ID: 1160833434

View in Genome Browser
Species Human (GRCh38)
Location 19:1113679-1113701
Sequence GTCTCTCTGCAGGAGGCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 294}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160833422_1160833434 5 Left 1160833422 19:1113651-1113673 CCCGCTCCAGGACCCCGGGGCCA 0: 1
1: 0
2: 4
3: 43
4: 343
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833417_1160833434 13 Left 1160833417 19:1113643-1113665 CCGCTCCACCCGCTCCAGGACCC 0: 1
1: 0
2: 1
3: 42
4: 496
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833423_1160833434 4 Left 1160833423 19:1113652-1113674 CCGCTCCAGGACCCCGGGGCCAT 0: 1
1: 0
2: 1
3: 19
4: 199
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833420_1160833434 8 Left 1160833420 19:1113648-1113670 CCACCCGCTCCAGGACCCCGGGG 0: 1
1: 1
2: 1
3: 33
4: 295
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833415_1160833434 23 Left 1160833415 19:1113633-1113655 CCTGCTTCAGCCGCTCCACCCGC 0: 1
1: 0
2: 3
3: 31
4: 666
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833428_1160833434 -8 Left 1160833428 19:1113664-1113686 CCCGGGGCCATGCGGGTCTCTCT 0: 1
1: 0
2: 3
3: 19
4: 154
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833425_1160833434 -1 Left 1160833425 19:1113657-1113679 CCAGGACCCCGGGGCCATGCGGG 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833427_1160833434 -7 Left 1160833427 19:1113663-1113685 CCCCGGGGCCATGCGGGTCTCTC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294
1160833429_1160833434 -9 Left 1160833429 19:1113665-1113687 CCGGGGCCATGCGGGTCTCTCTG 0: 1
1: 0
2: 1
3: 20
4: 190
Right 1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG 0: 1
1: 0
2: 1
3: 31
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160833434 Original CRISPR GTCTCTCTGCAGGAGGCACA GGG Exonic
900529473 1:3145613-3145635 ACATCTCTGCAGGAGGCTCATGG - Intronic
900566197 1:3333209-3333231 GTCCCTCTGCATCAGACACAGGG + Intronic
900649176 1:3722671-3722693 GCCTCTCTGCACCTGGCACAGGG + Intronic
900716862 1:4150601-4150623 GTCTCTCTCCAGGATGGGCAGGG + Intergenic
901142487 1:7044123-7044145 ATGTCTCTGCAGAAGGCACGTGG + Intronic
901151956 1:7109645-7109667 GTCTCTTTGCAGATTGCACAGGG - Intronic
901301652 1:8203856-8203878 CTCTTTTTGCAGGAGGCACCTGG - Intergenic
901488473 1:9582287-9582309 CTCTCTCTGCAGAAGTCATAAGG + Exonic
901725875 1:11241671-11241693 ATTTCTCTACAGGAGGCAGAAGG - Exonic
901884958 1:12216288-12216310 GCCTCTGTGCAGGAAACACAGGG - Intergenic
903737734 1:25541053-25541075 GCCCCTCTGCAGGGGACACATGG + Intergenic
905301833 1:36990900-36990922 GCCTCTTTCCAGGAGGCTCATGG - Intronic
905365598 1:37449632-37449654 GTCTCCCTGCAGGAGGCTCTGGG - Intergenic
905915769 1:41683273-41683295 GGAGCTCTGCATGAGGCACACGG - Intronic
906023590 1:42653972-42653994 GCTTCTCTGAAGGAGACACATGG + Exonic
907271140 1:53291910-53291932 GTCTCTGTGCTGCAGGGACAGGG - Intronic
907286787 1:53385578-53385600 TTCTCTCTGCAAGAAGCCCAAGG - Intergenic
907336241 1:53701649-53701671 GTCTCTACGTAGGAGGCAGAGGG - Intronic
