ID: 1160837609

View in Genome Browser
Species Human (GRCh38)
Location 19:1132108-1132130
Sequence CTGCAGCCACAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 736
Summary {0: 1, 1: 0, 2: 14, 3: 87, 4: 634}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160837601_1160837609 19 Left 1160837601 19:1132066-1132088 CCCGCCCCGGGAAGGGAGTGTTA 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634
1160837602_1160837609 18 Left 1160837602 19:1132067-1132089 CCGCCCCGGGAAGGGAGTGTTAC No data
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634
1160837605_1160837609 13 Left 1160837605 19:1132072-1132094 CCGGGAAGGGAGTGTTACCTTGT 0: 1
1: 0
2: 1
3: 17
4: 138
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634
1160837606_1160837609 -4 Left 1160837606 19:1132089-1132111 CCTTGTTCAGAGCCTCAAACTGC 0: 1
1: 0
2: 3
3: 31
4: 175
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634
1160837600_1160837609 24 Left 1160837600 19:1132061-1132083 CCTCGCCCGCCCCGGGAAGGGAG 0: 1
1: 0
2: 3
3: 50
4: 392
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634
1160837604_1160837609 14 Left 1160837604 19:1132071-1132093 CCCGGGAAGGGAGTGTTACCTTG 0: 1
1: 0
2: 5
3: 29
4: 161
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634
1160837603_1160837609 15 Left 1160837603 19:1132070-1132092 CCCCGGGAAGGGAGTGTTACCTT 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG 0: 1
1: 0
2: 14
3: 87
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160837609 Original CRISPR CTGCAGCCACAGCTGCAGCT GGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900348718 1:2224770-2224792 CTGCAGGCACAGCCACAGCGCGG - Intergenic
900352683 1:2243382-2243404 CTGCACCCACAGCTGCAGAAAGG - Intronic
900471429 1:2856879-2856901 CTGCAGCATCGGCCGCAGCTGGG - Intergenic
900563557 1:3320781-3320803 TTCCTGCCACAGCAGCAGCTGGG - Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901012874 1:6211057-6211079 CTGGAGCCACTGCTGCTGCTGGG + Exonic
901020852 1:6254690-6254712 CTGCCGCCGCAGCTGCACCACGG + Exonic
901041079 1:6363937-6363959 CTGGGACCACAGGTGCAGCTGGG - Intronic
901044595 1:6388223-6388245 CTGCAGCCTCCCCAGCAGCTGGG + Intronic
901061332 1:6473339-6473361 GTGCTGCCACTGCTGCCGCTGGG + Exonic
901213953 1:7543379-7543401 CTGCAGCCACAAGTGCTGCTGGG - Intronic
901314311 1:8295468-8295490 CGTCAGGCACAGCTGCTGCTGGG + Intergenic
901492338 1:9602883-9602905 CAGCAGCCAGAGCTGCAGCTCGG - Intronic
901640484 1:10690634-10690656 CTGCAGCCACAGCGACACATGGG + Intronic
902220412 1:14960986-14961008 GGGCAGCCACAGCTGGAGGTGGG - Intronic
902857461 1:19219229-19219251 AAGCAGCTACAGCTGCAGTTTGG - Exonic
902878709 1:19356689-19356711 CTGCAGCCACAGCATCACCGTGG + Exonic
903050424 1:20596345-20596367 CTGCAGCCTCAGCAGCTCCTGGG + Intronic
903464890 1:23545219-23545241 CTGGAGCCACAGCTGCAAGGTGG + Intergenic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904042702 1:27593554-27593576 CCACAGCCACGGCTCCAGCTGGG + Intronic
904318436 1:29681162-29681184 CTGCACGCACAGCTGCAGGAAGG + Intergenic
904439050 1:30517820-30517842 CTGCACGCACAGCTGCAGGAAGG - Intergenic
904482568 1:30803215-30803237 CTGCAGTCCCAGCTGCTACTTGG + Intergenic
904684125 1:32248489-32248511 CTCCAGCTCCAGCTCCAGCTCGG - Exonic
904761971 1:32811835-32811857 CTGCAGGCAAAGATGCAGTTAGG - Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906180048 1:43810361-43810383 CTCCTGCCACAGCTGAAGCCTGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906614932 1:47227510-47227532 CTGCAGCCTCCTCTGGAGCTTGG + Intronic
906691931 1:47798486-47798508 ATGCAGCCATTGCTGCAGGTGGG + Intronic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907238904 1:53069892-53069914 CTGCCGCCACAGCTGCACCTGGG + Exonic
907416980 1:54321258-54321280 CTGCAGGCACTGGTGCAGCGTGG + Intronic
907627356 1:56043280-56043302 CTGCTGCTAGGGCTGCAGCTGGG + Intergenic
907765250 1:57403410-57403432 CTCTAGCCATAGCTGCAACTAGG + Intronic
907811014 1:57869929-57869951 ATGCAGCCCAAGCTGCACCTTGG - Intronic
908089414 1:60670642-60670664 AGGCAGCCACATCAGCAGCTGGG + Intergenic
908729758 1:67213866-67213888 CTGGAGACACAGCTGCCTCTGGG + Intronic
909803687 1:79847830-79847852 CTGCAGGGACGGCTGCAGCTGGG - Intergenic
909948358 1:81689652-81689674 CTGCAGCCACATCTGCCAGTGGG - Intronic
910214936 1:84833749-84833771 TTACAGCCACCCCTGCAGCTGGG - Intronic
910518296 1:88088343-88088365 CTGCAGCCACTCCTCCCGCTAGG + Intergenic
911508593 1:98784327-98784349 CTGCAGCCACCGCTCCCACTAGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912495769 1:110090156-110090178 CAGCACCTCCAGCTGCAGCTGGG - Intergenic
913078633 1:115361290-115361312 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
914392878 1:147237498-147237520 GGGCAGCCACAGCTGTACCTGGG + Intronic
915041522 1:152971898-152971920 CTGCTGCCGCTGCTGCTGCTGGG - Exonic
915055925 1:153130423-153130445 CTCCAGGCACAGCTTCAGGTAGG + Intergenic
915300208 1:154947412-154947434 CTGCAGGCCCAGCTGCAGGTGGG - Exonic
915488496 1:156238717-156238739 CTGAAGGCCCTGCTGCAGCTTGG + Intronic
915535645 1:156533864-156533886 CTCCAGCAACAGCTGCAGGACGG + Exonic
915719209 1:157971764-157971786 CAGCAGCCTGAGCTGCATCTTGG + Intergenic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
916069054 1:161159564-161159586 CTGCGGCTAAAGCTGCAGCCGGG + Exonic
916084917 1:161261464-161261486 CTGCATTCACAGCTGCAGGCGGG + Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916120708 1:161525695-161525717 CTGCAGCAACTTCTGCACCTTGG - Exonic
916130475 1:161607328-161607350 CTGCAGCAACTTCTGCACCTTGG - Intronic
916288013 1:163132258-163132280 CTGCAGCCCAAGCTGTATCTAGG - Intronic
916850278 1:168696228-168696250 CTGGAGCACCAGCTGCAGCCTGG - Exonic
917930294 1:179818072-179818094 CTTCAGCCTCAGCTCCAGCTGGG + Intergenic
918366472 1:183813141-183813163 CTGCCGCCACAGCTTCAGTCAGG - Intronic
919314065 1:195948640-195948662 GGGCAGCCACAGCTGCACCCAGG + Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919647217 1:200107075-200107097 CTGCACCCACAGCTGGCCCTTGG - Intronic
920647440 1:207813943-207813965 CTGCAGCCACAGCTTTAGAGAGG - Intergenic
