ID: 1160841816

View in Genome Browser
Species Human (GRCh38)
Location 19:1149779-1149801
Sequence GGCCCCGGGACCCTGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160841802_1160841816 25 Left 1160841802 19:1149731-1149753 CCCGCAGCCCGGGAGTCTGCATC No data
Right 1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG 0: 1
1: 1
2: 0
3: 23
4: 211
1160841803_1160841816 24 Left 1160841803 19:1149732-1149754 CCGCAGCCCGGGAGTCTGCATCT 0: 1
1: 0
2: 1
3: 15
4: 239
Right 1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG 0: 1
1: 1
2: 0
3: 23
4: 211
1160841804_1160841816 18 Left 1160841804 19:1149738-1149760 CCCGGGAGTCTGCATCTCACACA 0: 1
1: 0
2: 4
3: 64
4: 484
Right 1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG 0: 1
1: 1
2: 0
3: 23
4: 211
1160841805_1160841816 17 Left 1160841805 19:1149739-1149761 CCGGGAGTCTGCATCTCACACAA 0: 1
1: 0
2: 3
3: 24
4: 305
Right 1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG 0: 1
1: 1
2: 0
3: 23
4: 211
1160841811_1160841816 -8 Left 1160841811 19:1149764-1149786 CCTGGGGGTGCCGCTGGCCCCGG 0: 1
1: 0
2: 5
3: 47
4: 372
Right 1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG 0: 1
1: 1
2: 0
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160841816 Original CRISPR GGCCCCGGGACCCTGCTTGG AGG Intronic
900177202 1:1296168-1296190 GGCCACGGGACCCCGTTTGTGGG - Intronic
900245063 1:1632816-1632838 GGGCCCGGGACCCGGGTGGGGGG - Exonic
900256294 1:1699975-1699997 GGGCCCGGGACCCGGGTGGGGGG - Intronic
901052235 1:6431005-6431027 GGCTCCAGGACCCTCCTGGGAGG - Intronic
901059582 1:6465870-6465892 GGCCCCCAGACCCTCCTGGGAGG + Intronic
901494423 1:9613142-9613164 GGCCTCAGGACCCTCCCTGGAGG + Exonic
901934693 1:12619219-12619241 GGCCCCGGGAACGTGCAGGGGGG - Intergenic
902481996 1:16717006-16717028 GGCCCCAGGACCCTCCTGGGAGG + Intergenic
903280647 1:22248085-22248107 GGCCCAGGCACCCTGACTGGGGG + Intergenic
904837687 1:33349709-33349731 AGCCCCGGGCCCCGGCTCGGAGG - Intronic
905692796 1:39955390-39955412 GGGCCCGGCACCCCGCGTGGAGG + Intronic
906529594 1:46515891-46515913 GGCCCCTGGACCATGCTCTGAGG - Intergenic
909374513 1:74924332-74924354 GGCTCCAGGACCCAGCTGGGAGG - Intergenic
911975404 1:104488546-104488568 GGCCTCAGGACTCTGCCTGGTGG - Intergenic
912492047 1:110067825-110067847 GGCCTCGGTGCCCTTCTTGGGGG + Intronic
913190878 1:116412003-116412025 GGCCCTGAGTCGCTGCTTGGAGG + Intergenic
1065114532 10:22471873-22471895 GGCCCCAGGTCTCTGTTTGGGGG - Intergenic
1066697994 10:38095251-38095273 GGCCCAGGGGCCCTCCTAGGAGG + Intronic
1067139953 10:43648604-43648626 GTCCACGGGACCCTGCTCTGCGG + Exonic
1070727668 10:78803251-78803273 GGCCACGGGGCCCTGCTGCGGGG + Intergenic
1071253943 10:83849949-83849971 GGCTTGGGGACCCTGCTTTGAGG + Intergenic
1072211256 10:93248939-93248961 AGCTGCGGGACCCTGCTGGGTGG + Intergenic
1074829945 10:117241228-117241250 GGCCCCGGTTCCCTGCTCGCAGG + Intronic
1076833422 10:133008203-133008225 TGCCTCGGGACCATGTTTGGAGG + Intergenic