912429701 1:109622629-109622651 GGCTCACTGAAGGTGGCACACGG - Intronic
912454453 1:109788399-109788421 GTCTCTCTGCAGGACGGATGCGG - Intergenic
912505404 1:110152340-110152362 GACTCAGTGCAGGAGGCAAATGG + Intronic
912550755 1:110483797-110483819 GTCTCTGGGCAGAAAGCACAGGG + Intergenic
914726017 1:150328421-150328443 GGCTCTCTGATGGAGGCCCAGGG - Exonic
914840553 1:151245004-151245026 GGCTCACTTCAGGAGGCAGAGGG - Intronic
915252209 1:154598631-154598653 GTCTCTTTGGAGAAGGCAGAAGG - Intronic
915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG + Exonic
917077423 1:171219894-171219916 GCCTCTCTGCAGTAGCCTCAAGG + Intergenic
918383844 1:183985227-183985249 ATCTCTCAGCAGGTGGGACACGG + Intronic
919778122 1:201207144-201207166 GACTCACTGCAGGAGGCAGATGG + Exonic
922703924 1:227779032-227779054 GCCCCTCTGCAGATGGCACAGGG - Intronic
1062787515 10:277969-277991 GTCTGGAAGCAGGAGGCACAGGG - Intronic
1064453900 10:15469051-15469073 TACTCTTTGCAGGAGGCAGATGG - Intergenic
1064751060 10:18529480-18529502 CTGTTGCTGCAGGAGGCACAGGG + Intronic
1066407884 10:35136532-35136554 GTCCCTATGCTGGGGGCACATGG + Intronic
1067080181 10:43208367-43208389 GTCTCTCTGCAGGCTGGACATGG - Intronic
1067196786 10:44126713-44126735 AGCTCTCTGCAGGAGTCACTAGG + Intergenic
1067690198 10:48496968-48496990 GGCTCTGTGCAGGGGGCCCAGGG + Intronic
1069508670 10:69023670-69023692 ATCGCTCTGCAGGATGCAGAGGG + Intergenic
1069558380 10:69412789-69412811 GTCTCCATGCAGAAGGCAGAGGG + Intronic
1070043139 10:72802159-72802181 GTACCTCTTCAGGAGGCACATGG + Intronic
1073119445 10:101112641-101112663 GCTTCTGTGCAGGAGGCACGTGG - Intronic
1075612025 10:123862095-123862117 GTCTCCCTCCTGGAGGCTCAAGG - Intronic
1075719905 10:124578533-124578555 GGCTCTGATCAGGAGGCACAGGG + Intronic
1076049112 10:127318585-127318607 CTCTCACTGCAGGAGGCTCAGGG - Intronic
1076209039 10:128625930-128625952 GTCTCTCTGCAGCAGGGAGTAGG + Intergenic
1077217258 11:1400177-1400199 GTCTCCCTGCAGGAGGGAGTGGG + Intronic
1077281857 11:1749492-1749514 GTCTCTCTTGGGGAGGCAGATGG - Intronic
1077994414 11:7441047-7441069 TTCTCTCTGCAGGATGCATTAGG - Intronic
1080403669 11:31959507-31959529 GTCTCTGAGCGGGTGGCACAGGG + Intronic
1084890864 11:72236276-72236298 TTCTATTTGGAGGAGGCACATGG + Intronic
1085055003 11:73398293-73398315 GCCTGTCTGCAGCAGGCACAGGG + Intergenic
1085358962 11:75868148-75868170 GTTTTTCTGCAGCAGTCACATGG + Intronic
1085668159 11:78434995-78435017 ATCTCTCTGCATTAGGCAGAAGG + Intergenic
1089011724 11:115137051-115137073 GCTTCTCTGCAGGTGGCCCAGGG - Intergenic
1089601695 11:119619727-119619749 GTTGCTGTGCATGAGGCACAAGG - Intergenic
1090616262 11:128518125-128518147 CTCTCACTGTTGGAGGCACAGGG - Intronic
1090767314 11:129887439-129887461 GTGTCACCTCAGGAGGCACATGG - Intronic
1091015579 11:132048292-132048314 CTCTCTTTGCAGGAGGCTCTTGG - Intronic
1091555060 12:1566800-1566822 TTCCCACTGCAGGAGGCACGAGG - Exonic
1095575682 12:43735711-43735733 GAGTCTCTGGAGGAAGCACAGGG + Intronic
1096008667 12:48193994-48194016 GTGTGTATGCAGGAGGGACAAGG + Intergenic
1096706375 12:53424839-53424861 GGCTCCCTGGAGGAGGCAGATGG - Exonic