922293338 1:224227470-224227492 CTTCAGCTTCAGCTTCAGCTTGG + Exonic
922728716 1:227939184-227939206 CTGCGGCCCCATCTGCAGCGTGG - Intronic
922894959 1:229092756-229092778 CTTCAGCCACATCTGCTGTTAGG - Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923611998 1:235504187-235504209 CCGCAGCCAGAGGTGCAGCGCGG + Exonic
924741290 1:246795488-246795510 CTCCAGGCAGAGCAGCAGCTGGG - Intergenic
1063978815 10:11437678-11437700 CTGGAGCCACGGCTGCTACTCGG + Intergenic
1064025319 10:11844105-11844127 CTGCAGCCTCCCCAGCAGCTAGG + Intronic
1064031926 10:11888022-11888044 CTGCAGTCCCAGCTACAGGTGGG + Intergenic
1064103936 10:12485458-12485480 CAGCAGACACATTTGCAGCTGGG - Intronic
1064923445 10:20543529-20543551 CTGAAGTCACAGCTGAAACTGGG + Intergenic
1065207738 10:23373178-23373200 CTGCAGTCCCAGCTACAGCTGGG - Intergenic
1065853128 10:29807458-29807480 CTCCAGCCACAGTTGCAGAGAGG + Intergenic
1066439739 10:35427160-35427182 CTGCAGCACCAGCTGCCCCTGGG + Intronic
1066455526 10:35568574-35568596 CTGCAGCCAGACCACCAGCTAGG - Intronic
1066695876 10:38077112-38077134 CAGCAGCCCAAGCTGCACCTGGG + Intergenic
1067521386 10:47009323-47009345 CAGGAGCCACACCTGCAGCCAGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069847774 10:71384556-71384578 CTGCTGCCACAGCCACAGCCAGG - Intergenic
1070785763 10:79161323-79161345 CAGGAGCCACAGCAGCATCTGGG - Intronic
1071071331 10:81697414-81697436 CTGCAGCCACATCTCCTGCTAGG - Intergenic
1071598787 10:86946116-86946138 CTCCAGCCCCAGCTGCACGTTGG - Intronic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1072102315 10:92240282-92240304 CTGCTGCCGCTGCTGCTGCTGGG + Exonic
1072154852 10:92715055-92715077 TTGCGTCCACAGCTGCAGTTTGG + Intergenic
1072515436 10:96176960-96176982 CTGCAGCCACTGAAGTAGCTGGG - Intronic
1072691652 10:97575974-97575996 CTGCAGCTACTGCTGCATGTGGG - Intronic
1073063593 10:100745923-100745945 CTGCAGCCAGGGCTGAAGCTGGG - Exonic
1073577502 10:104638977-104638999 CTGCAGCCCGAGCCGAAGCTCGG - Intergenic
1075122310 10:119672995-119673017 CCGCAGCCACAGCCTCACCTTGG + Intronic
1075201648 10:120409468-120409490 CTGCAGCCACAGGTCCAGCTGGG - Intergenic
1075424057 10:122327929-122327951 TTTCAGCCACAGCTCCAGCCGGG + Intronic
1075651155 10:124128989-124129011 CTCCAGCCACAGCCACTGCTCGG + Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1076746234 10:132516100-132516122 CTGCACCCCCAGCTCCAGCCAGG + Intergenic
1076783263 10:132736178-132736200 CTGCGGCTCCAGCTGCTGCTGGG + Intronic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077018438 11:407057-407079 GTGCAGCCACAGCTTCCGGTGGG - Exonic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077238879 11:1500308-1500330 CTGAAGCCACAGCCACAGCCAGG - Intronic
1077283697 11:1756725-1756747 CTGCAGCCGCTGCTCCAGCTTGG - Intronic
1077396571 11:2326660-2326682 GTGCAGCAACAGATGCAGGTGGG - Intergenic
1077401296 11:2359094-2359116 ATGCAGCCACAGGTGCAGACAGG - Intergenic
1077477008 11:2795278-2795300 CTGCTGCCAGACCTGCAGTTGGG + Intronic
1077564752 11:3290506-3290528 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077570642 11:3336323-3336345 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077864271 11:6210283-6210305 CGTCAGCCCCAGCTGCAGCCAGG - Exonic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1078544245 11:12235222-12235244 CTCCAGCCATAGCATCAGCTCGG + Intronic
1078949617 11:16115531-16115553 CAGCAGCCCCAGCTTCACCTGGG - Intronic
1079247775 11:18765730-18765752 CTCCAGCCCCAGCTTCAGCCGGG + Intronic
1079304776 11:19312345-19312367 CTGCAGCCTCAGCTCCACCCTGG + Intergenic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1080706608 11:34701359-34701381 GGGCAGCTACAGCTGCACCTGGG - Intergenic
1081493364 11:43583398-43583420 CTGCTGCTGCAGCTGCTGCTTGG + Intronic
1081869422 11:46376584-46376606 CTCCAGCCACAGCTGCTTCCGGG + Intronic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082768520 11:57187435-57187457 CTGCTGCCACCGCTGGAGCAAGG + Exonic
1083211993 11:61193938-61193960 CTTCAGCCCCAGCTCGAGCTGGG + Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083706014 11:64516343-64516365 CTGCAGGAACTGCTGCAGCCAGG + Intergenic
1083996532 11:66275814-66275836 CTGCAGCCACTGCTTCACGTTGG - Exonic
1084492378 11:69485895-69485917 CTGCATCCTTAGCTGCAGCAGGG + Intergenic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084763700 11:71293856-71293878 CTGCAGCCATATCTGCATCGGGG + Intergenic
1084769341 11:71332409-71332431 CCCCAGCCACAGCGGCAGGTGGG + Intergenic
1084770140 11:71337400-71337422 CTGCACCCACAGCTGCTCCAGGG - Intergenic
1084950749 11:72664111-72664133 CTGCAGCCACAGCTCCTGCAGGG + Intronic
1084991044 11:72925939-72925961 TTGGATCCACAGCTGCAGATTGG - Intronic
1085147465 11:74213778-74213800 CTGCAGCCATAGCTGCATTAGGG - Intronic
1085658893 11:78343627-78343649 CGGCAGCCACTGCTGCTTCTTGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1088084413 11:105960242-105960264 CTGCAGCCACCCCTGCCTCTAGG + Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089074168 11:115724741-115724763 CTGATGCCACAGCTGCTGCTGGG + Intergenic
1089890299 11:121874028-121874050 CTGCAGCCAGAGGGGCAGCTGGG + Intergenic
1090329971 11:125923836-125923858 CTGCAGCCACTGGTGCAGTTTGG - Intergenic
1090719770 11:129460500-129460522 CAGCATCCTCATCTGCAGCTTGG - Intergenic
1091122710 11:133069890-133069912 CTAGAGCCACAGCATCAGCTTGG - Intronic
1091250030 11:134136291-134136313 CAGCAGCCACCGCTGCAAGTGGG + Intronic
1091386821 12:101231-101253 CTGCAGCCCTAGCTCCAGGTGGG + Intronic
1091412694 12:254503-254525 CTGCAGCAAAGGCTGCAGATAGG - Intronic
1091545171 12:1496737-1496759 CTGCAGCCACAGCAGCTGTTGGG + Intergenic
1091789748 12:3264995-3265017 CTGCAGCCACCTCTCCAGCCTGG + Intronic
1092242265 12:6842576-6842598 TTGCACCCACCGCTGCAGCACGG - Intronic
1093025858 12:14244618-14244640 CTGCAGCCACAGCATAAGCATGG - Intergenic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1093498576 12:19784148-19784170 CTGCATTAGCAGCTGCAGCTGGG - Intergenic
1093639341 12:21508088-21508110 CTGCAGACACAGATGCCCCTTGG + Intronic
1094454547 12:30617903-30617925 ATTCAGCCACAGCTGCAAATGGG + Intergenic
1094675026 12:32611792-32611814 CTGCAGCAACTGCTCCAGATGGG - Intronic