1077144693 11:1039723-1039745 GGCCCCGGGCCCCAGCTTCCCGG + Intergenic
1077297909 11:1834687-1834709 GGACCCTGGGCCCTGCCTGGGGG - Intronic
1077471046 11:2760654-2760676 GACCCCTGGACCCTGGTTGCAGG - Intronic
1080905814 11:36543567-36543589 GGCACAGGGGCCCTTCTTGGAGG + Intronic
1083812118 11:65112020-65112042 GGCCCGGGGGCCCTGAGTGGGGG - Exonic
1083923815 11:65794146-65794168 GGCCCCCGGGCCCTGTGTGGTGG + Exonic
1084735415 11:71102439-71102461 GGCCCCGCGTCCCTGTTTTGGGG - Intronic
1085052192 11:73385504-73385526 CGCCTCGTGAGCCTGCTTGGAGG + Intronic
1085394666 11:76201235-76201257 GGCCCAGGGGCCCGCCTTGGAGG + Intronic
1085623953 11:78057829-78057851 AGCCCAGGGAGCCTGCTTGCAGG + Intronic
1089662292 11:119993506-119993528 GGCACCAGGCCCCTGGTTGGAGG + Intergenic
1090636838 11:128694726-128694748 GGGCTCGGGTCCCTGCCTGGTGG + Intronic
1091279335 11:134373198-134373220 GGCCCCGGGACACTGATGAGTGG + Intronic
1091703134 12:2677277-2677299 GGGACCGGGACCCTGACTGGAGG - Intronic
1091795516 12:3295536-3295558 CCTCCCGGGCCCCTGCTTGGAGG - Intergenic
1093435667 12:19130919-19130941 GGCACCCGGGCCCTGTTTGGAGG + Intronic
1093581615 12:20790363-20790385 GACCCCAAGACCCTGCTTGTTGG + Intergenic
1096657002 12:53098097-53098119 CTCCCCAGGACCCTGCCTGGAGG - Intronic
1097877137 12:64653909-64653931 GGCCATGGGACCCAGCTTGGAGG + Intronic
1100748701 12:97673289-97673311 GGCCCCTAGCCCCTACTTGGAGG - Intergenic
1104784924 12:131443332-131443354 GGCCCCGTGGCCCTGCCCGGGGG + Intergenic
1104902534 12:132197211-132197233 GGCCACGGGCCGCTGCCTGGAGG - Exonic
1104930415 12:132336589-132336611 GGGCCCGGGACCCCGACTGGAGG + Intergenic
1105000341 12:132686844-132686866 GGGCCGGGGACCCTGCCTGGGGG - Intronic
1110516553 13:76419557-76419579 AGCCTCAGGACCATGCTTGGGGG - Intergenic
1111449083 13:88390765-88390787 GGCCTCTGGACCCTGTCTGGTGG - Intergenic
1112343950 13:98576073-98576095 GGGCCCGGGACCCTGGTGCGCGG + Intronic
1112344040 13:98576354-98576376 GGTCCCGGGGCCCTGCGTGGTGG - Intronic
1112752418 13:102596694-102596716 GACACCAGGACTCTGCTTGGAGG + Intergenic
1113864337 13:113511412-113511434 TGCTCCAGCACCCTGCTTGGCGG - Intronic
1114007972 14:18333804-18333826 GGCCCCGGGAGGCAGCTTTGTGG - Intergenic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1115961429 14:38838464-38838486 ATCCCCGGGATCCTGCGTGGAGG + Intergenic
1119652048 14:76390978-76391000 GGCCCCAGGACCTTGCGAGGAGG + Intronic
1121098286 14:91233150-91233172 AGCCCCTGGTCCCTTCTTGGAGG + Exonic
1122235440 14:100328598-100328620 GGCCCCGAGACCCTGCAGGCTGG - Intronic
1122722813 14:103731669-103731691 GGCCCACCGACCGTGCTTGGAGG - Intronic
1122930066 14:104929019-104929041 GGCCCGGGGGCTCAGCTTGGTGG + Intronic
1124576359 15:30912468-30912490 ATCCCCGGGACTCTGCGTGGAGG + Intronic
1125730231 15:41888910-41888932 GGCCCCAGTACCCTGCATGGTGG + Intronic
1129060929 15:72859779-72859801 GGCCCCATGACCCTCCTTTGTGG + Intergenic
1129293474 15:74586162-74586184 GGCCCCTGCACCCTGCTGTGTGG - Intronic