1096803940 12:54128746-54128768 CCCTCTCAGCAGTAGGCACAAGG - Intergenic
1097719244 12:63002502-63002524 GCCTCTCTGCTGGAGGCTCCCGG + Intergenic
1098060093 12:66552912-66552934 GACTCACTGCAGCAGGCCCATGG - Intronic
1100527977 12:95437917-95437939 GAATCTCTGCAGGTGGCACCTGG + Intergenic
1101713750 12:107292568-107292590 CTCTCTCTTCAGGTGGCAGATGG - Intergenic
1104696454 12:130867684-130867706 GTCTCAGATCAGGAGGCACAGGG - Intergenic
1105241144 13:18610361-18610383 GCGTCCCTGCAGGAGGCAGAAGG + Intergenic
1106135091 13:26967907-26967929 TTATCACTGCAGGTGGCACAGGG - Intergenic
1107396272 13:40021176-40021198 GTGTCTCTATAGGAGGCTCAGGG + Intergenic
1107612677 13:42132064-42132086 GTCTCTCTGCTGGAGCCTCATGG + Intronic
1108989732 13:56640101-56640123 GTATCTCTGAAAGAGGCACTGGG + Intergenic
1111473585 13:88718179-88718201 GTCTCTCAGCAGGATGCATCGGG - Intergenic
1113076087 13:106469326-106469348 GTGTGTCTGCAGGAGTCACTGGG - Intergenic
1113354726 13:109567508-109567530 GTCCCTCTGCCGGGGGCAAACGG + Intergenic
1113659362 13:112095071-112095093 GTCTCTCTCCTAGAGGCGCAGGG + Intergenic
1113697506 13:112356380-112356402 GTCTCTCTCCACGCAGCACATGG - Intergenic
1114745053 14:25137410-25137432 GTCTCCCATCAGGAGGCACGGGG - Intergenic
1114955744 14:27816554-27816576 GTCTCAATGCAGAAAGCACAGGG + Intergenic
1115961457 14:38838564-38838586 GTCTCTCCACAGGGGGCTCAGGG + Intergenic
1116926801 14:50647405-50647427 GTGTCACTGCAGCAGGCTCAGGG - Intronic
1118346588 14:64945627-64945649 GCCTCCCTGCAGGTGGCACTAGG + Intronic
1118860345 14:69658204-69658226 GTCTCTCTGCTGGAGCCTCCAGG + Intronic
1119407769 14:74409514-74409536 GTCTCTCCCCAGGAGGCAGCTGG + Exonic
1121411395 14:93750853-93750875 GTCTCTGGGCATGGGGCACAGGG + Intronic
1122082930 14:99279149-99279171 CTCTCACTGCAGCAGCCACAGGG + Intergenic
1122129854 14:99598644-99598666 CTCTCTGGGCAGCAGGCACAGGG + Intronic
1122878865 14:104681003-104681025 GTTTCTGTTTAGGAGGCACATGG - Intergenic
1122884742 14:104706016-104706038 GTCTCTGTGCAGGAGGGGCCAGG - Exonic
1123490210 15:20774786-20774808 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1123546711 15:21343873-21343895 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1123696595 15:22883327-22883349 GTCTCCCAGCAGGATGCCCAAGG + Intronic
1127009107 15:54603039-54603061 GTCTATGTGGAAGAGGCACATGG - Intronic
1127152826 15:56095705-56095727 GTTTCTTTACAGGAGGCACCTGG + Exonic
1127930648 15:63595068-63595090 TTCTGTCTGCAGGAGGCATGGGG - Intergenic
1128727768 15:70000482-70000504 GGCTCTCAGCAGGAGGGAGAGGG - Intergenic
1129523187 15:76198508-76198530 GTCTCTCTGTAGGAGGAACCAGG + Intronic
1132130611 15:99275202-99275224 TTCTCTCTGCTGGAGGTACTGGG - Intronic
1202955042 15_KI270727v1_random:71088-71110 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1132589670 16:721165-721187 GGCTCCCGGCAGGAGGCAGAGGG + Exonic
1137530104 16:49274024-49274046 GGCACTGTGTAGGAGGCACAGGG + Intergenic
1139206746 16:65036422-65036444 GTCTCTGTGGAAGAGGAACATGG - Intronic
1139330866 16:66188885-66188907 TTCTCTCTGCAGGAGCCCCAGGG - Intergenic