1095042183 12:37455483-37455505 CTACAGCTACAGCTTCAGTTTGG - Intergenic
1095800924 12:46269282-46269304 CTCCAGCTGCAGCCGCAGCTGGG - Intronic
1095832642 12:46604096-46604118 CTGCTGACACTGCTGCTGCTGGG + Intergenic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1097748988 12:63331108-63331130 CTGCAGCCACCCCTACCGCTAGG - Intergenic
1098286364 12:68911353-68911375 CTCCAGCCGCAGCTGCAGTTTGG - Intronic
1098633878 12:72757301-72757323 CTGCAGCCACTACTGCTGCCGGG + Intergenic
1098951487 12:76644915-76644937 CTGCAGCTGCAGCTGCACCTGGG - Intergenic
1101061438 12:100976639-100976661 CAGCAGCATTAGCTGCAGCTGGG - Intronic
1101764060 12:107682488-107682510 GGGCAGCCACAGCTGCACCCTGG + Intergenic
1102060325 12:109926534-109926556 GGGCAGCCACAGCTGCACCCGGG - Intronic
1102526485 12:113515715-113515737 CAGCGGCCACAGCAGGAGCTGGG + Intergenic
1102549777 12:113683427-113683449 CTGCAGCCTCAGCATCACCTGGG - Intergenic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1104605274 12:130183554-130183576 CTGCAGCCCCACCTGCAGCTGGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104729441 12:131096990-131097012 CTGCAGCCACAGCAGAGGCGTGG - Intronic
1104919999 12:132285738-132285760 CTCCTGCCATAGCTGCATCTGGG - Intronic
1104937619 12:132374960-132374982 CTCCAGCCACACCTGCACCCAGG + Intergenic
1104970406 12:132528308-132528330 CGGCACCCTTAGCTGCAGCTGGG - Intronic
1104977599 12:132559235-132559257 TTGCAGCTACAGCAGCTGCTCGG + Intronic
1105302898 13:19151587-19151609 CTGCAGCCTCTTCTGCTGCTTGG + Intergenic
1105425259 13:20289017-20289039 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1105425271 13:20289087-20289109 CGGCAGCTGCAGCTGCACCTGGG - Intergenic
1105545499 13:21347927-21347949 CCCAAGCCACAGCTGCAGCCCGG + Intergenic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1108269140 13:48741320-48741342 CAGCAGCCCCAGATGCATCTTGG - Intergenic
1108322285 13:49300849-49300871 GTGCACACACAGCTGCACCTGGG - Intergenic
1109043401 13:57373550-57373572 CTGCAGTCCCAGCTACAGGTAGG - Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1109525144 13:63566069-63566091 CTGGGTCCATAGCTGCAGCTTGG - Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110641899 13:77834578-77834600 CTGCAGCCACACCATCAGCATGG + Intergenic
1110777887 13:79432046-79432068 GTGCAGCCACAGCTGCACCGGGG - Intergenic
1111397095 13:87677814-87677836 CTGCAGCTGCAGCTGCGGCGGGG - Exonic
1111397099 13:87677819-87677841 CCGCAGCTGCAGCTGCAGCCCGG + Exonic
1112733730 13:102394843-102394865 CTGGAGGCAGAGCTGCAGCGTGG + Intronic
1113310036 13:109122144-109122166 CTGCAGCCTTAGCTGAAACTGGG + Intronic
1113533332 13:111045273-111045295 CTGCATCTACATCTGCAGCCAGG + Intergenic
1114070701 14:19103551-19103573 CGGCAGCCTGAGCTGCTGCTGGG - Intergenic
1114091560 14:19296455-19296477 CGGCAGCCTGAGCTGCTGCTGGG + Intergenic
1114253633 14:20983129-20983151 CTCCAGTCACAGCCCCAGCTGGG - Intergenic
1114351930 14:21862045-21862067 CTGCAGGCCCAGCTGCAGTTCGG - Intergenic
1116130780 14:40854260-40854282 GGGCACCCACAGCTGCACCTAGG - Intergenic
1116194397 14:41704226-41704248 CAGCAGCCAGAGCTGTAGTTGGG + Intronic
1116465132 14:45223002-45223024 CTACAGTCACAGCATCAGCTGGG - Intronic
1117119641 14:52553338-52553360 CAGCCGCCACAGCTGCAGGTAGG - Exonic
1118213658 14:63788311-63788333 CTGCAGCTGCAGCTGCACCAGGG + Intergenic
1118246206 14:64113468-64113490 TTGCAGCCACAGCTCCAGCTCGG - Exonic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119669217 14:76506101-76506123 CTGAAGCCACAGGTGCTGCCTGG - Intergenic
1120745365 14:88146936-88146958 CTGGATCTGCAGCTGCAGCTTGG - Intergenic
1121294700 14:92809394-92809416 TTGCAGCCACAGCTTCAGTCAGG - Exonic
1121587023 14:95069391-95069413 CTGAAGCCACATCTCCAGCCTGG - Intergenic
1121614374 14:95303312-95303334 CTGCAGCCTCTGCTGCACATAGG - Intronic
1122155539 14:99748093-99748115 CTGCAGCCACACCTCCTGCCCGG - Intronic
1122268562 14:100558027-100558049 CTGGAGCCCCACCTGCAGCTGGG - Intronic
1122618857 14:103041676-103041698 CACCGGCCGCAGCTGCAGCTTGG + Intronic
1122770908 14:104097252-104097274 CTGCAGCCACAGCTGTTGGTGGG + Intronic
1202940706 14_KI270725v1_random:143208-143230 CTACAGCTACAGCTGCAGTTTGG - Intergenic
1123463487 15:20495676-20495698 ATGCACCCACACCTGCAGCACGG + Intergenic
1123654574 15:22504741-22504763 ATGCACCCACACCTGCAGCACGG - Intergenic
1124146042 15:27126490-27126512 GTGCAGCCACAGCCACAGCCAGG - Intronic
1124274329 15:28313084-28313106 ATGCACCCACACCTGCAGCACGG + Intronic
1124308485 15:28599938-28599960 ATGCACCCACACCTGCAGCACGG - Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1126292758 15:47100039-47100061 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1127023349 15:54775709-54775731 CTGCAACCCCAGCTGCTGCTGGG - Intergenic
1127865155 15:63026558-63026580 CTGCACCCTCAGCTCCACCTGGG - Intergenic
1128374181 15:67064269-67064291 CTGCAGCAGCAGCTGCGGATTGG + Intronic
1128834281 15:70796685-70796707 CTGAAGCCGGAGCTGCAGCCTGG + Intergenic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1128921314 15:71612566-71612588 CTCCATCAACAGCTGCAGCACGG - Intronic
1128944277 15:71810784-71810806 CTGCAGCTGCGCCTGCAGCTGGG + Exonic
1128944843 15:71813165-71813187 TTCCATCCAGAGCTGCAGCTGGG - Intronic
1129970599 15:79774751-79774773 CTTCAGCCTCACCTGTAGCTGGG - Intergenic
1131217600 15:90552117-90552139 CTGCTGCCACAGCAGGCGCTCGG - Intronic
1131567784 15:93502521-93502543 CGGTAGCCACAGCTGCATGTTGG - Intergenic
1132229493 15:100171135-100171157 CTGCAGCCCCTCCTGCAGGTGGG - Intronic
1132668277 16:1091608-1091630 CTGCCCCCACAACTGCAGCCAGG + Intronic
1132809787 16:1792059-1792081 CTGGAGCCACAGGCGCTGCTGGG - Exonic
1132897474 16:2235942-2235964 CTGGGGGCACAGCTCCAGCTGGG - Exonic
1133210507 16:4260924-4260946 CTGATGCCACAGCTCCAGCCTGG + Intronic
1133264757 16:4576303-4576325 CAACAGACACGGCTGCAGCTGGG + Exonic
1133296008 16:4752630-4752652 CTTCAGCCAGAGCTCCAGCCTGG - Exonic
1133346146 16:5071889-5071911 CTGCTGCCGCTGCTGCTGCTGGG + Exonic
1133387457 16:5381497-5381519 CTGCAGCCTCAGCTTCACCAGGG - Intergenic
1133409737 16:5558331-5558353 CTGCCTCCACAGCTGCATCTAGG - Intergenic