1129333720 15:74840374-74840396 GGCCCAGGGCCCCTGCTGAGGGG - Intronic
1131411088 15:92208934-92208956 GGCCCCTGGACCCTGCTAATTGG - Intergenic
1132503791 16:296883-296905 GGCCCAGGGAGCCTGCTGGAGGG + Intronic
1132537452 16:489744-489766 GGCCCAGGGAACCTGGGTGGAGG + Intronic
1132553120 16:561305-561327 AGCCCCCGGTCCCTGCTGGGAGG + Intronic
1132554522 16:566677-566699 GACCCAAGGACCCTGCTTGGGGG + Intergenic
1132572427 16:649823-649845 GGCCACGTCCCCCTGCTTGGCGG - Exonic
1132739376 16:1403832-1403854 GGGCCCTGGACGCGGCTTGGGGG + Intronic
1132933693 16:2471016-2471038 GGGCCCAGGACCCTGCTGGGTGG + Intergenic
1134261550 16:12655019-12655041 GGCCTCAGGACTCTCCTTGGAGG - Intergenic
1136460915 16:30409562-30409584 GCCCCAGGGACCCAGCTTGCAGG + Intronic
1139514258 16:67444075-67444097 GGCCCAGGGGACCTGCTCGGTGG + Intronic
1142367206 16:89656951-89656973 GGTCCCGGGTCCATGGTTGGGGG + Intronic
1143503749 17:7352868-7352890 GGCCCCGTGACCCTGAATGTGGG + Exonic
1143548555 17:7614687-7614709 GGCCCCGGCCCCCTGCTCGTTGG - Exonic
1144576574 17:16433523-16433545 CGTCCTGGGACCCTGCCTGGGGG - Intronic
1145747883 17:27333271-27333293 GGCCCCGGGTCCCTCTCTGGAGG - Intergenic
1146058004 17:29590585-29590607 GGCCCGGGCACTCTGCTTGTGGG + Intronic
1146255743 17:31390976-31390998 GGACCCGGGACCCTGCGACGGGG - Intergenic
1147934012 17:44001261-44001283 GGGCCCAGGACCCTTCTGGGTGG + Intronic
1148053296 17:44779662-44779684 AGCTCCGGGGCCCTGCTGGGGGG + Intronic
1148195247 17:45708502-45708524 GGCTCTGGGACCCTGCAAGGAGG - Intergenic
1148584733 17:48769326-48769348 GGCCATGGGACCCTACTGGGAGG - Intronic
1149095366 17:52833387-52833409 GTCCCCTGGACCCTGGGTGGTGG + Intergenic
1149679468 17:58495291-58495313 GGCCACAGGGCCCTGCTTTGGGG - Exonic
1151322872 17:73361933-73361955 GGCCCCGGGACCCTGGGTAGGGG + Intronic
1151571485 17:74928042-74928064 GGTCCTGGGTCCCTTCTTGGTGG - Intronic
1152161178 17:78669557-78669579 CGCCCCGGGCCCTTGCCTGGTGG + Intergenic
1152356493 17:79810108-79810130 GGCCCCGGGAGCCGGCGGGGAGG - Intergenic
1152362703 17:79839833-79839855 GGCCCCGGGACCCCTGCTGGGGG + Intergenic
1152598531 17:81249890-81249912 GGCATCGGGACCCTGCCTGAGGG + Intronic
1152633238 17:81420058-81420080 GTCCTCGGGACCCTGGATGGGGG + Intronic
1152659844 17:81537141-81537163 GGCCCCGGGGCGCCGCTTGGGGG + Intergenic
1152887351 17:82860280-82860302 GGCCCCCGCCCCCTGCATGGCGG + Intronic
1152931823 17:83113927-83113949 GACCCCGCGACCCTCCTTGAAGG + Intergenic
1153673417 18:7434418-7434440 GGCCACGGGAACCTGGATGGGGG + Intergenic
1154954427 18:21241534-21241556 GGCCCCGGGCCCCGGCTCGTCGG - Intergenic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1157858036 18:51118946-51118968 GGTCCCTGGACCCTGCTGGTCGG + Intergenic
1159012466 18:63071007-63071029 GGCCCTGGCACCCTGGTTGTTGG - Intergenic
1159045622 18:63366825-63366847 GGCCCCGGCACCCGGCCTCGCGG - Intronic
1159775379 18:72598365-72598387 GGCCTCGGGACTCTGCCTGTTGG + Intronic
1160392804 18:78547899-78547921 GGCCCCGGGCCCCTGGTGTGGGG + Intergenic
