ID: 1160834463

View in Genome Browser
Species Human (GRCh38)
Location 19:1117997-1118019
Sequence TCTCCCGTAACCCCCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160834463_1160834467 13 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA 0: 1
1: 1
2: 0
3: 10
4: 135
Right 1160834467 19:1118033-1118055 ACCTAAAGAAACGAGTGAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 143
1160834463_1160834470 18 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA 0: 1
1: 1
2: 0
3: 10
4: 135
Right 1160834470 19:1118038-1118060 AAGAAACGAGTGAAGAGGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 384
1160834463_1160834472 26 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA 0: 1
1: 1
2: 0
3: 10
4: 135
Right 1160834472 19:1118046-1118068 AGTGAAGAGGCTGGGTGTGGTGG 0: 1
1: 16
2: 168
3: 1093
4: 5084
1160834463_1160834471 23 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA 0: 1
1: 1
2: 0
3: 10
4: 135
Right 1160834471 19:1118043-1118065 ACGAGTGAAGAGGCTGGGTGTGG 0: 1
1: 0
2: 10
3: 97
4: 783
1160834463_1160834469 17 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA 0: 1
1: 1
2: 0
3: 10
4: 135
Right 1160834469 19:1118037-1118059 AAAGAAACGAGTGAAGAGGCTGG 0: 1
1: 0
2: 2
3: 43
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160834463 Original CRISPR TCTCCCGTAACCCCCAGGGC CGG (reversed) Intronic
901136777 1:7002293-7002315 ACTCCCGTATCCCACAGTGCTGG - Intronic
901649624 1:10736172-10736194 TCTCCAGGAACCCCCAAGCCAGG + Intronic
904267335 1:29325470-29325492 TCTCCCTTCTCCCCGAGGGCGGG + Intronic
905631811 1:39522990-39523012 TCTCCCTTGCCCCCCAGGACTGG + Exonic
905665950 1:39763197-39763219 TCTCCCTTGCCCCCCAGGACTGG - Exonic
905894445 1:41535922-41535944 TCTCCTGCAATCCCCATGGCTGG + Intronic
906963596 1:50434919-50434941 TCTCCCCTAACCCCCAGACTGGG - Intergenic
910930928 1:92441977-92441999 TCTCCCGTGAGCCCCCGCGCAGG - Intergenic
912436777 1:109667902-109667924 TCTCCTGAAACCCACGGGGCTGG + Intronic
913177368 1:116287178-116287200 TCTCCCATAACCCTCAGTTCTGG + Intergenic
913971600 1:143421643-143421665 TCTCCCCTAAAACCCAGTGCTGG + Intergenic
914065977 1:144247256-144247278 TCTCCCCTAAAACCCAGTGCTGG + Intergenic
914113174 1:144719098-144719120 TCTCCCCTAAAACCCAGTGCTGG - Intergenic
915312387 1:155011130-155011152 ACTCCCCTAATCCCCAGGGTGGG + Intronic
915943895 1:160136080-160136102 TCTCCTGTAACCCCCACAGCTGG - Intronic
916321841 1:163513088-163513110 TCTTCCGTCTGCCCCAGGGCAGG - Intergenic
917003373 1:170385517-170385539 TGTCCCATAACCACCAGAGCTGG + Intergenic
920310056 1:205043548-205043570 TCTCCCCTCAGCCCCAGGGTGGG + Intronic
922876777 1:228945986-228946008 TCTCCCCTCTCCCCCAGAGCTGG - Intergenic
923389233 1:233497625-233497647 TCACCCCTAACCTCCAGAGCAGG + Intergenic
1065000862 10:21336570-21336592 TCTCCTGTGCCCCCTAGGGCTGG + Intergenic
1076331875 10:129676081-129676103 TCTCCTGTAACTCCCAGGAGTGG + Intronic