1133714312 16:8432280-8432302 CACCAGCCACAACTACAGCTTGG - Intergenic
1134243475 16:12522924-12522946 CTGCAGCCACCCATGTAGCTGGG + Intronic
1135028419 16:19016557-19016579 CTCCCGCCACAGCTCCAGGTGGG - Exonic
1135724836 16:24846221-24846243 CTCCAGCCTCAGCTGCAGCGGGG - Exonic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136271718 16:29152548-29152570 CTGCACACACAGCTGCATCTGGG - Intergenic
1137256306 16:46778150-46778172 GGGCAGCCACAGCTGCACCCTGG - Intronic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1137978169 16:53048288-53048310 CTGCAGCCACTGTAGTAGCTGGG - Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1139871673 16:70113450-70113472 CTGCAGCCACCATTGCATCTTGG - Intergenic
1140162421 16:72511785-72511807 CTCCTGCCTCAGCTGTAGCTTGG - Intergenic
1140364262 16:74369033-74369055 CTGCAGCCACCATTGCATCTTGG + Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142025482 16:87810625-87810647 CTGCAGCCCCAGGTGGACCTTGG + Intergenic
1142075384 16:88114708-88114730 CCGCACACACAGCTGCATCTGGG - Intronic
1142394634 16:89825055-89825077 CTCCAGCCACTGCTGCATCCTGG - Intronic
1142699258 17:1649488-1649510 CTGCGCCGACACCTGCAGCTGGG + Exonic
1142706690 17:1699708-1699730 CCCCTGCCTCAGCTGCAGCTGGG + Intergenic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1144785217 17:17827639-17827661 CTGGAGCCCCAGGTGCACCTGGG + Intronic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1145886274 17:28384511-28384533 CTGCAGCCACGTCTGAACCTCGG - Exonic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1147162927 17:38578456-38578478 CCGCAGCCGCAGCCGCAGCCGGG + Intronic
1147818616 17:43228462-43228484 CTGCAGCTCCTGCTGCTGCTGGG + Intergenic
1147831899 17:43303164-43303186 CTGCAGCTCCTGCTGCTGCTGGG + Intergenic
1147999616 17:44380122-44380144 CTGCCGGTCCAGCTGCAGCTCGG + Exonic
1148143261 17:45343071-45343093 CTTCTCCCCCAGCTGCAGCTGGG + Intergenic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148640512 17:49183889-49183911 GGGCAGCCGCAGCTGCACCTGGG + Intergenic
1148801003 17:50225794-50225816 CTGAAGCCACAGCTATACCTTGG + Intergenic
1149088597 17:52751095-52751117 CTGCAGCTGCAGCTGCATCTGGG - Intergenic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1151403492 17:73871659-73871681 CTGCAGGCTCAGGTGCAGCAGGG - Intergenic
1151539934 17:74759661-74759683 CTGCAGCCTCTGCTGGAGGTAGG - Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151771622 17:76166383-76166405 CTGGGGCCACAGCTGCTGCCAGG + Intronic
1151786638 17:76278429-76278451 CTCCACCCACAGCTGCAGACAGG - Intronic
1151902021 17:77022585-77022607 CAGCAGCCCCAGCTGTACCTGGG - Intergenic
1152415830 17:80161188-80161210 GGGCAGCCACAGCTGCAACAAGG + Intergenic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152467343 17:80473802-80473824 CTGCAGCCACCCCTGCTCCTTGG - Intronic
1152648765 17:81482357-81482379 CTGCATCCACAGCTTCAGCGCGG - Intergenic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1153337674 18:3941344-3941366 CTGCAGCCTGAACTGCAGCCAGG - Intronic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1153814915 18:8783726-8783748 CTTTAGCCGCAGCTTCAGCTCGG - Exonic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1155299223 18:24413384-24413406 CTGCAGCCACAGCTTCTCTTGGG + Intergenic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1157479110 18:48041473-48041495 CTGCAGCCAAGGCAACAGCTAGG - Intronic
1157807752 18:50670814-50670836 CAGCAGCCTCAGCTTCACCTAGG + Intronic
1157921948 18:51722178-51722200 CAGCTGACTCAGCTGCAGCTGGG - Intergenic
1158165700 18:54537862-54537884 CTGCCACCACAACTGCAGCCAGG + Intergenic
1158575969 18:58638136-58638158 GTGCAGCCACATTTGCAGATTGG - Intergenic
1158946053 18:62447847-62447869 CTGCAGCCCCTCCTGCAGGTTGG - Intergenic
1159186595 18:64983695-64983717 TTGGATCCACAGCTGCAGTTGGG - Intergenic
1159378668 18:67628456-67628478 CTTCAGCCTCAGGAGCAGCTGGG + Intergenic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160065932 18:75574383-75574405 CTCCAGCCACCGCTGCTTCTTGG + Intergenic
1160404501 18:78635670-78635692 CTGCAGCTCCACCCGCAGCTGGG + Intergenic
1160406441 18:78649591-78649613 CTGGAGCCTCACCTGCAACTGGG + Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161290290 19:3490507-3490529 CTGCACCCACAACAGGAGCTGGG + Intergenic
1161554030 19:4930456-4930478 CTTCAGCCACAGCTGCTGGGAGG - Intronic
1162396586 19:10420850-10420872 CTGCCGCCACAGGTGCTGCGGGG - Exonic
1162490625 19:10989246-10989268 CTGCAGCTCCAGCTGTAACTGGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162798716 19:13099516-13099538 CTGCGGCCAGAGCTGCGGCTTGG + Exonic
1162925817 19:13930087-13930109 CTGCAGCTGCCGCTCCAGCTGGG - Exonic
1162958385 19:14112411-14112433 CTGCAGCCACAGCTGGAAGGTGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163698740 19:18776761-18776783 CTCCAGCCCTAGCAGCAGCTGGG + Intronic
1163935506 19:20439006-20439028 CTGCAGCCACCCCTCCTGCTAGG + Intergenic
1164984344 19:32637689-32637711 CTGGATCCAGAGCTGCGGCTGGG - Intronic
1165027038 19:32969659-32969681 GGGCAGCCACAGCTGCACCTGGG + Intronic
1165095742 19:33409051-33409073 CTGCCTCTACAGCTGCAGCTGGG + Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165477580 19:36040094-36040116 CTGCAGCCAGGCCTGCAGCCGGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166851113 19:45761807-45761829 CTCCAGCTCCAGCTCCAGCTCGG + Exonic
1166897326 19:46032298-46032320 GGGCAGCCGCAGCTGCACCTGGG - Intergenic
1167116273 19:47491043-47491065 CTGCAGCCATCTCTGCAGCCAGG - Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1168665719 19:58203466-58203488 CTCCTGCCTCAGCCGCAGCTGGG - Intronic
925296953 2:2783606-2783628 CTGCAGCCCCTGTAGCAGCTGGG + Intergenic
925348664 2:3187179-3187201 CTGCAGCCACAGCTGTGATTAGG - Intergenic
925394233 2:3520852-3520874 CTGCAGCCACATCTCCAACCTGG + Intergenic
925913077 2:8586023-8586045 CAGCAGCTACACCTGCAGGTGGG + Intergenic
926326419 2:11788162-11788184 CTGCTGGCACGGCTGCTGCTGGG + Intronic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927317317 2:21699126-21699148 CTGCACACAAACCTGCAGCTTGG + Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