1140948845 16:79796627-79796649 GTCTCTCTGCAGAAGGGAAAAGG + Intergenic
1141606437 16:85156544-85156566 GTCTCTCTGAGGCAGCCACAGGG + Intergenic
1141710410 16:85695654-85695676 GTCTCTCAGCAGGAGCCGCAGGG - Intronic
1142567252 17:848686-848708 GTCTCTCAGTAGGAGGCATTTGG - Intronic
1143660611 17:8322370-8322392 CCCTGACTGCAGGAGGCACAGGG + Exonic
1144909346 17:18668108-18668130 GCCTCTCTGCAGGTGGCTGAGGG + Intronic
1144940789 17:18938765-18938787 GTCTCCCTGCTGGAAGCTCAAGG - Intergenic
1146695881 17:34908912-34908934 GAGGCTCTGCAGGAGGCACCAGG + Intergenic
1147326004 17:39669932-39669954 TTCCCTGTGCAGGAGGCACAAGG - Exonic
1147791961 17:43019641-43019663 GCCTCTGTGCAGGAGGGAAAGGG + Intronic
1148794051 17:50188785-50188807 CTCTCTCTGCAGGGGGCTCCTGG - Exonic
1151241290 17:72760379-72760401 GGCTCTCTACAGGAAGCAGATGG - Intronic
1151354226 17:73548991-73549013 GTGTCTCTTCAGGAGGCAGCCGG - Intronic
1151971731 17:77460824-77460846 GTCTCTGGGCAGAAGGGACAAGG - Intronic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1152775185 17:82196848-82196870 GCGTCTCTGCAGGAGTCACGAGG - Intronic
1152775204 17:82196974-82196996 GAGTCTCTGCAGGAGTCACGAGG - Intronic
1152775216 17:82197053-82197075 GCGTCTCTGCAGGAGTCACGAGG - Intronic
1152775234 17:82197171-82197193 GCGTCTCTGCAGGAGTCACGAGG - Intronic
1153057537 18:961861-961883 GTCTCTGTGCCGGATGCAGAGGG + Intergenic
1153773465 18:8433478-8433500 ACCTCTTTGCAGGAGGCACTTGG - Intergenic
1154056934 18:11021926-11021948 GTGACTCTGCAAGGGGCACAGGG - Intronic
1154447814 18:14449540-14449562 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157414603 18:47491297-47491319 GACTTGGTGCAGGAGGCACAGGG + Intergenic
1157601836 18:48897611-48897633 ACCTCTTAGCAGGAGGCACAGGG + Intergenic
1157609378 18:48946827-48946849 GTGTCTCTGCAGGAAACCCAAGG + Intronic
1158569357 18:58583848-58583870 GTTTCTCTGCAGAGGGCTCATGG - Intronic
1158852127 18:61505145-61505167 GTGTCTCTGATGGAGGCAGAAGG + Intronic
1158956653 18:62546632-62546654 CTCTCTCAGCATGAGGGACAGGG - Intronic
1159408391 18:68036382-68036404 CTCCCTCTGCAGGAAACACATGG + Intergenic
1160408938 18:78661622-78661644 CTCTCACTGGAGGAGGGACAAGG - Intergenic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161258901 19:3324744-3324766 CTCTCTCTGCTGCAGCCACACGG + Intergenic
1161503913 19:4633762-4633784 ACATCTTTGCAGGAGGCACAGGG - Intergenic
1161524022 19:4742523-4742545 GTCTCTCTGGAGGACGCCCAAGG - Intergenic
1162462478 19:10821275-10821297 CTCCCTGTACAGGAGGCACACGG - Intronic
1163310784 19:16513294-16513316 GTCTCTTTGCAAGAGACAGAAGG - Intronic
1164986758 19:32653870-32653892 TTCACTCTGCGGGAGACACATGG + Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165974000 19:39658288-39658310 ATCTCCCTGCAGGGGGCACGAGG + Intronic
1166211898 19:41311930-41311952 GACTCTCTGAAGGAGACAGATGG - Intronic
1167581344 19:50344861-50344883 GTCTCTCAGCAGGTGACACAGGG + Intronic
1168167060 19:54556047-54556069 CTCTATCTGAAGGAGCCACAGGG + Intergenic
1168578432 19:57533499-57533521 CCCTCTCTGCTGGAAGCACAAGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925306424 2:2850510-2850532 GGCTCTCTGCAGGGGGCAGTGGG - Intergenic
