: 0
2: 3
3: 9
4: 130
Right 1160824928 19:1075026-1075048 CGCCCCCCCCAACGCCAAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160824918 Original CRISPR CCGCGCATGCGCAGGAGGCC GGG (reversed) Intronic
904327130 1:29734038-29734060 CTGAGCATGCCCAGGATGCCTGG + Intergenic
907320017 1:53596200-53596222 CCACCACTGCGCAGGAGGCCAGG + Intronic
910251455 1:85201784-85201806 ACGCGCATGCCCCGGAGCCCCGG + Intergenic
911002345 1:93179896-93179918 CCGCGCAGGCGCGCGAGGCGAGG - Intronic
913714365 1:121519248-121519270 CCGCACACTCGCAGGTGGCCCGG - Intergenic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1066460426 10:35608177-35608199 CGGCGGATGCGCAGGAGGCCGGG + Exonic
1076572796 10:131443675-131443697 CCGCGCAGGTGCCGGAGGCAAGG + Intergenic
1077491335 11:2862342-2862364 CCGCGACTGGGCAGGGGGCCGGG - Intergenic
1077556029 11:3226487-3226509 CCGCACGTGCCCAGCAGGCCTGG - Intergenic
1083389456 11:62337421-62337443 CTGCGCCTGCGCACGAGGGCGGG - Intergenic
1083789037 11:64972082-64972104 TTGCGCGTGCGCAGAAGGCCTGG - Intronic
1089346839 11:117796494-117796516 CCGCGCATTGGCTGGAGGCAGGG - Intronic
1094838875 12:34334738-34334760 CCGCGCATGCGCGGCAGGTGGGG - Intergenic
1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG + Intergenic
1094839271 12:34336197-34336219 CCGCGCATGCGCAGCATGGGGGG - Intergenic
1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG + Intergenic
1094840898 12:34342329-34342351 CTGCACATGCGCAGGATCCCGGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094841760 12:34345284-34345306 CCGCGCATACGCGGGATCCCGGG - Intergenic
1094841970 12:34346000-34346022 CCGCGCATGCGCGGGGTCCCGGG - Intergenic
1094841979 12:34346009-34346031 CCGCGCATGCGCGGTAGGGGCGG + Intergenic
1094842789 12:34348993-34349015 CCGTGCATGCGCAGCAGGGGTGG + Intergenic
1094843424 12:34351321-34351343 CCGCGCATGCACAGCAGGGGTGG + Intergenic
1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG + Intergenic
1096241685 12:49963127-49963149 CCAGGCACGGGCAGGAGGCCGGG + Intronic
1101053503 12:100888446-100888468 CCGCGCAAGAGCAGGAGCCCTGG + Intronic
1102339207 12:112108594-112108616 CCGGGCAGGCGCAGGGGGGCGGG - Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1113861570 13:113490699-113490721 CCGCGCCTGCGCAGAAGGCCGGG - Exonic
1115359431 14:32484713-32484735 CGGCGCATGAGCTGGAGTCCTGG - Intronic
1121378043 14:93431455-93431477 CTGGGCATGCTCAGAAGGCCAGG - Intronic
1122231097 14:100306601-100306623 CCGGGCGTGCGCGGGAGGCGGGG + Intergenic
1122796243 14:104207593-104207615 TCGCACATGGGGAGGAGGCCTGG - Intergenic
1122883711 14:104701282-104701304 CCCCGCCTGCGCTGGTGGCCAGG + Intronic
1122985119 14:105208358-105208380 CCGCTCATGCACAGGCAGCCTGG + Intergenic
1123021072 14:105398264-105398286 CCGCGCGCGCGGAGGTGGCCCGG + Intergenic
1124453835 15:29822482-29822504 CCGGGCATGCTCAGTGGGCCGGG - Exonic
1129740987 15:77989592-77989614 CAGCCCATGGGCAGGAGGGCAGG - Intronic
1129814553 15:78540416-78540438 CCGCGCATGCGCAGAACCGCTGG - Exonic
1129844732 15:78762960-78762982 CAGCCCATGGGCAGGAGGGCAGG + Intronic
1133102009 16:3485518-3485540 CGGTGCATGCGCAGGGGGGCAGG - Exonic
1136480117 16:30535894-30535916 CCGCGCAGGGGCAGGACGTCAGG - Intronic
1139973276 16:70789813-70789835 CCACGCCTGCCCAGGAAGCCAGG + Intronic