1160703785 19:519782-519804 GACCCCTGGACCCGGCCTGGTGG + Intergenic
1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG + Intronic
1160922520 19:1527692-1527714 GTCCCATGGACCCTGCTTGGTGG - Intronic
1160947428 19:1650276-1650298 GGCCTGGAAACCCTGCTTGGTGG + Exonic
1160988707 19:1851962-1851984 GGCCGGGGGACCCTCCGTGGAGG + Intergenic
1161681273 19:5681013-5681035 GGGGCCGGGCCCCTGCTGGGAGG + Intronic
1162728194 19:12702192-12702214 GGCCCCGGGACGGTACGTGGCGG + Intronic
1163268191 19:16233951-16233973 GGCCTCAGCAGCCTGCTTGGGGG - Intronic
1163838926 19:19593805-19593827 GGCCTTGGGACTCAGCTTGGAGG + Intronic
1164605203 19:29593063-29593085 GGCCCAGGGCCACTGCCTGGAGG + Intergenic
1164695807 19:30242567-30242589 GGGGCAGGGACCCTGCTTTGTGG - Intronic
1165914079 19:39247419-39247441 GGCCCCGGGGACCTTCCTGGAGG + Intergenic
1165916795 19:39265513-39265535 GGCCCCGGGGACCTTCCTGGAGG - Intergenic
1167651902 19:50735938-50735960 GCCCCCGGGAACCAACTTGGTGG - Intergenic
1168705344 19:58467412-58467434 GGCCCCGGGACGCTGCTGGCGGG + Exonic
925167681 2:1728325-1728347 GGCCCAGGGACCCTGCCAGCAGG - Intronic
926107768 2:10163002-10163024 GGGCCCGGGGCCCTGCGTGCAGG - Intronic
927461662 2:23304579-23304601 GGCTCAGGGAGCCTGCATGGAGG + Intergenic
931220590 2:60285121-60285143 GGCCCCAGCACCTTGCGTGGGGG + Intergenic
932741715 2:74295863-74295885 GGCTCCAAGTCCCTGCTTGGTGG - Intronic
937279821 2:120710075-120710097 GGCCCCGAGACCCTGCTTGGAGG + Intergenic
937886324 2:126901976-126901998 GGCCCCAGGACCCAGGATGGAGG - Exonic
938169962 2:129066816-129066838 GGCCCTGGGAGCCTCCGTGGTGG + Intergenic
938528581 2:132161558-132161580 GGCCCCGGGAGGCAGCTTTGTGG + Exonic
941951534 2:171160996-171161018 GGCCGCGGGAGCAGGCTTGGGGG + Intronic
942446582 2:176082374-176082396 GGCCTCGGAAGCCTGCATGGAGG - Exonic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
947634697 2:231674077-231674099 GGCTGCGGGGCCGTGCTTGGTGG - Intergenic
948461260 2:238131018-238131040 GGCCCCGCAACCCCGCGTGGCGG - Exonic
948828361 2:240585373-240585395 GGCCCCAGGCCCCTGATTAGGGG - Intergenic
949059583 2:241949248-241949270 GGCCCCTGGACCCTCATTTGGGG - Intergenic
1170601228 20:17843168-17843190 GGCCCCGAGTCCGTGCCTGGGGG - Intergenic
1172130284 20:32650621-32650643 GGCTGCGGGCCCCTGCTGGGCGG - Intergenic
1175242917 20:57562977-57562999 TGCGCCAGGGCCCTGCTTGGGGG - Intronic
1175443949 20:59007661-59007683 GGCGCGGGGACCCTTCTTTGGGG - Intergenic
1175931650 20:62496475-62496497 GAGCCCCGGACCCTGCTGGGTGG + Intergenic
1176242056 20:64079798-64079820 GGCCCGGGGACCGTGCTGGGCGG - Intronic
1178772457 21:35518339-35518361 GAGCCCGGGAGCCTGCTGGGAGG + Intronic
1179446087 21:41431757-41431779 AGCCCCGGGGCCCGGCCTGGAGG + Intronic
1179639692 21:42739112-42739134 GCCCACTGGACCCTGCTAGGGGG - Intronic
1180006996 21:45027468-45027490 CGGCCCGAGACCCTGCTTGGTGG - Intergenic
1180087427 21:45514262-45514284 ACCCTGGGGACCCTGCTTGGGGG - Exonic