925575266 2:5353655-5353677 GTCTCACTCCATGAGGCACAGGG + Intergenic
925901695 2:8513714-8513736 GTCTCACAGCAGGAGCCACCAGG + Intergenic
926742735 2:16125935-16125957 GTCCCTGTGGTGGAGGCACAGGG - Intergenic
927079444 2:19613136-19613158 GACTTTTAGCAGGAGGCACAGGG - Intergenic
928256043 2:29723385-29723407 GTCTCTCAGCAGGATGACCAGGG - Intronic
929791233 2:45024559-45024581 GTCTCCCTCCAGCAGTCACAGGG + Intergenic
934481533 2:94651510-94651532 GTCTCAATGCAGAAAGCACAAGG - Intergenic
934605323 2:95690781-95690803 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
934925230 2:98377523-98377545 ATCTATCTGCAGGAGGCAAAGGG + Intronic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
936043538 2:109168475-109168497 GGCTCTCAGCAGGAGGGAGAGGG + Intronic
936538780 2:113333334-113333356 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
937260115 2:120580034-120580056 GTCTTTCTGCAGATGGCACCAGG + Intergenic
937517324 2:122670214-122670236 GTCTCTCTGGACCAGGCACTGGG + Intergenic
938119683 2:128624774-128624796 GTCTCTCTGCTGAAGGAAGAAGG + Intergenic
938141678 2:128799555-128799577 GACTCTGTTCAGGAGGCAGAGGG + Intergenic
938152468 2:128899398-128899420 GCTTCTCAGCAGGATGCACAGGG + Intergenic
939417864 2:141924354-141924376 GGCTCTCAGCAGGATGGACAGGG - Intronic
939862146 2:147433272-147433294 GGCTCTCTTCAGCAGACACAGGG + Intergenic
942935762 2:181554754-181554776 GTCTCTCTCCAGGAGGCAAATGG + Intronic
943568815 2:189547846-189547868 GTATCTATGTAGGAGGCATAGGG + Intergenic
943836889 2:192525161-192525183 GTCTCCCCTCAGGAGGCACGGGG - Intergenic
945200579 2:207277217-207277239 GTCTCTCTGCAGCCAGGACATGG - Intergenic
947394040 2:229669964-229669986 GACTCTCTGCAGCTTGCACAGGG - Intronic
947528791 2:230895557-230895579 CTCTCTCTGCAGGAGCCAGAAGG - Intergenic
947614714 2:231548442-231548464 GTCTCTCTGCAGAGCCCACAGGG + Intergenic
948398390 2:237664066-237664088 GTCTCTCTGCAGCATGGACATGG - Intronic
948613834 2:239185531-239185553 ATCTCTCCCCAGGAGGCACAGGG - Intronic
948859100 2:240744277-240744299 CTCTCTCTCCAGGACGAACAGGG + Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1168759755 20:341956-341978 GTCTCTCTGCATGAGCCAGTTGG - Intergenic
1168991489 20:2100130-2100152 GCCTTTCATCAGGAGGCACATGG - Intergenic
1170781667 20:19431014-19431036 GTATCTCTGCTGGGGGCAAAAGG + Intronic
1171045918 20:21809358-21809380 GGATGGCTGCAGGAGGCACAGGG + Intergenic
1172660212 20:36562901-36562923 ATGGCTCTGCAGGAGGCAGAGGG + Intergenic
1173160651 20:40649742-40649764 GTCTCAATGCAGCAGGCCCAGGG - Intergenic
1173266994 20:41493078-41493100 TTCTCTCTGTGGGAGTCACAGGG + Intronic
1173534073 20:43795439-43795461 GTCTCTATGAAGCAGGCATAAGG - Intergenic
1173908022 20:46642816-46642838 AACTTTCTGCAGGAGGCAAAGGG + Intronic
1173977317 20:47196776-47196798 ATGTCTATGCAGGAGGCAGATGG + Intergenic
1174278276 20:49419578-49419600 ATCTGCCTGCAGGAGGCACCTGG + Intronic
1175301367 20:57945633-57945655 GTTACCCTGCAGGAGGGACAAGG - Intergenic
1175311232 20:58012871-58012893 GTCTGTCTCCAGGAGGAAAATGG + Intergenic