1143155396 17:4833354-4833376 CCGCGCCTGCGCAGGAGAGGTGG + Intergenic
1143240402 17:5438886-5438908 CCGCGAGGCCGCAGGAGGCCCGG + Exonic
1143517964 17:7429463-7429485 ACGCGCCTGAGCAGGAAGCCTGG - Intergenic
1143639783 17:8189421-8189443 CCGCGCAGGGGCAGAAGGCGGGG + Exonic
1144753943 17:17668342-17668364 CAGGGCAGGAGCAGGAGGCCTGG - Intergenic
1144816878 17:18040633-18040655 CAGAGCAGGGGCAGGAGGCCTGG - Intronic
1145992894 17:29089879-29089901 CCGCGCATGCTCAGCAGGGCTGG - Intronic
1147161767 17:38572767-38572789 CCGCGGCTGCGGAGGCGGCCGGG - Intronic
1147185205 17:38709582-38709604 CCGCTCATGCGCTGGTCGCCAGG - Intronic
1147986896 17:44312028-44312050 GTGGGCATGCGCAGGTGGCCAGG - Intronic
1148502406 17:48101562-48101584 CCGCGCACGCACAGTAGGCGAGG + Intergenic
1148567449 17:48641999-48642021 CGGCGCTGGCGCAGGCGGCCAGG + Intergenic
1151767611 17:76140342-76140364 CCGGGCCGGCGGAGGAGGCCGGG - Exonic
1151785324 17:76272384-76272406 CGGTGCAGGCCCAGGAGGCCTGG - Intergenic
1152406575 17:80101472-80101494 CCGCGCAGGCGCCCGAGGCAAGG - Intergenic
1152934082 17:83125928-83125950 CCGCTCAGGTGCAGGAAGCCAGG - Intergenic
1152935850 17:83136305-83136327 CCTCTCGGGCGCAGGAGGCCTGG - Intergenic
1153999709 18:10472965-10472987 CCGCCCACCCGCAGCAGGCCCGG - Intronic
1160342332 18:78100391-78100413 CCGCGCATGGACAGGAGCTCAGG + Intergenic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1161344579 19:3761682-3761704 CCGCGCATGCTCAATGGGCCAGG - Exonic
1161764558 19:6199562-6199584 GCGCGCAGGCGCAGGAGGGGCGG - Intronic
1161764585 19:6199676-6199698 GCGCGCAGGCGCAGGACGCGGGG - Intergenic
1161764614 19:6199787-6199809 GCGCGCAGGCGTAGGAGGCGGGG - Intergenic
1162562365 19:11424071-11424093 CAGCGCTTGGGAAGGAGGCCGGG + Intronic
1162937068 19:13986629-13986651 CTGGGCATGCGCAGGAGGCCAGG + Intronic
1163390287 19:17026663-17026685 CCGCGCCTGGGGAGGGGGCCGGG + Exonic
1163677164 19:18660860-18660882 CAGGGCATGAGGAGGAGGCCTGG + Intronic
1163708489 19:18831831-18831853 CCGCGCACGCGCAGGGGGTGGGG - Intergenic
1164596733 19:29535121-29535143 CAGAGCAGGCGCAGGAGGCTGGG + Intronic
1164658578 19:29942484-29942506 CAGCGCCTGCGCAGGCGGCGCGG - Exonic
1167149125 19:47698897-47698919 CCGCGGATGCGCAGGAAGGAGGG - Intronic
1167265520 19:48481032-48481054 CCGTGCAAGGGCAGGAGGCAGGG + Intronic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
926784618 2:16507827-16507849 CTGGGCATGAGCAGGAGGGCGGG + Intergenic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
932355936 2:71068540-71068562 CCGCGCATGCGCACGCGCACAGG + Exonic
937320870 2:120959972-120959994 CTGTGCAGGCGCAGGGGGCCTGG + Intronic
943525480 2:189011366-189011388 CAGTGCATCCTCAGGAGGCCTGG - Intronic
943658709 2:190534936-190534958 CCCCGCGTGCGCTGGAGGCCCGG - Intergenic
948421913 2:237865083-237865105 CCCAGCATGGGCAGGAGGCCAGG + Intronic
948751611 2:240136404-240136426 CCGCGGACGCGCCGGCGGCCGGG - Intronic
1169354866 20:4897774-4897796 CAGCTCATGCCAAGGAGGCCAGG - Intronic
1172894573 20:38291470-38291492 CCACTCATCCGCAGGAGTCCAGG - Intronic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
1179452679 21:41476291-41476313 CCACCCATGAGCTGGAGGCCCGG - Intronic
1179495017 21:41766245-41766267 CCGCGCAAGCGCCGGGCGCCCGG + Intronic