1180163129 21:46006873-46006895 GGCCCAGGGACCCTGGTGAGAGG + Intergenic
1180432479 22:15264614-15264636 GGCCCCGGGAGGCAGCTTTGTGG - Intergenic
1180515052 22:16132594-16132616 GGCCCCGGGAGGCAGCTTTGTGG - Intergenic
1180874821 22:19170233-19170255 TGCCCCCTGACCCTGCTTGATGG - Intergenic
1181803271 22:25360678-25360700 GGTCCCAGGACCGTGCCTGGGGG + Exonic
1182117268 22:27764010-27764032 GGCCCAGGGACCCTGATTTAGGG + Intronic
1182355524 22:29720788-29720810 GGCCCCGTGACCCCGCTGCGGGG - Intronic
1183315514 22:37135014-37135036 GGCCCCGGGGCTCTCCCTGGAGG + Intronic
1183456450 22:37925737-37925759 GGCCCCGGGCTGCTGCTTGGGGG - Exonic
1184017924 22:41800032-41800054 GGCCCGGGGCCCCTGCCGGGCGG - Intergenic
1184389741 22:44196487-44196509 GGCCCTGGGAACCTGCTGTGTGG + Intronic
1184644851 22:45890119-45890141 GGCCCCAGGACCCTGCCTCTGGG - Intergenic
949888416 3:8714232-8714254 GGGCCCTGGAGCCTGCTTTGGGG - Intronic
950518159 3:13480525-13480547 AGCCCCGCGCCCCTGCTCGGTGG + Intronic
954450860 3:50570999-50571021 GGCCCCTGGACCCAGCTGGGTGG - Exonic
955187728 3:56731249-56731271 GGCCCCCGGGCCCAGCCTGGAGG - Intronic
955910946 3:63859674-63859696 GGGCCCTGGCCCCTGCTTTGGGG - Intronic
961446506 3:126983823-126983845 GCCCCCGCGGCCCTGCTGGGAGG - Intergenic
962752099 3:138441066-138441088 GGCCCAGGAAGCCTTCTTGGAGG + Intronic
964344714 3:155744475-155744497 GGTCCCGGGACCCCGCGTGAGGG + Intronic
968731299 4:2270541-2270563 GGCCCGGGGTCCCTGCAGGGAGG + Exonic
969444116 4:7234474-7234496 GGCCCAGTGACCCAGCATGGTGG + Intronic
975139200 4:70902678-70902700 AGTCCCGGGGCCCCGCTTGGTGG - Intronic
979335304 4:119455156-119455178 GGTCCCCGGGCCCTGCCTGGGGG - Intergenic
981191712 4:141872250-141872272 TCCCCCGGGACACTGCCTGGTGG - Intergenic
982123178 4:152161272-152161294 GGACCCGGGAACCTGCTTCTGGG - Intergenic
983939085 4:173522956-173522978 GGGCCCAGGACCCTGGTTGGAGG - Intergenic
985480808 5:109100-109122 GTCCCCAGGGCCCTGCTTGAAGG + Intergenic
985580535 5:693400-693422 GGGCCCGGGACCGGGCTGGGCGG - Intergenic
985623944 5:974452-974474 GACCCCAGCACCCTGCTGGGTGG - Intergenic
985693934 5:1329410-1329432 GGCCTCAGGCCTCTGCTTGGTGG + Intronic
985722180 5:1495136-1495158 GGCCGCGGGGCCCTGTGTGGTGG + Intronic
988592156 5:32558222-32558244 GGTCCCTGGACCCTGCTTATTGG + Intronic
996852405 5:127967267-127967289 GGCCACGGGAGCAGGCTTGGGGG - Intergenic
997193917 5:131965018-131965040 GGCCCAGGGACTCTGCTTAGGGG - Intronic
997200180 5:132005263-132005285 GACCCCAGGACCCTGCTTAGTGG - Intronic
997549343 5:134738483-134738505 GGCTCCGGGACCGCGCTCGGGGG + Exonic
998143679 5:139713492-139713514 GGCCCCTGAACCCTGGGTGGTGG + Intergenic
1002067731 5:176660603-176660625 GGCCCAGGGACCCTCCTAGAGGG - Intergenic
1002568383 5:180127075-180127097 GGCACCGGCACCCTGCTGGTTGG + Intronic
1003078178 6:3000258-3000280 GACACCGGGACCCTGCGTGTGGG - Intronic
1004812095 6:19272870-19272892 GGTCCCTGGACCCTGCTCGTCGG - Intergenic
1006983412 6:38162961-38162983 TGCCCCAGGGCCCTGCTTGGAGG - Intergenic
