ID: 1160842034

View in Genome Browser
Species Human (GRCh38)
Location 19:1150547-1150569
Sequence GACCACGGGGGCGTCCGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160842034_1160842044 1 Left 1160842034 19:1150547-1150569 CCGTCACGGACGCCCCCGTGGTC No data
Right 1160842044 19:1150571-1150593 TGGGGGAGACACCACCAGCCGGG 0: 1
1: 0
2: 1
3: 16
4: 296
1160842034_1160842043 0 Left 1160842034 19:1150547-1150569 CCGTCACGGACGCCCCCGTGGTC No data
Right 1160842043 19:1150570-1150592 ATGGGGGAGACACCACCAGCCGG 0: 1
1: 0
2: 1
3: 19
4: 156
1160842034_1160842050 27 Left 1160842034 19:1150547-1150569 CCGTCACGGACGCCCCCGTGGTC No data
Right 1160842050 19:1150597-1150619 ATCATCCTGCTTATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 93
1160842034_1160842045 2 Left 1160842034 19:1150547-1150569 CCGTCACGGACGCCCCCGTGGTC No data
Right 1160842045 19:1150572-1150594 GGGGGAGACACCACCAGCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 164
1160842034_1160842046 3 Left 1160842034 19:1150547-1150569 CCGTCACGGACGCCCCCGTGGTC No data
Right 1160842046 19:1150573-1150595 GGGGAGACACCACCAGCCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160842034 Original CRISPR GACCACGGGGGCGTCCGTGA CGG (reversed) Intronic
No off target data available for this crispr