927871782 2:26628665-26628687 CTGCAGCCACTCCTGGAGCTGGG + Intronic
928333079 2:30372588-30372610 CTTCTGCCTCAGCTGTAGCTGGG + Intergenic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
930957135 2:57216943-57216965 GGGCAGCTACAGCTGCACCTGGG - Intergenic
933219345 2:79670125-79670147 GGGCAGCCACAGCTGCACCCGGG + Intronic
933294530 2:80474004-80474026 ATGCAGGCACAGCTGCCCCTTGG + Intronic
933454803 2:82507689-82507711 GGGCAGCTACAGCTGCACCTGGG - Intergenic
934247609 2:90321677-90321699 CTGCAGACACAGCTTCTCCTCGG - Intergenic
934261716 2:91480924-91480946 CTGCAGACACAGCTTCTCCTCGG + Intergenic
935581329 2:104758278-104758300 CTGCAGCCAGCGCCACAGCTGGG + Intergenic
936290271 2:111217459-111217481 CTGCAGCTGCAGCTGCACCCAGG + Intergenic
936596488 2:113853189-113853211 CAGCAGCAACAGCTTCACCTGGG + Intergenic
937606677 2:123808532-123808554 CTGCTGCTACTGCTGCACCTGGG + Intergenic
937969299 2:127536920-127536942 CTGCATCCACAGCTCTAGCACGG + Intronic
938180756 2:129179642-129179664 CTGGATCCACAGCCGCAGTTTGG + Intergenic
938263016 2:129908699-129908721 CTGCAGCTGCTGCTGCAGCTGGG - Intergenic
938307104 2:130263827-130263849 CTGCAGCCTCATCTGCTGCTTGG - Intergenic
939914435 2:148021505-148021527 CTGCTGCTACTGCTGCTGCTTGG + Intronic
939991064 2:148876640-148876662 CAGCAGCCCCAGCTGCAGAGAGG - Intronic
942098561 2:172556219-172556241 CTTCAGCCGCAGCTTCAGCTCGG + Exonic
942763976 2:179432154-179432176 CTGCTGCTACTGCTGCTGCTTGG + Intergenic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
944479770 2:200144655-200144677 CTGCAGCCAAAGCTGTACCTTGG + Intergenic
944652560 2:201846134-201846156 CTACAGTCACAACTGCAGCCTGG - Intronic
944955218 2:204799821-204799843 CTGCAGCCATATCTGCATTTGGG - Intronic
945035981 2:205704245-205704267 CTGAAGCCACACCTCCAACTGGG - Intronic
946702148 2:222424607-222424629 CTGCAGGCTCCGCAGCAGCTCGG - Exonic
947522869 2:230862044-230862066 CAGCAGCCCCAGCAGCACCTGGG - Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948391229 2:237612982-237613004 TTGCAGCTGAAGCTGCAGCTGGG + Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948466825 2:238156266-238156288 CTTGAGCCATAGCTGCAGCCAGG + Intergenic
948678038 2:239610634-239610656 CTGCATCCACACCTGCAGCCTGG - Intergenic
948761909 2:240197504-240197526 CTGCAGCCCCAGGTCAAGCTAGG + Intergenic
948897227 2:240933123-240933145 CTGCAGGCACAGCTCCTGCTCGG - Intronic
949024620 2:241760784-241760806 CTGCAGCACCAGCTCCTGCTGGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1170377057 20:15711582-15711604 CTGCAGCAGGTGCTGCAGCTTGG + Intronic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171188851 20:23144069-23144091 CTTCAGCCAGCCCTGCAGCTAGG - Intergenic
1171536617 20:25898555-25898577 CTACAGCTACAGCTGCACTTTGG - Intergenic
1171804489 20:29662602-29662624 CTACAGCTACAGCTGCAGTGTGG + Intergenic
1171839558 20:30193820-30193842 CTACAGCTACAGCTGCAGTTTGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172457987 20:35092707-35092729 CGGCAGCCACAGTGGCGGCTTGG - Exonic
1172846236 20:37931364-37931386 CTGGAGCCACACCAGCAGCCGGG - Intronic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173524591 20:43721913-43721935 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1173916522 20:46712170-46712192 TTGCAGCCACAGCTGATACTTGG - Intronic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174398890 20:50265114-50265136 CTGCAGCCACACAGGCGGCTTGG + Intergenic
1174648602 20:52105755-52105777 CAGCAGCCACAGCGCCACCTGGG - Intronic
1174944714 20:54972101-54972123 CTGCTTCCACAGCTACAGCATGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175525090 20:59628317-59628339 CGGGAGCCAGGGCTGCAGCTGGG - Intronic
1175758393 20:61544689-61544711 CTTCTGCCACAGTTGCAGTTTGG + Intronic
1175875108 20:62225819-62225841 TTTCAGGCACAGCTGCATCTGGG + Intergenic
1175963622 20:62649251-62649273 CTCCTGTGACAGCTGCAGCTGGG - Intronic
1175980813 20:62737748-62737770 CTGCAGCCACAACTGCATTCTGG - Intronic
1176201308 20:63861907-63861929 CTGCTGCCGCTGCTGCAGCAGGG + Exonic
1176582448 21:8543734-8543756 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1176615743 21:9027167-9027189 CTCCAGCCACACTTTCAGCTTGG + Intergenic
1177358957 21:20044960-20044982 CTGCAGGCAAAGCAGCATCTAGG - Intergenic
1177406349 21:20673295-20673317 CTGCAGCCAGAGCTGTACCTGGG - Intergenic
1178147288 21:29754828-29754850 CTGCAGCATCAGCTTCAGCCTGG + Intronic
1178497718 21:33101428-33101450 CGGCAGTCACAGCCGCAGCAGGG - Intergenic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179119174 21:38527291-38527313 CAGCAGCCTCAGCTGCAGCTGGG + Intronic
1179867348 21:44225415-44225437 CTGCATGGACAGCTGCAGCCTGG + Intronic
1179941447 21:44641061-44641083 CTGCATCCAGAGCTGATGCTGGG - Intronic
1180100282 21:45580778-45580800 CTGCGGTCACAGCTGCAGGGCGG - Intergenic
1180172514 21:46067132-46067154 CTGGGGCCACGGCCGCAGCTGGG + Intergenic
1180196314 21:46196511-46196533 CTGCAGACACAGCTGCAAACAGG + Intronic
1180265280 22:10520782-10520804 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1180489166 22:15826016-15826038 CGGCAGCCTGAGCTGCTGCTGGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180918505 22:19506127-19506149 TTACAGCCACTGCTGCAGTTTGG - Intronic
1181079155 22:20402243-20402265 CTGCAGCCACTGTTGCAGGTTGG - Intronic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1182712615 22:32332106-32332128 CTGCAGCCATGTCTGCGGCTTGG - Intergenic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1183063202 22:35347795-35347817 CTGAAGCCTCACCTGCAGCCTGG - Exonic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183893149 22:40947560-40947582 CTGCAGCCTCTCCTGTAGCTGGG - Intergenic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184034499 22:41912066-41912088 CTGCAGCCGCGGCTTCTGCTGGG + Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184588448 22:45463804-45463826 CAGCAGCTTCAGCTGTAGCTGGG - Intergenic
1184884041 22:47331398-47331420 CTGCACCCCCATCTGCATCTTGG + Intergenic
1184996142 22:48209111-48209133 CTGCAGCCTCCCCTGCAGCTGGG - Intergenic
1185016728 22:48347594-48347616 CTGCACCCCCAGCTAGAGCTTGG + Intergenic