1006983424 6:38162990-38163012 TGCCCCAGGGCCCTGCCTGGAGG - Intergenic
1006983436 6:38163019-38163041 TGCCCCAGGGCCCTGCCTGGAGG - Intergenic
1007630675 6:43271598-43271620 GGGCCCTGGCCCCTGCCTGGGGG + Intronic
1013268357 6:108521961-108521983 GGCACTGGGACCCTGTCTGGAGG + Intronic
1015882268 6:137881216-137881238 GGCCCGGCAACGCTGCTTGGGGG - Exonic
1018093269 6:160363387-160363409 GGCCCCGTGCCCCTCTTTGGGGG + Intronic
1018706837 6:166469673-166469695 GCCCCCAGGACCCTGCTGAGCGG - Intronic
1019037966 6:169077986-169078008 GGCCCCAGGGCCCTGCTAGAAGG + Intergenic
1019716961 7:2543562-2543584 GGCCCCGGGACGCAGCTGGGGGG - Intronic
1019996117 7:4725474-4725496 GGCCCCGGGCCTCTGCCTGTGGG - Intronic
1022536748 7:31103118-31103140 GGACACGGGCCCCAGCTTGGAGG + Intronic
1025098470 7:56115973-56115995 GTCCCCGGGGCACTGGTTGGGGG + Intronic
1026592886 7:71712038-71712060 GGGCACGGGACGCTGCCTGGAGG + Exonic
1029640824 7:101817617-101817639 AGCCCCGGGACTCTGCCAGGTGG + Intronic
1029665015 7:101989473-101989495 GGCTCCGGGACCTTCCATGGGGG - Intronic
1030176479 7:106660377-106660399 GGCCCCCGGGCCCTGCTTCGGGG - Exonic
1033857219 7:145578140-145578162 GGCCCCGGGTCCAGGCTTGAGGG + Intergenic
1036130589 8:6105892-6105914 GTCCCCGAGTCACTGCTTGGAGG - Intergenic
1038038394 8:23705014-23705036 GGCCTCGGGTCCCTCCTCGGCGG + Intronic
1047782776 8:128123396-128123418 GGCCCCGGGAGGCTGCACGGTGG + Intergenic
1049658402 8:143808931-143808953 GCCCCCTGGACCCTGCCAGGCGG - Exonic
1050382399 9:5043017-5043039 GGCCCCTGGGCCCTGCTGTGTGG + Intronic
1053306122 9:36986031-36986053 GGCGTCGGGACCCGGCCTGGAGG - Intronic
1054842711 9:69760305-69760327 TGCCCGGGGACCTTGCTGGGGGG - Intergenic
1056621777 9:88220925-88220947 GGCACCCGGACTCTGCGTGGAGG + Intergenic
1057181749 9:93034444-93034466 GGGCCAGGGCCACTGCTTGGGGG - Intronic
1057222928 9:93267509-93267531 GGCCCAGGTCCCATGCTTGGAGG + Intronic
1060431191 9:123552558-123552580 TACCCCAGGACCCTGCATGGTGG + Intronic
1061412958 9:130431031-130431053 GGCCCCTGGACCCTGCAGAGAGG + Intronic
1061540726 9:131276877-131276899 AGCCCCGGGACCCTGCACGGCGG - Intergenic
1062372098 9:136245382-136245404 GGCCCCGGGACCCGCCTTCTGGG + Intronic
1062469388 9:136695888-136695910 GGACCCGGGTGCCTGCCTGGGGG - Intergenic
1062584663 9:137243884-137243906 GGCCCTGGGTATCTGCTTGGTGG + Intronic
1203790195 EBV:147301-147323 GGCCCCGGGACACTCCTCTGGGG - Intergenic
1187562189 X:20413269-20413291 GGCCCAGGGACCTCGCTTTGAGG - Intergenic
1192058220 X:67795065-67795087 GACCCAGGGTCCCAGCTTGGAGG + Intergenic
1192482940 X:71500572-71500594 GGCCCCTGGACCCTGCTGATTGG + Intronic
1197421030 X:126237531-126237553 GGACCTGGGATCATGCTTGGGGG + Intergenic
1198724721 X:139664993-139665015 GGCCTCATGACTCTGCTTGGTGG + Intronic
1200074368 X:153543907-153543929 GGCCCCAGGGCCCTGGCTGGAGG - Intronic
1200239544 X:154486521-154486543 GGCCCGGGGACCCTACCTGCAGG + Exonic
1201530417 Y:14985118-14985140 GGCCCCTGGACCCTGCTGATCGG - Intergenic