1179977027 21:44874019-44874041 CCGCGCAGGCGCAGGAGCCGCGG - Intergenic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1183466373 22:37982419-37982441 CCACACATCCCCAGGAGGCCTGG + Intronic
1184704817 22:46203712-46203734 CCACACATGAGCTGGAGGCCAGG + Intronic
1184795148 22:46727879-46727901 CTTAGCATGCACAGGAGGCCTGG + Intronic
959906118 3:111712756-111712778 CTGCACATGCTCACGAGGCCTGG - Intronic
960925935 3:122795048-122795070 CCGCGCAGGCGCACCAGGCGCGG + Exonic
961718942 3:128879422-128879444 CCGCGCAAGCGCAGTGGGGCCGG + Intergenic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
976787167 4:88835103-88835125 CCACACATGCTCAGCAGGCCTGG + Intronic
982350480 4:154409513-154409535 CAGCTCAGGCTCAGGAGGCCAGG - Intronic
987286741 5:16465198-16465220 CAGCGCCTGCAAAGGAGGCCAGG - Exonic
987374359 5:17219208-17219230 TCGCGCATGCGCCGGAGAGCAGG + Intronic
992542213 5:77776352-77776374 GCGCGCATGCGCAGGCTGCGCGG + Exonic
999388824 5:151175047-151175069 CGGCGCATGCGCTGAATGCCTGG + Intergenic
1002211156 5:177600139-177600161 CCGCGTAGGCCCGGGAGGCCGGG + Exonic
1002304456 5:178275020-178275042 CTGCACATGAGCAGCAGGCCAGG + Intronic
1002417119 5:179126434-179126456 CCTCACATGCCCAGCAGGCCTGG + Intronic
1003490182 6:6614474-6614496 CCTGGTATGCGCAGGAGTCCTGG - Intronic
1006407627 6:33854526-33854548 CCGGGCATCTGCAGGAGGCAGGG - Intergenic
1017769575 6:157634749-157634771 CTGTGCGTGTGCAGGAGGCCTGG + Intronic
1018720861 6:166571122-166571144 CCCCGCATGCCCAGCAGGCCTGG + Intronic
1018940681 6:168307570-168307592 CCGGGCATGCGGAGCTGGCCTGG - Exonic
1019232943 6:170584247-170584269 CCGCGCACGCGTCGGAGGCATGG + Intronic
1019442661 7:1055309-1055331 ACACGCACGCGCAGGCGGCCAGG + Exonic
1019461329 7:1160422-1160444 CCGCGCAGGCGCAGCCGGGCGGG + Intronic
1019731570 7:2632126-2632148 GCGCGCATCCGGAGGCGGCCGGG + Exonic
1020560562 7:9726198-9726220 CCGCGCCTGGGGAGGGGGCCGGG - Intergenic
1023116639 7:36869166-36869188 CAGGGCATGCCCAAGAGGCCAGG - Intronic
1024189209 7:46988491-46988513 CTGCGCCTGGCCAGGAGGCCAGG - Intergenic
1024757309 7:52550023-52550045 CAACCCATGCGGAGGAGGCCAGG - Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1027244780 7:76359391-76359413 GCGCGCAGGCGCAGGAGGACGGG + Intergenic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1032001255 7:128266981-128267003 CCGTGCCTGGGCAGAAGGCCAGG - Intergenic
1032265278 7:130366156-130366178 CCAAGAATGCACAGGAGGCCAGG - Intronic
1035233403 7:157480643-157480665 CCGGGGATGCGCAGGGGGCTTGG - Intergenic
1037898733 8:22675421-22675443 CCACGCGTGAGCAGCAGGCCTGG + Intergenic
1040549601 8:48428011-48428033 CCGGCCTTGCGCAGGAGCCCTGG - Intergenic
1049709530 8:144057372-144057394 CCCAGCCTGAGCAGGAGGCCTGG + Intronic
1061187936 9:129065888-129065910 CAGCTCATGAGCAGGAGGCAGGG - Intronic
1062267709 9:135695049-135695071 CCATGCTGGCGCAGGAGGCCGGG - Exonic
1062534963 9:137017389-137017411 ACGGGCCTGCCCAGGAGGCCGGG - Intronic
1188683497 X:33041278-33041300 GCGCGCATGCGCAGGCTGCGCGG - Intronic
1189974384 X:46447183-46447205 CCGCGCACGCGCAGTAGCACGGG - Exonic
1192632091 X:72785065-72785087 CCGGGCTGGCCCAGGAGGCCAGG + Intronic
1192649618 X:72935736-72935758 CCGGGCTGGCCCAGGAGGCCAGG - Intronic
1196645892 X:118116917-118116939 CGGCGCCTGCGCGGGAGGCAGGG + Intronic