ID: 1160843978

View in Genome Browser
Species Human (GRCh38)
Location 19:1158652-1158674
Sequence TCTGCCGGGCTCCATCACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843978_1160843982 -3 Left 1160843978 19:1158652-1158674 CCGTGGTGATGGAGCCCGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 128
Right 1160843982 19:1158672-1158694 AGAGGCCACCGCACAGTCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 189
1160843978_1160843990 28 Left 1160843978 19:1158652-1158674 CCGTGGTGATGGAGCCCGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 128
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843978_1160843988 20 Left 1160843978 19:1158652-1158674 CCGTGGTGATGGAGCCCGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 128
Right 1160843988 19:1158695-1158717 AGGCCGCATTACCTCAGCCGAGG 0: 1
1: 0
2: 1
3: 4
4: 36
1160843978_1160843991 29 Left 1160843978 19:1158652-1158674 CCGTGGTGATGGAGCCCGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 128
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1160843978_1160843983 0 Left 1160843978 19:1158652-1158674 CCGTGGTGATGGAGCCCGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 128
Right 1160843983 19:1158675-1158697 GGCCACCGCACAGTCCCTGGAGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843978 Original CRISPR TCTGCCGGGCTCCATCACCA CGG (reversed) Intronic
901041740 1:6368318-6368340 TCTGAAGGGCACCATCAGCAGGG + Intronic
901401584 1:9018485-9018507 TTGGCCGAGCTCCATCTCCACGG - Intronic
903126569 1:21252312-21252334 TGTGCCTAGCTCCATCTCCATGG + Intronic
903225082 1:21890140-21890162 CCTGCCTGTCTCCATCCCCAGGG - Exonic
904898744 1:33838863-33838885 ACTGGCATGCTCCATCACCATGG + Intronic
905356723 1:37389948-37389970 TCTGCCCGCCTCCACCTCCATGG + Intergenic
906556896 1:46721236-46721258 TCTTCCTGGCTCCATCAGCATGG + Intergenic
908957267 1:69648437-69648459 TCTGCCTTGCTCCATGTCCAGGG + Intronic
909364906 1:74808266-74808288 ACTGCCTGTCTCCACCACCAGGG + Intergenic
910365575 1:86461466-86461488 TCTTCTGGGGTCCCTCACCACGG - Intergenic
912503328 1:110137085-110137107 TCTGCGGGGATCCGTCGCCATGG - Intergenic
914898697 1:151699411-151699433 TCTGCCAGGCTCTATCTGCATGG - Intergenic
915005249 1:152629633-152629655 TCTGGCTAGCCCCATCACCATGG + Intergenic
916713339 1:167431176-167431198 TCTGCCCGGCCCTCTCACCAGGG + Exonic
919857602 1:201716418-201716440 TCTGCCTTGCTCACTCACCACGG - Intronic
920022188 1:202964947-202964969 TGTGCCTGTCTCCTTCACCAGGG - Intronic
922179776 1:223224656-223224678 TCTGCAGGGCTCCCTCACGTGGG + Intronic
922452057 1:225745369-225745391 TCTGCCAGGCTCCATGATCAGGG - Intergenic
923119161 1:230974729-230974751 TCAGCTGTGCTGCATCACCAGGG + Intronic
924191485 1:241557370-241557392 TCTACTGGGCTCCATCACGAGGG - Intronic
924463722 1:244282182-244282204 TCTGCTGTGCTCCATGATCAAGG - Intergenic
1062976788 10:1689630-1689652 ACTGCAGGGCACCATCACAATGG - Intronic