1185153010 22:49177167-49177189 CCTCAGCCATGGCTGCAGCTGGG - Intergenic
1185234746 22:49705297-49705319 GGGCCGCCACAGCTGGAGCTGGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949625127 3:5857153-5857175 CTCCTGCCTCAGCTTCAGCTGGG - Intergenic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
949787505 3:7758167-7758189 CTGGAGCCACAACTGAAGTTAGG - Intergenic
949982399 3:9509964-9509986 CTGAAGACCCAGCTGCTGCTAGG + Intronic
950329317 3:12143978-12144000 CTCCAGCCCCAGCTGCACCCAGG - Intronic
950713344 3:14829456-14829478 CTGCAGCCACAGCCCCAGGTTGG - Intronic
951363900 3:21757256-21757278 CTATAGTCACAGCTTCAGCTGGG + Intronic
951529179 3:23682747-23682769 CAGCAGCAACAGCAGCACCTGGG - Intergenic
951864610 3:27294264-27294286 GTGCAGGCACAGCTGCAGGCTGG - Intronic
952016009 3:28958676-28958698 CTGCATCCATAACTGCAGTTTGG - Intergenic
952192732 3:31041367-31041389 CAGCAGCAATAGCAGCAGCTGGG + Intergenic
952271067 3:31831882-31831904 CTCCAGACATACCTGCAGCTGGG + Intronic
953115595 3:39989647-39989669 CTGCAGCCACCCCTCCCGCTAGG + Intronic
953289727 3:41649385-41649407 AGGCAGCTGCAGCTGCAGCTAGG - Intronic
953439777 3:42907380-42907402 CACCAGCCACAGAGGCAGCTAGG - Intronic
954361213 3:50123880-50123902 CTGCAGCCATACCTGCAGTGAGG + Intergenic
954371129 3:50170064-50170086 CTGCACCCCCAGCTGCAGACAGG - Intronic
954452948 3:50581472-50581494 CAGCATCCTCTGCTGCAGCTGGG + Exonic
955228661 3:57080350-57080372 CTGTAGTGACAGCAGCAGCTGGG + Intergenic
956525032 3:70149435-70149457 CAGCAGCATCAGCTTCAGCTGGG + Intergenic
956728925 3:72178642-72178664 CAGCAGCCACAACTCAAGCTGGG + Intergenic
957678688 3:83404103-83404125 GGGCAGCCGCAGCTGCACCTGGG - Intergenic
958784715 3:98585455-98585477 CTGCTGCCACAGCTTCTCCTGGG + Exonic
958819113 3:98952395-98952417 CTGCAGCCACTGTTGCAGATGGG + Intergenic
959979877 3:112504122-112504144 CTTCACCCACTGCTGCAGCAGGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961507088 3:127377269-127377291 TTGCAGCCCCAGCTCCAGCCTGG - Intergenic
961768177 3:129228570-129228592 CTGTAGCCAGAGCTACAGGTGGG - Intergenic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
964117782 3:153154831-153154853 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
964258347 3:154805090-154805112 CTGCAGCCTGAGCTGCACCTTGG + Intergenic
965674116 3:171176710-171176732 CTGCTGCCATTGCAGCAGCTGGG + Intronic
965731322 3:171774979-171775001 CTGAAGGAGCAGCTGCAGCTGGG + Intronic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
965793208 3:172411401-172411423 CTGGATCCACAGCCACAGCTTGG + Intergenic
966491368 3:180531660-180531682 CTGCAGCTGCAGCTGCACCTTGG - Intergenic
966822864 3:183938801-183938823 CTGTTGCCACAGCAGCAGCTGGG + Intronic
967102101 3:186223969-186223991 CTGGGGCCACACCTACAGCTGGG - Intronic
967147394 3:186617583-186617605 CAGCAGCCACAGCTGCCGGCAGG + Intronic
967979871 3:195059332-195059354 CTGCCCCCTCAGCTGGAGCTGGG - Intergenic
968451253 4:677052-677074 ATGCAGCCACAACAGCAGGTGGG - Intronic
968515130 4:1012513-1012535 CTGCTGCCGCCGCTGCTGCTGGG + Exonic
968762751 4:2450951-2450973 CTGAAGCCGCAGCTGCTGCTTGG - Exonic
968856402 4:3127448-3127470 CTTGAGCCACAGCTCCAGCCAGG + Exonic
969136472 4:5033253-5033275 CGGCGTCCACAGCTGCAGCACGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969569189 4:7998614-7998636 CTGCAGCCACACTAGCAGATGGG - Intronic
969574867 4:8030878-8030900 CTGCAGAGCCAGCAGCAGCTGGG - Intronic
969670076 4:8585302-8585324 CTCCAGACACAGCCTCAGCTGGG + Intronic
970172381 4:13302828-13302850 CTGCAGACCCAGCTGCTGATGGG + Intergenic
970440602 4:16078131-16078153 CTGGAGCCACAGCTGCTTTTAGG - Intronic
970652773 4:18196909-18196931 CTGGAGAGACAGCTCCAGCTGGG + Intergenic
971092326 4:23360445-23360467 ACCCAGCCACAGCTGCAGATGGG + Intergenic
972868950 4:43272084-43272106 CTGCAGACACAGCTCCATTTAGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973584708 4:52378071-52378093 CTGCAGCCACCCCTTCCGCTAGG - Intergenic
974286777 4:59879108-59879130 CTGGAGAGACAGCTCCAGCTGGG - Intergenic
974340028 4:60603466-60603488 CAGCAGCCACACCTCCACCTGGG + Intergenic
974878501 4:67725348-67725370 CTGCAGTCATAGCTGAAGCCTGG - Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
976620609 4:87123363-87123385 CTGCAGCCACAGCCACATCTAGG - Intronic
976734637 4:88297076-88297098 CTGCAGCAGCGGCTGCAGCAAGG - Intergenic
977680904 4:99797854-99797876 CAGGACCCACAGCTGCAGGTCGG + Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980159155 4:129138585-129138607 CTGCAGCCACAGGTACATGTTGG + Intergenic
980383533 4:132058219-132058241 CAACAGCCCCAGCTGCACCTTGG - Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982090093 4:151872834-151872856 CTTCAGCTACAGCAGCAGGTGGG + Intergenic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
982288051 4:153755033-153755055 CTGCAGCCAGCACTGCAGGTAGG + Intronic
982303262 4:153901539-153901561 CTGCAGCCCCACCTCCACCTAGG - Intergenic
982610929 4:157574313-157574335 TTGCAGCTGCAGCTGCACCTGGG - Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983491740 4:168397892-168397914 CTGCAGCTGCAGCTGCAGCTTGG - Intronic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
984108030 4:175574725-175574747 CTGCAGCCACAACAGCAGAAGGG - Intergenic
984325086 4:178241603-178241625 CTGGGTCCACAGCTGCGGCTTGG - Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
984915281 4:184718135-184718157 CTGGATCCACTGCAGCAGCTGGG + Intronic
985725597 5:1514321-1514343 CTGCAGCCACAGCAGCACGAGGG + Intronic
985768885 5:1796637-1796659 CTGCAACCAAAGTTTCAGCTTGG + Intergenic
985830329 5:2223411-2223433 CTGCAGCAACTGCTGAACCTGGG - Intergenic
986195843 5:5535824-5535846 CTGCAGCTCCAGGTGCAGATGGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987238906 5:15972543-15972565 CTGCAGACTCAGCTGCTGTTTGG - Intergenic
987546595 5:19318208-19318230 TTGTAGCTACAGCTGCAGATAGG - Intergenic
987812002 5:22849088-22849110 CTACAGCCACAGCTGGAACATGG - Intronic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
988306260 5:29498476-29498498 TAGCAGCTACAGCTGCAGCAAGG + Intergenic
988375813 5:30434406-30434428 CTCCAGCCTCAGCTGCTGCCTGG - Intergenic