1175418397 20:58816378-58816400 GCCTCTCTGCAGGAGGCCGCTGG - Intergenic
1175544214 20:59767679-59767701 GTCTCTTTGCAGGAGTCAAAGGG + Intronic
1175788009 20:61724038-61724060 GTCCCCATGCAGGGGGCACAGGG + Intronic
1175986179 20:62765149-62765171 GTCACTCTGGAGGTGGCCCAGGG + Intergenic
1176448393 21:6841125-6841147 GCGTCCCTGCAGGAGGCAGAAGG + Intergenic
1176826563 21:13706147-13706169 GCGTCCCTGCAGGAGGCAGAAGG + Intergenic
1178361416 21:31951576-31951598 GTGACTCTCCAGGAGGCACCAGG - Intronic
1179937701 21:44615635-44615657 GTCTCTCTGCAGGTGCCTCCTGG + Intronic
1181134244 22:20753062-20753084 GTCTGTCTGCTGGAGGCATCTGG - Intronic
1181432258 22:22888648-22888670 CTCACTGGGCAGGAGGCACATGG - Intronic
1182023051 22:27097348-27097370 GTATGTCTGCAGGATGCAGACGG - Intergenic
1183796862 22:40126185-40126207 GCCTCTGTGCAGCAGGAACAGGG - Intronic
950636609 3:14319894-14319916 GACCCTCTGCAGGAGGCAAGCGG - Intergenic
951563341 3:23989272-23989294 GTCTGCCTGCAGGAGGACCAAGG + Intergenic
952906463 3:38142155-38142177 AGCTCTCTGCAGGTGGCCCAGGG - Exonic
953046321 3:39296755-39296777 GGCTCTCTGCAAAAGGCCCATGG + Intergenic
955426994 3:58801654-58801676 GTCAGTCTGGAGGAGCCACACGG + Intronic
958101208 3:89013397-89013419 CTCTCTCTGCAGGAGACAAGAGG - Intergenic
959398618 3:105871576-105871598 GTGTCTCTACTGGAGGCACCCGG - Intergenic
960047757 3:113213281-113213303 GTGCATCTGCAGGTGGCACAAGG - Intronic
960215583 3:115032357-115032379 GTGTGGCTGCAGGAGACACAAGG + Intronic
960855131 3:122094895-122094917 GTGCCTCTGCAGGTGGCACTAGG - Intronic
964371303 3:156003540-156003562 GTCTCCCAGCAGGAGGCATGGGG + Intergenic
966912674 3:184568343-184568365 ATGTATCTGCAGGAGGCAGAGGG - Intronic
968541969 4:1172451-1172473 GTCCCTCTGGAGGTGCCACAAGG + Intronic
969586451 4:8096974-8096996 GCCTCGCTGCAGGATGCAGAGGG + Intronic
970591910 4:17566985-17567007 GTCCCCCTGCAGCAGACACAGGG - Intergenic
970807903 4:20057280-20057302 CTCTCTCTGCATGAGACACAGGG - Intergenic
974472537 4:62337386-62337408 CTCTCTCTGCAGAATTCACAGGG + Intergenic
976620420 4:87121240-87121262 CTCTCTCTTCAGGAGGAAAAAGG - Intronic
981168263 4:141588787-141588809 TTCTCTCTGCTGGAGCCTCAGGG - Intergenic
981507414 4:145518072-145518094 GTTTCTCTTCAGAAGGTACAGGG - Intronic
982268757 4:153565176-153565198 GAAGCTCTGCAGGAGGGACAGGG + Intronic
984591973 4:181627031-181627053 GTTTCCCTGCAGGAGAAACATGG + Intergenic
984702993 4:182830280-182830302 GGCTCTGTGCAGGAGGCAAAGGG - Intergenic
984869072 4:184310996-184311018 GCCTCTCTGCTGTAGGCAGAAGG + Intergenic
985639478 5:1056998-1057020 GCCTCACTGCAGCAGGCAGATGG - Intronic
985667104 5:1186974-1186996 GTCTCTCCTGAGGAGGCCCAAGG - Intergenic
985719212 5:1480515-1480537 GTGTCTCTGCTGGGGGGACAGGG + Intronic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
987100707 5:14589003-14589025 GTCTCTCTCATGGAGACACATGG + Intronic
988928382 5:36012086-36012108 GTCACTTTGCAGAAGGCAAAGGG - Intergenic
990848475 5:60173096-60173118 GTTTCTCTCCAGTAGGCACATGG + Intronic
991293940 5:65061373-65061395 TTCTCTCTGTAGGATGCCCAGGG + Intergenic
