ID: 1160825257

View in Genome Browser
Species Human (GRCh38)
Location 19:1077212-1077234
Sequence GAGCCCGGAGACGCTCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160825251_1160825257 27 Left 1160825251 19:1077162-1077184 CCTGGGCGGCTTCTCTGTTCTCG 0: 1
1: 0
2: 3
3: 6
4: 104
Right 1160825257 19:1077212-1077234 GAGCCCGGAGACGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160825257 Original CRISPR GAGCCCGGAGACGCTCCCGT GGG Intronic
900147372 1:1164199-1164221 GAGGCCTGAGACGCTCCCGGGGG - Intergenic
900147381 1:1164222-1164244 GGGGCCTGAGACGCTCCCGGGGG - Intergenic
904620589 1:31772850-31772872 GAGCCCAGAGACGGCCCCGGCGG - Intergenic
905734736 1:40317244-40317266 GCGCCGGGAGACTCTGCCGTCGG - Exonic
919842339 1:201618588-201618610 GAGCCCGGATATGCTCTCGGCGG + Intergenic
920071352 1:203305398-203305420 GGGCCCGGAGCCGCTCCGCTCGG - Intergenic
1062843848 10:689871-689893 GCGCGCAGAGACGCTCCCGCCGG - Intergenic
1063593043 10:7410546-7410568 GAGCCCGGAGACGCAGGCGAAGG + Intronic
1084538950 11:69774919-69774941 GAGCCTGGTGGCGCTCTCGTTGG - Exonic
1100555979 12:95694346-95694368 GAGCCTGGAGGCGCTGCCGAGGG - Intronic
1122531635 14:102431955-102431977 GAGCCCGGAGCCGCTGTCGGTGG - Exonic
1126849944 15:52790647-52790669 CAGCCCGGGGACGCTCGTGTCGG + Intronic
1132941245 16:2509363-2509385 GAGCCCTGAGCTGCTCCCGCTGG - Intronic
1145794466 17:27647451-27647473 GAGCTTGGAGAGGCTCCCATGGG + Intronic
1147795070 17:43036513-43036535 GAGCCCGGCGCCGCCCCAGTTGG + Intergenic
1150003315 17:61455271-61455293 GAGCCCGGGGATGCTCCGGGAGG + Intronic
1160455044 18:78993810-78993832 AGGGCCGGGGACGCTCCCGTGGG + Exonic
1160592206 18:79951190-79951212 GGGTCCCGAGACGCTCCCGGAGG + Intronic
1160825257 19:1077212-1077234 GAGCCCGGAGACGCTCCCGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1163480926 19:17555842-17555864 GAGCCCGGAGTCGCCCCTGCAGG + Exonic
1164869035 19:31628021-31628043 TTGCCTGGAGCCGCTCCCGTCGG - Intergenic
1167609543 19:50500607-50500629 GAGTCCTGAGGCGCTCCCCTGGG + Intergenic
1168347165 19:55655565-55655587 GGGCGTGGAGACGCTGCCGTGGG - Intronic
947754241 2:232550454-232550476 GGGCCAGGACACGCTCCCTTAGG + Exonic
1173975481 20:47183644-47183666 GAGCCTAGAGACGCTCCGGCAGG + Intronic
1176099357 20:63357954-63357976 GAGCCCTGAGAAGCTCAGGTAGG + Intronic
1176548726 21:8212740-8212762 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176556621 21:8256949-8256971 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176567657 21:8395775-8395797 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176575560 21:8439991-8440013 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1183779262 22:39988439-39988461 GAGCCAGAAGAGTCTCCCGTGGG + Intergenic
1184373778 22:44099020-44099042 GAGCCCAGACAGGCTCCCATGGG - Intronic
1184582872 22:45429155-45429177 GGGTCCGGAGACCCTCCCTTTGG - Intronic
1203253609 22_KI270733v1_random:129045-129067 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1203261665 22_KI270733v1_random:174124-174146 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
951908086 3:27722774-27722796 CAGCCCGGAGACCCTCCTATTGG + Intergenic
952744513 3:36764455-36764477 GCCCCCGGAGACGTTCCCGGTGG - Intergenic
960153502 3:114274861-114274883 CAGCCCTGAGACTCTCCCTTCGG + Intergenic
968465513 4:748000-748022 GAGCACAGAGACGCGCCCGGAGG - Intronic
973293279 4:48490525-48490547 GAGCCATGAGCCGCTCCCGCTGG - Exonic
983061545 4:163166627-163166649 GAGCCCGGAGACGGAGCCGCCGG + Exonic
992039606 5:72816830-72816852 GAGCCCGGCGTCTCTCCCGTAGG - Intronic
994077965 5:95674476-95674498 GAACCTGGAGACATTCCCGTTGG + Intronic
1002691403 5:181053087-181053109 GCGCCCGGAGAAGGTCCCGCGGG + Intronic
1010044047 6:71420332-71420354 GAGCCGGGAGACGGTCAAGTTGG + Intergenic
1010519085 6:76810458-76810480 GAGCCCAAAAGCGCTCCCGTGGG + Intergenic
1017238315 6:152140129-152140151 GGGCCTGGAGAAGCTCCCATCGG + Exonic
1029169133 7:98618264-98618286 GAGCCGGGATGCGCTCCCGCAGG + Intronic
1037788197 8:21915366-21915388 GAGCCCTGAGATGCTGCCGGTGG + Intergenic
1037881975 8:22578023-22578045 GAGGCCGGAGACCAGCCCGTGGG + Intergenic
1041714983 8:60924366-60924388 TAGCCCAGAGAAGCTCCCCTTGG - Intergenic
1049252675 8:141597544-141597566 GAGCCCAGAGAGGCTCCCTCCGG - Intergenic
1203470011 Un_GL000220v1:112193-112215 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1203477832 Un_GL000220v1:156165-156187 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1185479458 X:435173-435195 CAGGCCGGAGAGGCTCCCGCAGG - Intergenic
1190284888 X:48955393-48955415 GAGCCCTGAGACTCTTCCCTTGG - Intronic
1190881759 X:54496366-54496388 GAGCCCGGAGACTTGCCTGTGGG - Intergenic
1191232054 X:58103771-58103793 GAGCCAGGAGTCTCTCCCGTTGG - Intergenic