1063969088 10:11368802-11368824 TCTGCCCAGCTCTCTCACCATGG + Intergenic
1064307998 10:14186000-14186022 ACTGCTGTGCTCCATCACCATGG - Intronic
1066110192 10:32188852-32188874 TCTGTCTGGCTCCATCACCAAGG + Intergenic
1066474753 10:35735721-35735743 TGTGCAGGGCTCCATCATCTAGG + Intergenic
1067036767 10:42926609-42926631 ACTGCCTGCCTCCAACACCAAGG + Intergenic
1067065090 10:43099784-43099806 TCTGCCTGGCTTCCTCACCTTGG + Intronic
1067451752 10:46385946-46385968 TCTGCCTGTCTCCCTCACCCAGG + Intronic
1067531028 10:47073273-47073295 TCTCCCTGGCTCTATCTCCATGG + Intergenic
1067585486 10:47473809-47473831 TCTGCCTGTCTCCCTCACCCAGG - Intronic
1067821987 10:49538843-49538865 GCTGACAGGCTCAATCACCACGG + Intronic
1069156751 10:65039013-65039035 TCTGCCTGGCTGCATTCCCAGGG - Intergenic
1069959469 10:72071120-72071142 TCTGCCTGGCTCCAAGACCCTGG - Intronic
1070914626 10:80144912-80144934 ACTGCTGGGCTCCAGCTCCAGGG - Exonic
1071353173 10:84767155-84767177 GCTGCCGGGCTCCTACCCCATGG + Intergenic
1076804647 10:132849390-132849412 TGTGCCTGGCTCCATGCCCAGGG - Intronic
1077011366 11:380710-380732 GGTGCCGGGTCCCATCACCACGG - Intronic
1078563192 11:12390770-12390792 TCTGCAGGTCTGCCTCACCAGGG - Intronic
1080887310 11:36378011-36378033 TCTCCCGGGCTTGATCAGCAAGG - Intronic
1083926830 11:65812407-65812429 TCTCCCAGGCACCATCCCCAGGG + Intergenic
1084385938 11:68842702-68842724 TCTCCCGAGCTCCAGCACAAGGG - Intronic
1084542696 11:69797434-69797456 ACTGCCCGGCTCCATCCTCATGG + Intergenic
1085524391 11:77155813-77155835 TCTGCCCTGCTCCAGCACCCTGG - Intronic
1087286047 11:96266094-96266116 GCTGTGGGGCTCCAACACCAGGG - Intronic
1088156446 11:106810169-106810191 ATTGCTGGGCTACATCACCAGGG + Exonic
1091890514 12:4050249-4050271 TCTGCTGAGCTGCAGCACCAAGG + Intergenic
1092780451 12:11981622-11981644 TCAGCCCATCTCCATCACCATGG + Intergenic
1098377737 12:69835826-69835848 GCTGTGGGGCTCCAACACCATGG + Intronic
1101822785 12:108196744-108196766 TCTCCTGAGATCCATCACCAAGG - Intronic
1104674731 12:130704790-130704812 GCTCCGGGGCTCCACCACCAGGG + Intronic
1104802675 12:131565413-131565435 TGTCCGGGGCTCCATCTCCATGG + Intergenic
1105787351 13:23762647-23762669 TCTGACTGGCTGCATCCCCAAGG - Intronic
1106655718 13:31744008-31744030 TTTGCCGAGCTCCCTCCCCAGGG + Intronic
1112548406 13:100394891-100394913 TCTGACGTGCTCCATCATCAAGG + Intronic
1113580897 13:111428095-111428117 GCTGTCGGACACCATCACCAAGG - Intergenic
1113903064 13:113807081-113807103 ACAGCCGGGCCCCAGCACCAGGG - Intronic
1113970520 13:114185291-114185313 TCGGCCTGGCTCCATCACAGCGG - Intergenic
1120318368 14:82927087-82927109 CCTGCCAGGCTCCATAACCCAGG + Intergenic
1126285887 15:47009863-47009885 TCTGGCAAGCTCCACCACCATGG - Intergenic
1130330874 15:82921401-82921423 TGTGACGTGCTCCAGCACCAAGG - Intronic
1132093344 15:98963501-98963523 ACTGCTGGGCTCCAACACCTCGG - Exonic