992421967 5:76615047-76615069 GTCTCTTTCCAAGAGGCAAAAGG - Intronic
992525087 5:77601711-77601733 GTGTCTCTGAGGGAGGCACCAGG - Intronic
995705850 5:114989045-114989067 CTCTCTCTTCAGAAGGCATAAGG + Intergenic
996218175 5:120893629-120893651 TTCTCCCTGCCGGAAGCACAGGG + Intergenic
997689214 5:135814308-135814330 GGCTGTCTGCAAGAGGCAGAAGG - Intergenic
998909031 5:146937947-146937969 GTCTCTCTGCATATGGCTCAGGG - Intronic
1000202295 5:159023466-159023488 GTCTATCAGTATGAGGCACAGGG - Intronic
1001396799 5:171423560-171423582 GTGGCGCTGCAGGAGGGACAAGG - Intronic
1002323902 5:178392991-178393013 GTCTCTCTGCAAAATGCAGATGG - Intronic
1002432822 5:179213042-179213064 GTGGCTGTGCAGGAGGCAGATGG - Intronic
1002714473 5:181217846-181217868 GTTCCTCTGCAGGAAGCCCAGGG + Intergenic
1006568677 6:34982029-34982051 GTCATTTTGCAGAAGGCACAAGG + Intronic
1007303618 6:40887544-40887566 TGCTGTCTGCAGGAGCCACAGGG - Intergenic
1011413262 6:87088197-87088219 GTCTGTCTGCAGGAGCGCCATGG - Exonic
1011744692 6:90398139-90398161 GTGTGACTGCAGCAGGCACAGGG + Intergenic
1013286027 6:108682564-108682586 GCCTCTCTGCAGGTGGCTGAGGG - Exonic
1014086459 6:117351419-117351441 TTCTCTCTGTGGGAAGCACAAGG + Intronic
1014934774 6:127374557-127374579 GTCTTTGTGCAGGAGGCAGGAGG + Intergenic
1016945389 6:149527639-149527661 GTCTCTGATGAGGAGGCACAGGG - Intronic
1018369972 6:163158764-163158786 CTCACACTGCAGCAGGCACAGGG + Intronic
1018703768 6:166448839-166448861 GTCCCTCTGCAGCAGTTACACGG - Exonic
1019669704 7:2270816-2270838 GTCTTCCTGCAGCAGGGACAAGG + Intronic
1020022468 7:4877478-4877500 CTCGCTCTGCAGGAGGCAGTCGG - Intronic
1020370116 7:7422667-7422689 GTATCACAGCAGGAGGCACATGG - Intronic
1020409776 7:7878334-7878356 GTTTTTCTTCAGGAGGCAGAGGG - Exonic
1023127830 7:36973248-36973270 GTCTCGCTCCAGGAGGCAGAAGG - Intronic
1027142055 7:75665297-75665319 GTCTGGCTGCAGGAAGCAGAGGG + Intronic
1029017055 7:97325804-97325826 GGCTCTCAGCAGGATGGACAGGG + Intergenic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1029610540 7:101624376-101624398 GTCTGTCTGCTGTAGGCACCGGG - Intronic
1030090066 7:105850616-105850638 CTCGTTCTTCAGGAGGCACAGGG - Intronic
1032678237 7:134152990-134153012 GTCTCTGGGAAGGAGACACAGGG + Intronic
1032705020 7:134414154-134414176 CTCACTCTGCTGGAGCCACATGG - Intergenic
1033037603 7:137889199-137889221 GTCTGTTTTCAGGAGGCACTGGG - Intronic
1033243404 7:139699628-139699650 GTCCCTCTGCACCAGGCACAAGG + Intronic
1033690381 7:143730692-143730714 GTCTCTCTGTATGAGAGACAAGG - Intergenic
1034163349 7:149007962-149007984 CTCTCTTTGCCGGAGGGACAGGG - Intronic
1034278435 7:149834879-149834901 GGCTCTTTGCAGGAGGAACAGGG - Intergenic
1034905902 7:154945631-154945653 GCCTCATTGCAGGAGGCCCAGGG + Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035782598 8:2240240-2240262 GTATCTTTCAAGGAGGCACATGG - Intergenic
1035809523 8:2479349-2479371 GTATCTTTCAAGGAGGCACATGG + Intergenic
1037830292 8:22184311-22184333 GTCTCTCTAGTGGACGCACATGG + Intronic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038915450 8:32016378-32016400 TTCTGTCTGCAGGAGCCACATGG + Intronic