989788467 5:45361426-45361448 CTCCTGCCTCAGCTGTAGCTGGG + Intronic
990021141 5:51128693-51128715 CTGCAGCCAAAGCTTCTGCCTGG - Intergenic
990342661 5:54839055-54839077 CAACAGCCTCATCTGCAGCTGGG + Intergenic
990389816 5:55307570-55307592 CTTCTGCCACAGCTGCAACATGG - Exonic
991202335 5:64008862-64008884 CTGCAGCCACCACGGAAGCTGGG + Intergenic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993941348 5:94062808-94062830 CTACAGCGACTGCTGCAGCCTGG + Intronic
994099285 5:95876751-95876773 CGGCAGCAACAGCAGCACCTGGG - Intergenic
994457397 5:100028517-100028539 CTGCAGCCACATCTGCATTAGGG - Intergenic
996046004 5:118873959-118873981 CTGTTGCAACTGCTGCAGCTTGG + Intronic
996716919 5:126595428-126595450 CGGGAGCCACAGTTCCAGCTGGG + Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997837272 5:137205584-137205606 CTGCAATCACAGCAGCAGCTGGG - Intronic
998134541 5:139667903-139667925 CTGGAGCCACCGCAGCTGCTGGG - Intronic
998261098 5:140632477-140632499 CTTGAGCCACTGCTGCAGCTCGG + Exonic
998463391 5:142325306-142325328 CGGCGGCGACTGCTGCAGCTGGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999132968 5:149298801-149298823 CACCAGCATCAGCTGCAGCTTGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1000546538 5:162610336-162610358 CTGCAGCCTGAGCTGTACCTGGG - Intergenic
1001555098 5:172631735-172631757 CTGCAGCCTCAGCTGGTCCTGGG + Intergenic
1002108373 5:176891533-176891555 CTGCAGGCACTCCTGCACCTGGG + Exonic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002596677 5:180328374-180328396 CAGCAGCCGCTGCTGCAGCCTGG + Intronic
1002688909 5:181037080-181037102 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1002927232 6:1611537-1611559 CTGCAGCCAGACCTCCAGCGCGG + Exonic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003790199 6:9537832-9537854 CTTCAGCCTCATGTGCAGCTGGG + Intergenic
1004165893 6:13256165-13256187 CAGCAGCCTGAGCTGCACCTGGG + Intronic
1004520713 6:16358839-16358861 CGGCAGCTGCAGCTGCACCTGGG - Intronic
1005705429 6:28447043-28447065 CTCCAGCCACGGCTGCAGAGAGG + Intergenic
1005958194 6:30679205-30679227 CTGCAGCCAGAGCTCCAGGGCGG - Exonic
1006009770 6:31032527-31032549 CAGCAGCCACAACTGCAGCCAGG - Exonic
1006145848 6:31959169-31959191 CTGGAGCCACAGCAGCTGCCTGG - Exonic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1011284278 6:85706675-85706697 GGGCAGCCACAGCTGCACCCAGG + Intergenic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1012661628 6:101903199-101903221 CTGCAGCCTCTCTTGCAGCTAGG - Intronic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1015280767 6:131431713-131431735 CTGCAGAGAGAGCTGCAGGTAGG - Intergenic
1015726568 6:136305582-136305604 CTGCAGCAACAGCATCACCTGGG + Intergenic
1015946807 6:138511272-138511294 TTGCAGCCAAAACTGAAGCTTGG + Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016758982 6:147716546-147716568 GGGCAGCCACAGCTGCACCCAGG + Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016866003 6:148767080-148767102 CTGCAACCTCAGCTACACCTGGG - Intronic
1017182337 6:151565141-151565163 CTGAAGCAGCAGCTGCAGGTGGG + Intronic
1017478083 6:154819864-154819886 CTGCAGTCCCAGCTGCTGCAGGG + Intronic
1017721360 6:157245607-157245629 TTGCTTCCACAGCTGCAGCGGGG - Intergenic
1017872637 6:158500127-158500149 CTGCAGCAACAGCTGAACCTTGG - Intronic
1018456716 6:163960139-163960161 CTGCAGCCCCAGCTTCATCGTGG + Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019120072 6:169795058-169795080 CTGAAGCCACAGCTACGACTTGG - Intergenic
1019728760 7:2617925-2617947 CTGCTGCCACATCTGCAGTGAGG + Intergenic
1019737717 7:2658876-2658898 ATGCAGTCCCAGCTGCAGGTCGG - Intronic
1020508058 7:9018641-9018663 GTGCCGCCATAGCTGCAGCCTGG + Intergenic
1020586637 7:10078485-10078507 GGGTAGCCACAGCTGTAGCTGGG - Intergenic
1020781248 7:12519048-12519070 CTGAAGCCACTACTGCAGCAGGG - Intergenic
1021119162 7:16778490-16778512 CTGCAGCCTCATCTGAAGCTTGG + Intronic
1021561490 7:21972398-21972420 GGGCAGCCACAGCTGCATCCAGG + Intergenic
1022096468 7:27144610-27144632 CTGCAGCCACAGAGGCTGCCTGG + Intronic
1022350570 7:29563798-29563820 CCGCTGCCACAGGTGCAGGTAGG - Exonic
1022596578 7:31718797-31718819 CAGCAGCCCTAGCTGCTGCTAGG + Intergenic
1022703420 7:32782080-32782102 CTGCAGCCCAAGCTGAACCTTGG + Intergenic
1022907660 7:34872205-34872227 CTGCAGCCCAAGCTGTACCTTGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023522218 7:41060018-41060040 CTCCTGCCACACCTGAAGCTGGG - Intergenic
1023789046 7:43737511-43737533 GGGCAGCCACAGCTGCACCTGGG - Intergenic
1025234025 7:57221484-57221506 CTGCAGCACCAGCTCCACCTGGG - Intergenic
1025288091 7:57685263-57685285 CTACAGCTACAGCTGCAGTTAGG - Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026232045 7:68493395-68493417 CTGCAGCACCAGCAGCAACTGGG - Intergenic
1026279672 7:68911020-68911042 TTGCAGCCAAAGCTTCACCTTGG - Intergenic
1026335031 7:69386831-69386853 CTGCAGCCCCTCTTGCAGCTGGG + Intergenic
1026393678 7:69928768-69928790 CTGCAGCTGCAGCTGCACCTGGG + Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1027888780 7:83943852-83943874 TTTCAGCCACAGCTGCAGAACGG + Intergenic
1028845735 7:95477886-95477908 TTGCAGACAAAGCTGCAGTTAGG - Intergenic
1030373133 7:108723452-108723474 CTGCACTCACAGCTGTAGTTGGG - Intergenic
1030517012 7:110550947-110550969 CTGCAGCCTGAGCTGTACCTGGG + Intergenic
1030752167 7:113241681-113241703 CAGCAGCCTCAGCTGTACCTTGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1033463883 7:141573018-141573040 CTTCATCCACAGCTGAAGGTAGG + Intronic
1034270643 7:149802077-149802099 CTGCAGCCGCAGCTGTGGCCTGG + Intergenic
1034400114 7:150856619-150856641 CTGCAGCCTCAGCTCCTTCTTGG - Exonic
1035134288 7:156685532-156685554 CTGCAGCCACTGCGGCACCATGG + Intronic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1035450891 7:158976273-158976295 GGGCGGCCACAGCTGCACCTGGG - Intergenic
1035777195 8:2197040-2197062 CTGCAGCCACAGAGGCTGGTGGG + Intergenic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1036642161 8:10591451-10591473 CGGCAGCCTCAGCGGCAGCCTGG + Intergenic
1037288581 8:17326770-17326792 CTGCAGTCAAAGTGGCAGCTGGG - Intronic
1037753663 8:21698123-21698145 CTGGAGCCACAGATGCCTCTAGG - Intronic