1077009482 11:373840-373862 TCTCCAGAAGCCCCCAGGGGAGG - Intronic
1077308274 11:1877383-1877405 TCTCCCCTAAAACCCAGTGCTGG - Intronic
1079076457 11:17388093-17388115 GCTCCGGTGACCCCCAGGGAGGG + Exonic
1080923460 11:36731601-36731623 TCTCCCCTTACCCCTAGGGATGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1082004143 11:47410405-47410427 TCTCCGGTGGCGCCCAGGGCTGG + Intronic
1084712585 11:70853093-70853115 TCTCCCGTAAACCCAATGCCAGG - Intronic
1090060330 11:123459145-123459167 TCTGCCCTAACTCCAAGGGCTGG - Intergenic
1091082903 11:132689065-132689087 TCACACGTAATCCTCAGGGCAGG - Intronic
1096240254 12:49955966-49955988 ATTCCCGGAACCCCCAAGGCAGG - Exonic
1096557617 12:52413057-52413079 TGACCCCTCACCCCCAGGGCTGG - Intergenic
1097158045 12:57026944-57026966 TCTCCCATCACCCCCAGCCCAGG + Intronic
1101778436 12:107814868-107814890 CATCCCCTAACCCCCAGGCCAGG + Intergenic
1108490323 13:50975207-50975229 GCTCCCCTGACCCCCAGAGCAGG + Intergenic
1112865506 13:103891775-103891797 TCTTCCCTAACCCCCAGGACTGG + Intergenic
1117162302 14:53001542-53001564 TCTCCCCTACCCCACAAGGCAGG - Intergenic
1118820953 14:69345579-69345601 TCCCCTGTAACTCCCAGGCCTGG + Intronic
1122340502 14:101025254-101025276 CCTCCGGGAAGCCCCAGGGCTGG - Intergenic
1130348138 15:83067357-83067379 ACTCCCGGCAGCCCCAGGGCAGG + Intergenic
1132522147 16:396734-396756 TCCCACGTGAGCCCCAGGGCGGG - Intronic
1132669094 16:1095414-1095436 TCGTCCGGAGCCCCCAGGGCAGG + Intronic
1133393829 16:5430263-5430285 CCTCCCCTGACCCCCAGGTCAGG - Intergenic
1136450378 16:30351336-30351358 TCTCCTGTAGGCCCCAGGGATGG - Exonic
1141829194 16:86500314-86500336 TCTCCCTGAACACCCAGGGAGGG + Intergenic
1142233935 16:88912634-88912656 ACGCCCGTCTCCCCCAGGGCAGG + Intronic
1143092601 17:4457857-4457879 TCAGCCCCAACCCCCAGGGCAGG - Intronic
1143711877 17:8741282-8741304 TCCCCAGTGCCCCCCAGGGCTGG + Intronic
1143814638 17:9502291-9502313 TCTCCCCCAAACCCCAGGGCTGG - Intronic
1146675089 17:34767878-34767900 TGTCACTTAATCCCCAGGGCTGG - Intergenic
1147905866 17:43822740-43822762 CCTCCCATATGCCCCAGGGCTGG + Intronic
1148479226 17:47949330-47949352 TCTCCCTCAACCCCCAAGGAGGG + Intergenic
1152379265 17:79934056-79934078 TGTCCCGCAGCCCTCAGGGCTGG - Exonic
1152759529 17:82100706-82100728 TCCCCCGCACCCCCCAGGCCTGG - Intergenic
1152897602 17:82922038-82922060 CCACCTGTAACCCCCAGGACGGG - Intronic
1153071832 18:1115405-1115427 TCTCCCGTTTCCCACAGGGATGG + Intergenic
1160834463 19:1117997-1118019 TCTCCCGTAACCCCCAGGGCCGG - Intronic
1160946218 19:1645177-1645199 TCTCCAGAATCCCCCAGGGGTGG - Intronic
1161594316 19:5143520-5143542 TGTTCTGCAACCCCCAGGGCAGG - Intronic
927510502 2:23641301-23641323 TCTCTTGTTTCCCCCAGGGCTGG + Intronic
928473025 2:31592633-31592655 TCTACCCTATCCCCCAGGGATGG - Intergenic
929947739 2:46383106-46383128 TCTCCCTAAAGCCCCAGGGAAGG - Intronic
930147801 2:48025195-48025217 ACTCCCCTAATCCCCAGAGCTGG - Intergenic
932761607 2:74441790-74441812 TCTCCCGAAACCACCGGAGCCGG - Exonic
934176296 2:89582576-89582598 TCTCCCCTAAAACCCAGTGCTGG + Intergenic
934286606 2:91656937-91656959 TCTCCCCTAAAACCCAGTGCTGG + Intergenic
938945737 2:136210595-136210617 TTTCCCCTAACCTCCAGGGAGGG + Intergenic
945006882 2:205417847-205417869 TCTCCGGGAACCCCCAGTGGAGG + Intronic
946773220 2:223110947-223110969 TCTGCCATCATCCCCAGGGCTGG - Intronic
948726283 2:239936020-239936042 ACTCCCGGCTCCCCCAGGGCTGG + Intronic
948797433 2:240412146-240412168 TCTCCCGGATCCTCCAGGGAGGG + Intergenic
1169014357 20:2279656-2279678 TCTCCAGAATCCCTCAGGGCAGG + Intergenic
1169053966 20:2604694-2604716 TATCCCGTCACCTCCAGGGAGGG + Intronic
1169827865 20:9789783-9789805 TCTCCCTTAACCTCCAGTGATGG + Intronic
1169889228 20:10434593-10434615 TCTCCCGTAACTCCCGGGATCGG + Intergenic
1174386919 20:50192894-50192916 TCTCCCCTTTCCCCCGGGGCTGG - Intergenic
1174396684 20:50251065-50251087 TCTCCTCAAACCTCCAGGGCAGG - Intergenic
1175217442 20:57399010-57399032 TCTCCCCTCACCCCCATGGCAGG - Intronic
1175230594 20:57471152-57471174 TTTCCCCTAATCTCCAGGGCAGG + Intergenic
1175944505 20:62552436-62552458 TCTCTCTTACCACCCAGGGCAGG - Intronic
1176390047 21:6158702-6158724 CCTCCCGTCACACACAGGGCAGG + Intergenic
1179733419 21:43379538-43379560 CCTCCCGTCACACACAGGGCAGG - Intergenic
1179787065 21:43735941-43735963 GCTCCCGTGGCACCCAGGGCAGG - Intronic
1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG + Intronic
1181034099 22:20161658-20161680 TCCCTCCTACCCCCCAGGGCAGG - Intergenic
1181681831 22:24500664-24500686 TCTGCCTTAATCCTCAGGGCGGG + Intronic
1182061930 22:27404635-27404657 GCTCACGTGACCCCCAGGGTAGG + Intergenic
1182158527 22:28098687-28098709 TTGACTGTAACCCCCAGGGCAGG + Intronic
1184769821 22:46590423-46590445 GCTCCACTAACCCCGAGGGCTGG + Intronic
1184865025 22:47197455-47197477 TGTCCCGGCACCCACAGGGCGGG - Intergenic
1185237649 22:49724287-49724309 TCTCCCGGAAACCGCAGGGAAGG + Intergenic
1185394357 22:50579134-50579156 TCTCCTGGAGCCTCCAGGGCAGG - Exonic
949863460 3:8527572-8527594 TCTCCCAGAACCCCTAGGGAAGG + Intronic
951493866 3:23303190-23303212 TCTCCCGTCACCCCCAGATGGGG + Intronic
957716677 3:83936981-83937003 TCTCCCGTAGTCCCCAGGCCAGG - Intergenic
968334297 3:197900280-197900302 ACTCCCTTAACCACCATGGCTGG - Intronic
968964327 4:3761860-3761882 CCTCCCGTGACCTCCCGGGCTGG - Intergenic
969414776 4:7051169-7051191 CCTTCAGTGACCCCCAGGGCCGG - Intronic
975882634 4:78928880-78928902 TCTCCCATCACCCCCAGAGGGGG - Intronic
981329203 4:143488626-143488648 TGTCCCATAACCACCAAGGCTGG - Intergenic
982765767 4:159346833-159346855 TCTCCAGTAGCTCCAAGGGCAGG + Exonic
984149411 4:176108042-176108064 TCTCCCCTATCCCCCAAGACAGG + Intronic
985547308 5:516141-516163 TTCCCCCTAACCCACAGGGCTGG + Intronic
986014167 5:3742929-3742951 TCTCCTGAAACCCCTAGGTCAGG - Intergenic
989608805 5:43272308-43272330 TCTTCCCTAACCCCCAGACCAGG + Intronic
990119904 5:52438341-52438363 TCTCCCTGAAGTCCCAGGGCAGG - Intergenic
993728767 5:91398014-91398036 TCTCCAGCAGCCCCCAGGGCTGG + Intergenic
1002288800 5:178184263-178184285 TCACCCTTGACCCCCAGAGCTGG - Intergenic
1002295624 5:178229506-178229528 TTTCCCTGAACCCCCAGGTCAGG + Intronic
1002523943 5:179805739-179805761 TCTCCCGGAACCTCCAGGCCGGG + Intronic
1002581092 5:180209623-180209645 TCTCCCGTGGCCCCCAGGGAGGG + Intergenic
1008687453 6:53941425-53941447 TCTCCAGTAAACCCCTGGTCTGG - Intronic
1008760350 6:54846473-54846495 TGCCCCGTAGCCCCGAGGGCGGG + Intergenic
1017914207 6:158819166-158819188 TCGCCCGGCACCCCCGGGGCAGG - Intronic
1018387170 6:163315337-163315359 TCTGACATCACCCCCAGGGCAGG - Exonic
1018962453 6:168458268-168458290 CCTCCCAGGACCCCCAGGGCAGG - Intronic
1018962475 6:168458330-168458352 CCTCCCAGGACCCCCAGGGCAGG - Intronic
1019386471 7:759282-759304 TTTCCTGTGAACCCCAGGGCAGG - Intronic
1019730091 7:2624741-2624763 GCTCCCGGCACCCCCAGAGCAGG + Intergenic
1020187673 7:5971274-5971296 TCTCCCGTCACCCCCAGATGGGG - Intergenic
1020295244 7:6753496-6753518 TCTCCCGTCACCCCCAGATGGGG + Intergenic
1022539388 7:31121827-31121849 TCTCCCATAGGCCACAGGGCAGG - Intergenic
1023091891 7:36625154-36625176 CCTCCCCTGTCCCCCAGGGCAGG - Intronic
1024111053 7:46146481-46146503 ACTCCAGTAACCCCCAAAGCAGG - Intergenic
1027501383 7:78956134-78956156 TCTTCCTCAACCTCCAGGGCAGG - Intronic
1029685018 7:102141297-102141319 TTTCCTGTACCCCGCAGGGCTGG - Intronic
1032903327 7:136335962-136335984 TCTCCCATCACCCCCAGGTGGGG + Intergenic
1037926619 8:22848424-22848446 TCTCCCCTATCCCCCTTGGCTGG - Intronic
1041396706 8:57399108-57399130 TTTCCCAGAACCCCAAGGGCTGG + Intergenic
1041588268 8:59546749-59546771 TCAGCCCTGACCCCCAGGGCAGG + Intergenic
1049266627 8:141671129-141671151 TCTGCTCTAACCCCCAGGGCAGG - Intergenic
1049303293 8:141883213-141883235 TTTCCCAGAGCCCCCAGGGCAGG - Intergenic
1049352181 8:142170286-142170308 TCTCCCGTAGCGCTCAGGCCTGG - Intergenic
1051326036 9:15969736-15969758 ATTCCCCTAACCCCCAGGCCTGG + Intronic
1056566676 9:87778726-87778748 TCTGCAGCAACCCCGAGGGCAGG + Intergenic
1058528002 9:105879236-105879258 CTTCCCCTTACCCCCAGGGCAGG + Intergenic
1062424898 9:136501674-136501696 TCTCCCCTAAGCCCCGAGGCTGG - Intronic
1062581891 9:137232430-137232452 TCTTCCGTAACCCCCAGGGCAGG - Intronic
1062715580 9:138008543-138008565 GCTCCCTTGACCCCCAGGGAGGG + Intronic
1185449768 X:275935-275957 TCTCCCGGAGCCCCCAGGACGGG - Intergenic
1187994846 X:24914875-24914897 TCTCCCTTAACCCACAGGAAGGG - Intronic
1190228310 X:48562371-48562393 TCTCCCGTCACCCCCAGTATTGG + Exonic
1190692936 X:52927016-52927038 TCTTCAGTAACCCACAGAGCTGG + Intronic
1190700962 X:52989670-52989692 TCTCCCCAAACCACCAGGCCTGG + Intronic
1192549388 X:72041971-72041993 TTTCCCGCAACCCTCAGGTCTGG + Intergenic
1198293043 X:135257260-135257282 GCTCCCGTATGGCCCAGGGCGGG - Intronic