1039228556 8:35418067-35418089 CTCACTCTGCAGGGGGCTCAGGG - Intronic
1041241844 8:55855002-55855024 GTATCTCTGAGGGTGGCACAAGG + Intergenic
1041628875 8:60062363-60062385 CTCTCTGTCCAGGAGGCCCATGG - Intergenic
1041646772 8:60261068-60261090 TTCTCTTTCCAGGCGGCACATGG - Intronic
1041691627 8:60693394-60693416 CTCTCTCTGCAGGTGCCCCAAGG - Intronic
1041930744 8:63283931-63283953 GCCTTTCTCCAGGAGGCACTGGG + Intergenic
1042347753 8:67745368-67745390 GCCTTTCTTCAGGAGGCAGAGGG - Intronic
1045281846 8:100756123-100756145 ACCTCTCTCCAGGAGGCACCGGG - Intergenic
1045657859 8:104405708-104405730 GTCTGCCTGGAGCAGGCACAAGG + Intronic
1047071463 8:121348801-121348823 CTCTCTCTGCAGCTGGCACGTGG - Intergenic
1048265622 8:132983105-132983127 GCCTCTCTGCAGTAGGCAGGTGG + Intronic
1048268244 8:133006060-133006082 GTCTCTCTGTAGATGACACATGG - Intronic
1048791032 8:138103775-138103797 GTGTGTCTGCAGGAGCCCCAGGG + Intergenic
1048973993 8:139661214-139661236 GTCACACAGCAAGAGGCACATGG - Intronic
1049774451 8:144398008-144398030 GTCACTCTTCAGCAGGAACATGG + Exonic
1050528008 9:6562992-6563014 TTCACTCTGCAGGAGGGAGAGGG - Intronic
1053676300 9:40432597-40432619 GTCTCAATGCAGAAAGCACAAGG + Intergenic
1053926074 9:43058713-43058735 GTCTCAATGCAGAAAGCACAAGG + Intergenic
1054287419 9:63192296-63192318 GTCTCAATGCAGAAAGCACAAGG - Intergenic
1054289368 9:63268122-63268144 GTCTCAATGCAGAAAGCACAAGG + Intergenic
1054387402 9:64572668-64572690 GTCTCAATGCAGAAAGCACAAGG + Intergenic
1054508321 9:65943697-65943719 GTCTCAATGCAGAAAGCACAAGG - Intergenic
1055668757 9:78579118-78579140 GTCTCACTGCAGTAGGCATGGGG + Intergenic
1058866155 9:109164112-109164134 GTCTCTATTCAGGACCCACAGGG + Intronic
1059430282 9:114245854-114245876 GTCTCTTTGCAGGGGGAACCAGG + Exonic
1062484459 9:136768139-136768161 GTCCCTCTGCAGGGTGCACCTGG - Intergenic
1203520798 Un_GL000213v1:43393-43415 GCGTCCCTGCAGGAGGCAGAAGG - Intergenic
1185829280 X:3284154-3284176 GACTCTCTGCAGGAGGATCAAGG + Exonic
1186421323 X:9429246-9429268 GGGTCTCTGCAGGAAGCAGATGG + Intergenic
1186910708 X:14161567-14161589 TTCTTTCTTCAGGAGGCACATGG + Intergenic
1187274607 X:17806566-17806588 GTCTCCATACAGGGGGCACATGG - Intronic
1189129587 X:38484757-38484779 GTATCTCTTCAGAAGGCTCAAGG - Intronic
1189754199 X:44253809-44253831 GTCTCCTAGCAGGAGGCACAGGG - Intronic
1192370614 X:70509828-70509850 GCCTCTCAGCAGGAGCCACTGGG - Intergenic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1193440850 X:81537895-81537917 GTCTAACTCCAAGAGGCACAGGG - Intergenic
1194900754 X:99508265-99508287 TTCTCTGTGCAGGAGACAGATGG + Intergenic
1195295606 X:103473464-103473486 GTCTCTTTGCAGCAAGCCCATGG - Intergenic
1195314606 X:103665615-103665637 CTCTGCCTGCAGCAGGCACAGGG + Intergenic
1196192226 X:112806935-112806957 CTCTCCCTGCTGGAGTCACAAGG - Intronic
1196221998 X:113122404-113122426 GTCTCTTCACATGAGGCACATGG - Intergenic
1197992064 X:132329048-132329070 CTACCTCTCCAGGAGGCACATGG - Intergenic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1201921829 Y:19241868-19241890 GTCTCTCTGTAAGAAACACACGG - Intergenic