1132939969 16:2501640-2501662 TGTGCTGGGCTCCACCCCCAGGG + Exonic
1133304629 16:4801543-4801565 TCTGCCGGGCTCCGGCACTGAGG - Exonic
1135880691 16:26252941-26252963 TCTGCCTGGCTCCAAAACCTGGG + Intergenic
1138406404 16:56798135-56798157 TGTGACTAGCTCCATCACCAAGG + Intronic
1139582325 16:67880853-67880875 TATGCCGATCTCCATCCCCAGGG - Exonic
1147306789 17:39569688-39569710 GCTGCAGAGATCCATCACCATGG - Intergenic
1148021854 17:44558534-44558556 TCTGTCGGGCTGCTACACCATGG + Exonic
1148063276 17:44851051-44851073 TCTGCCGGGCTCCATTCCCAAGG - Exonic
1152655653 17:81518102-81518124 TCTGTGGGCCTCCAGCACCAGGG - Intronic
1156339478 18:36198361-36198383 TCTGTCTTGCTCCATCACCCAGG - Intronic
1156469128 18:37366597-37366619 TCTCCCAGGCTCCATCTCCATGG - Intronic
1160843978 19:1158652-1158674 TCTGCCGGGCTCCATCACCACGG - Intronic
1161065555 19:2235796-2235818 TCTGCAGCGCTCCAGCAGCAGGG + Exonic
1161708108 19:5831737-5831759 TCTGCTGGGGCCCAGCACCACGG + Exonic
1161710322 19:5844006-5844028 TCTGCTGGGGCCCAGCACCACGG + Exonic
1161714325 19:5866853-5866875 TCTGCTGGGGCCCAGCACCACGG + Exonic
1162615616 19:11798423-11798445 TCTGCAGGGCTCCGTTACCCAGG + Intronic
1163129790 19:15265316-15265338 TCTGGAGGGCTGCTTCACCAGGG - Intronic
1163889738 19:20000206-20000228 TCTGTTGGGTTCCATCACCAAGG - Intronic
1164628624 19:29746479-29746501 CCCGCAGGGCTGCATCACCATGG - Intergenic
1165256073 19:34577831-34577853 GCTGCCTGGATCCAGCACCATGG - Intergenic
925078571 2:1040854-1040876 ACAGCCGGGCTCCATCACACAGG - Intronic
925126313 2:1459867-1459889 TCTGCAGAGCCCCCTCACCAGGG + Intronic
925399677 2:3563338-3563360 ACCGCCGGGCTCCACCCCCAGGG - Intergenic
926235590 2:11041058-11041080 CCTGCAGGGCTCCACCTCCAGGG + Intergenic
927874094 2:26642896-26642918 TCTGCCAGGCTCTATCCCCATGG - Intergenic
929125794 2:38521735-38521757 ACTGCTGGGCTCCATGTCCAGGG + Intergenic
930576680 2:53159185-53159207 TCTTCCGGGCCTCATCCCCATGG + Intergenic
933424939 2:82098780-82098802 GCTGCCAGCCTCCATCTCCATGG - Intergenic
936497706 2:113036819-113036841 TCTGACTGGCTGAATCACCAAGG - Intronic
937103151 2:119287022-119287044 TCTGGCAGGCTCCATCACTTAGG + Intergenic
939650481 2:144756039-144756061 TCTGCAGGGTACCATCACCAGGG + Intergenic
939932622 2:148254164-148254186 TCTGCAGGGGTTCATCAGCAAGG + Intronic
942327664 2:174789194-174789216 GCTACCGGGCTCCAACCCCACGG - Intergenic
948994887 2:241573132-241573154 TGTTCCGGGCCCCTTCACCAGGG - Exonic
1170750670 20:19141976-19141998 TCTGCAGGTCTCCATCAGAAGGG + Intergenic
1171141800 20:22749888-22749910 CCTGCCTTGCTCCATCACCCTGG + Intergenic
1173523605 20:43716310-43716332 TCTGCCTGGTTCCCTCCCCAAGG + Exonic
1174278670 20:49422292-49422314 TCTTCCCAGCTCCATCTCCATGG - Intronic
1175552980 20:59828924-59828946 TCTGCCTCTCTCCATCCCCAAGG - Intronic
1178736272 21:35155074-35155096 ACTGCCGAGCTCCATCAGCCTGG - Intronic
1181038681 22:20181878-20181900 CCGGCCTGGCTCCATCACCGGGG - Intergenic