1038168930 8:25111021-25111043 CCGCAGCCACTGCTGCAGTGGGG + Intergenic
1038319515 8:26514220-26514242 CGGCAGCCGCGGCAGCAGCTAGG + Intergenic
1038708180 8:29915755-29915777 CTGTAGCCCCAGCTGCTACTTGG - Intergenic
1039846413 8:41328958-41328980 CTGCAGCCCCAGCCGCAGCTTGG + Intergenic
1040386640 8:46918846-46918868 CTCCAGCCACTGCTGCACCAGGG + Intergenic
1040466198 8:47697599-47697621 CTGCAGCCTGTGCTGCAGGTGGG + Intronic
1040550429 8:48433053-48433075 CAGCAGGCACAGCTGCACCCAGG - Intergenic
1041007455 8:53509046-53509068 CAGCACCAACACCTGCAGCTTGG - Intergenic
1041017653 8:53607811-53607833 ATGCAGCCACAGCGGCAGTGAGG + Intergenic
1042614395 8:70632702-70632724 CTCCAGCCACAGGGGTAGCTGGG + Intronic
1043044066 8:75299099-75299121 CTTCAGCCTCACCTGCATCTTGG - Intergenic
1043380270 8:79695123-79695145 TTGCAGCCCGAGCTGCAGCCTGG - Intergenic
1043865024 8:85364950-85364972 TGGCAGCAACAGCTGCCGCTTGG + Intronic
1044806200 8:96010789-96010811 CTCAAGCCACAGCTGCTTCTTGG + Intergenic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1044962230 8:97542608-97542630 CTGAAGCTGCAGCTGCACCTAGG - Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1045597576 8:103673576-103673598 CTCTAGCTACAGCTACAGCTGGG - Intronic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1048572027 8:135664444-135664466 CTGCAGAAGCAGCTGCTGCTCGG + Intergenic
1048884416 8:138898210-138898232 CTGCAGCCTCTGCTTCATCTGGG + Intronic
1048998009 8:139806140-139806162 CAGGAGCCACAGCTGCCGCGTGG - Intronic
1049262834 8:141648996-141649018 CGCCTGCCACACCTGCAGCTGGG + Intergenic
1049315458 8:141964636-141964658 CTCCAGGCGCAGGTGCAGCTGGG + Intergenic
1049428032 8:142545914-142545936 CTGTAGCCGCCTCTGCAGCTTGG - Intergenic
1049789958 8:144467999-144468021 CTGCAGGAACGGCTGCAGCTCGG - Intronic
1049876185 8:145022859-145022881 TTGCAGTCACAGCTGCTGCTAGG - Intergenic
1050064250 9:1742198-1742220 CTGAAGCTAAAGATGCAGCTGGG - Intergenic
1050243086 9:3658788-3658810 CTGCAGTCACTGCTGTAGCCAGG - Intergenic
1050447335 9:5739323-5739345 CTGCATTTAAAGCTGCAGCTCGG - Intronic
1051798603 9:20905216-20905238 CTTCAACCACAGCTGAAGGTGGG - Intronic
1052623386 9:30943680-30943702 GGGCAGCTACAGCTGCATCTGGG - Intergenic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1052973097 9:34390733-34390755 CTTCAGCCTCCGCAGCAGCTGGG + Intronic
1053379537 9:37636982-37637004 CTGCAGCCACTGCTTCACGTTGG + Intronic
1053617261 9:39781322-39781344 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053875444 9:42540685-42540707 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053897201 9:42753948-42753970 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054236256 9:62561039-62561061 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054266905 9:62926115-62926137 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054550398 9:66595569-66595591 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1055053704 9:72004472-72004494 TTACAGCCACAGCTACTGCTGGG - Intergenic
1055813424 9:80178109-80178131 CAGCAGCCAGAGCTGTACCTGGG + Intergenic
1056194814 9:84219071-84219093 CTGCAGGCACCGCAGCAGCAAGG - Intergenic
1056771976 9:89484156-89484178 CTGCAGGCCCACCTGCAGCTGGG + Intronic
1057518119 9:95738532-95738554 CTGCAGACCCAGCTGCAGCGAGG - Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057548374 9:96034726-96034748 CAGCTGCCCAAGCTGCAGCTGGG + Intergenic
1057576112 9:96244121-96244143 CAGAAGCCACAGCAGCAGGTGGG + Intronic
1058374345 9:104305415-104305437 CTGCAGCCACCCCTTCCGCTAGG - Intergenic
1059177544 9:112180973-112180995 CTGCTGCCCCAGCTTCTGCTGGG - Intergenic
1059332807 9:113546782-113546804 CTACAGCAGCAGCTCCAGCTGGG - Intronic
1059335960 9:113568639-113568661 CTGCAGCCCAAGCCGAAGCTGGG + Intronic
1059895175 9:118856104-118856126 CTACAGCCACTCCTGCTGCTAGG - Intergenic
1061625666 9:131839291-131839313 CTCCAAGCTCAGCTGCAGCTGGG - Intergenic
1061753831 9:132799024-132799046 CTGAAGCCAGACCTGCAGCCCGG - Intronic
1062022961 9:134327655-134327677 CTGCAGCCTGGGGTGCAGCTTGG + Intronic
1062146818 9:134994182-134994204 TTACACCCACACCTGCAGCTGGG - Intergenic
1062542254 9:137046653-137046675 CTCCAGCCAAAGCTGCAGTCGGG - Intergenic
1062624184 9:137435536-137435558 CTGTGGCCACGGCCGCAGCTGGG - Intronic
1062627326 9:137449210-137449232 CTGCGGCCACGGGTGCAGCGAGG + Exonic
1062654839 9:137598456-137598478 AGGCAGCCCCAGCTGCTGCTGGG + Intergenic
1203612463 Un_KI270749v1:21748-21770 CTACAGCTACAGCTGCAGTTTGG + Intergenic
1185468752 X:370400-370422 CTGCAGCCACGGCTGCAGCGAGG + Intronic
1187118508 X:16379887-16379909 CTTCAGCCACCTCAGCAGCTGGG - Intergenic
1188161725 X:26813482-26813504 CTGCAGCCATATCTGCAGGAGGG + Intergenic
1188174679 X:26974887-26974909 CTGCAGTCTCAGCTGCTACTCGG + Intergenic
1188844846 X:35059891-35059913 CCCAAGCCACAGCTGCAGCTAGG + Intergenic
1188862254 X:35271667-35271689 CTGCAGCCTCAACTCCAGGTTGG - Intergenic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189875545 X:45432952-45432974 CTGCAGCCACATCTGCATTAGGG + Intergenic
1190651289 X:52571236-52571258 CTGCAGCCCCAGCTCCAGACTGG - Intergenic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1190928448 X:54928957-54928979 CTGAAGCCACCACTGGAGCTGGG - Exonic
1191152537 X:57235161-57235183 CTTAAGCCATAGCTACAGCTTGG - Intergenic
1194380206 X:93181528-93181550 GGGCAGCCACAGCTGCATCAGGG - Intergenic
1194552515 X:95319583-95319605 CTGCATCCACAGCAGTAGATGGG + Intergenic
1194897927 X:99468793-99468815 CTGCAGCCACAGCTTCTCCTGGG + Intergenic
1196193255 X:112815539-112815561 CAGCAGCCACAGCAGCAGCCAGG - Exonic
1196395735 X:115260157-115260179 CTCCAGCCTCAGCCTCAGCTGGG + Intergenic
1197723130 X:129758482-129758504 CTGTGGCAACTGCTGCAGCTGGG + Intronic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1199196101 X:145032709-145032731 CAGCAGCCAGAGCTGTACCTTGG - Intergenic
1199845415 X:151689226-151689248 CTGCAGCCATATCTGCATCAGGG - Intergenic
1200165695 X:154033636-154033658 CTGCAACAACAGGGGCAGCTTGG + Intronic
1200268879 X:154662603-154662625 CAGCTGCACCAGCTGCAGCTGGG + Intergenic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic