ID: 1160834463

View in Genome Browser
Species Human (GRCh38)
Location 19:1117997-1118019
Sequence TCTCCCGTAACCCCCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160834463_1160834470 18 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA No data
Right 1160834470 19:1118038-1118060 AAGAAACGAGTGAAGAGGCTGGG No data
1160834463_1160834471 23 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA No data
Right 1160834471 19:1118043-1118065 ACGAGTGAAGAGGCTGGGTGTGG No data
1160834463_1160834469 17 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA No data
Right 1160834469 19:1118037-1118059 AAAGAAACGAGTGAAGAGGCTGG No data
1160834463_1160834472 26 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA No data
Right 1160834472 19:1118046-1118068 AGTGAAGAGGCTGGGTGTGGTGG No data
1160834463_1160834467 13 Left 1160834463 19:1117997-1118019 CCGGCCCTGGGGGTTACGGGAGA No data
Right 1160834467 19:1118033-1118055 ACCTAAAGAAACGAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160834463 Original CRISPR TCTCCCGTAACCCCCAGGGC CGG (reversed) Intronic