1182146046 22:27997420-27997442 TCTGCCTGGCACCAGCACCTGGG + Intronic
1183103138 22:35596267-35596289 TCTGCCAGGCTCCTTCTCCTGGG + Intergenic
1184684058 22:46088084-46088106 CCTCCCGGGCTCCGTCCCCATGG + Intronic
1185024816 22:48402856-48402878 TCTGCCGTGAGCCATGACCACGG + Intergenic
950724447 3:14907450-14907472 TCTGCAGGGAGCCACCACCATGG - Intronic
962733106 3:138300804-138300826 TCTGCAGTTCTCCATTACCAGGG - Intronic
962777170 3:138672667-138672689 TCCGCCTGGCTCCATCTCCCAGG - Intronic
968479947 4:828862-828884 TCTGCGGGGCTTCTTCTCCAGGG - Intergenic
969059513 4:4423949-4423971 TCTGCCTAGCCTCATCACCATGG + Intronic
974052332 4:56952546-56952568 TTTTCCTGGCTCCATAACCAGGG - Intergenic
974894456 4:67922284-67922306 TCTGCAGTTCTCCATCATCACGG + Intronic
986543693 5:8872973-8872995 TCTGTGTGGCTTCATCACCAGGG - Intergenic
986754768 5:10824670-10824692 TCTGCCTGGCTCCATCTACTTGG + Intergenic
992660302 5:78953336-78953358 TCTGCCTGGCTGCATGACCTGGG + Intronic
1000337684 5:160253729-160253751 TGTGCCGGGCACCATTGCCAAGG + Exonic
1001686844 5:173599728-173599750 ACTGCTGGCCTCCATCTCCATGG - Intergenic
1008868812 6:56247585-56247607 TCTCCCGGGCTCCGCCTCCAGGG - Exonic
1014511752 6:122331141-122331163 TCTTTGGGTCTCCATCACCAGGG + Intergenic
1019641926 7:2107875-2107897 TGTGCCAGGCACCATCCCCATGG - Intronic
1024088247 7:45914861-45914883 TCTCCCAGGCTACACCACCAAGG - Exonic
1027175316 7:75899484-75899506 CATGCCGGGCCCTATCACCAAGG - Intronic
1030124138 7:106138771-106138793 TCTGCCAGGTTCAATCAGCAAGG - Intergenic
1032516170 7:132507877-132507899 TCCACCAGGCTCCACCACCAAGG - Exonic
1035360847 7:158313432-158313454 TCTGCCCAGCTCCATCCCCAGGG - Intronic
1035737668 8:1900432-1900454 TCTGTCGGGCTGTGTCACCATGG - Intronic
1039379061 8:37067818-37067840 GCTGCCGGGCACCACCACCAAGG + Intergenic
1041391152 8:57348721-57348743 CATGCCGTGCCCCATCACCAGGG + Intergenic
1045409700 8:101904565-101904587 TCTCCTGGGCTCCTTCCCCAAGG + Intronic
1054818470 9:69498066-69498088 TCAGCCGTGCTCCCTCCCCAGGG - Intronic
1057704641 9:97388198-97388220 TCTCTGGGGCTCCATCTCCAGGG + Intergenic
1058538603 9:105989341-105989363 TGTACCAGGCTCCATCCCCAGGG + Intergenic
1058608695 9:106751843-106751865 TTTGCCTGCCTGCATCACCAAGG - Intergenic
1059742217 9:117163071-117163093 TCTGCCAGGCTCCATCTACACGG + Intronic
1060311601 9:122467332-122467354 TCTGCCCCGCTCCACCACCTTGG + Intergenic
1061152465 9:128836687-128836709 TCTGCAGGGCTCCATAACCCTGG + Intronic
1061322792 9:129841842-129841864 TGTGTCTGACTCCATCACCATGG + Intronic
1061433207 9:130544297-130544319 TCTGCCAGGCCCCCTCCCCAAGG - Intergenic
1187613831 X:20971926-20971948 TCTGCTGGGCTCCTTATCCAAGG + Intergenic
1195710348 X:107768240-107768262 TCTGCAGGGTTCCATCACCCGGG + Intronic
1201641187 Y:16178638-16178660 TCTTCCAGGCTCCATTGCCAGGG - Intergenic
1201661628 Y:16406688-16406710 TCTTCCAGGCTCCATTGCCAGGG + Intergenic