ID: 1160843980

View in Genome Browser
Species Human (GRCh38)
Location 19:1158666-1158688
Sequence ACTGTGCGGTGGCCTCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843980_1160843993 19 Left 1160843980 19:1158666-1158688 CCCGGCAGAGGCCACCGCACAGT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1160843993 19:1158708-1158730 TCAGCCGAGGTTCTCCGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 69
1160843980_1160843991 15 Left 1160843980 19:1158666-1158688 CCCGGCAGAGGCCACCGCACAGT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1160843980_1160843988 6 Left 1160843980 19:1158666-1158688 CCCGGCAGAGGCCACCGCACAGT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1160843988 19:1158695-1158717 AGGCCGCATTACCTCAGCCGAGG 0: 1
1: 0
2: 1
3: 4
4: 36
1160843980_1160843990 14 Left 1160843980 19:1158666-1158688 CCCGGCAGAGGCCACCGCACAGT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843980_1160843995 26 Left 1160843980 19:1158666-1158688 CCCGGCAGAGGCCACCGCACAGT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1160843995 19:1158715-1158737 AGGTTCTCCGGGCAGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843980 Original CRISPR ACTGTGCGGTGGCCTCTGCC GGG (reversed) Intronic
900604154 1:3516408-3516430 AATGTGCTGTTGCCTGTGCCCGG + Intronic
900764272 1:4493625-4493647 CCTCTGCAGTGCCCTCTGCCTGG + Intergenic
900803192 1:4750498-4750520 ACAGAGCAGTGCCCTCTGCCAGG + Intronic
900803210 1:4750588-4750610 ACAGAGCAGTGCCCTCTGCCAGG + Intronic
900954514 1:5878217-5878239 ACTGTGTGGAGGCTTCTGCAGGG - Intronic
901659587 1:10790057-10790079 CCTGGGCGGTGGCATCTGCGTGG - Intronic
901988899 1:13096603-13096625 ACTGTGCCGTCGCCACTGGCTGG + Intergenic
901992914 1:13130164-13130186 ACTGTGCCGTCGCCACTGGCTGG - Intergenic
902404331 1:16174648-16174670 CCTGTCCTGTGGCCTCTTCCTGG - Intergenic
902608457 1:17582585-17582607 TCTTTGCTGTGGCCTCTGCCTGG + Intronic
902977721 1:20100993-20101015 CCTGGGTGGTGCCCTCTGCCTGG + Intergenic
903425405 1:23250494-23250516 ACTGTGCTATGTCCACTGCCTGG + Intergenic
904475832 1:30764104-30764126 GCTGTGCTGTGGTCTCTGGCTGG - Intergenic
905282407 1:36857541-36857563 ACTGTGAGGTGGAGTTTGCCGGG + Intronic
907641294 1:56193221-56193243 CCGGTGCGGTGGCTTATGCCTGG + Intergenic
911126124 1:94342591-94342613 CCTGTGAGGTTGCCTCTGACTGG + Intergenic
912302242 1:108530086-108530108 CCTTTGCTGTTGCCTCTGCCTGG + Intergenic
912775321 1:112503022-112503044 TTTGTGCTGGGGCCTCTGCCAGG - Intronic
915034743 1:152912182-152912204 AGTGTAGGGTGGGCTCTGCCAGG - Intergenic
915598595 1:156908769-156908791 CCTGCACGGTGGCGTCTGCCAGG + Exonic
916043565 1:160981711-160981733 ACCTTGCGCTGGCCTCTCCCAGG + Intergenic
920319905 1:205111960-205111982 CCTGTGCAGTGCCCTCTGCTTGG + Intronic
922422735 1:225470558-225470580 TCTGTGCGGTGGCCTGCCCCCGG - Intergenic
923020030 1:230155975-230155997 CCTGTGTGGTGGGCTCTGTCTGG + Intronic
924359311 1:243219822-243219844 ACTGTGCAGAGCCCTCTGCTAGG + Intronic
924542143 1:244991247-244991269 AGGGTGCGGTGAGCTCTGCCAGG + Intronic
1063194616 10:3729756-3729778 ATGCTGCGGTGGCCACTGCCTGG - Intergenic
1064301119 10:14123720-14123742 ACAGTTCTGTGGCCTCTCCCAGG - Intronic
1065127493 10:22587657-22587679 ACTGGGTGGTGGGCTCAGCCTGG - Intronic
1065288634 10:24208895-24208917 ACTGGGGGCTGGGCTCTGCCAGG - Intronic
1065488029 10:26253840-26253862 AATGTGCTGTGGCGTCTGCCTGG - Intronic
1065963859 10:30754992-30755014 CCTCTGCGGTGGCCTGTGCTGGG + Intergenic
1066247276 10:33595633-33595655 CAGGTGCGGTGGCGTCTGCCTGG + Intergenic
1069574647 10:69517761-69517783 TCTGTGAGGAGGGCTCTGCCAGG + Intergenic
1075975032 10:126687325-126687347 ACAGTAAGGTGGCCTCAGCCAGG - Intergenic
1076116642 10:127906109-127906131 ACGTGGGGGTGGCCTCTGCCAGG + Intergenic
1076405391 10:130208914-130208936 ACTCTGCAGTTGCCTCGGCCTGG - Intergenic
1076681520 10:132174219-132174241 CCTGTGCAGTGGCCCCTTCCTGG + Intronic
1076787105 10:132755992-132756014 AGTGTGGAGTCGCCTCTGCCTGG + Intronic
1076794863 10:132793547-132793569 ACTGTGTGCTGGCCACTGCAGGG - Intergenic
1077210792 11:1370158-1370180 AGTGTGTGGGGGACTCTGCCAGG + Intergenic
1077482230 11:2821145-2821167 AGTGTTCGGTGGCCCCTGGCTGG + Intronic
1082000102 11:47389518-47389540 GCTGAGCGGTGTCCTCTGGCTGG - Intergenic
1084276438 11:68053472-68053494 GCTGCAAGGTGGCCTCTGCCTGG - Exonic
1084419005 11:69050921-69050943 CCTATGCTGTGGCCTCAGCCAGG + Intronic
1084419029 11:69051056-69051078 TCTGTGCTGAGGCCTGTGCCAGG + Intronic
1084542901 11:69798399-69798421 ACTGCCCGGTCCCCTCTGCCAGG + Intergenic
1084678573 11:70651478-70651500 ACAGAGCAGTGGCCTCTGTCTGG + Intronic
1089342267 11:117766151-117766173 TCTGTGCGGAGGCCTGTGCTGGG - Intronic
1091268607 11:134289962-134289984 CCTGTGCGGAGACCTCTGGCTGG + Intronic
1094849084 12:34374299-34374321 CTTGTGCGGGGACCTCTGCCTGG + Intergenic
1096574041 12:52541540-52541562 ACCCTGCGATGGCCTCTTCCTGG + Intergenic
1099554367 12:84092072-84092094 ACTGTGTGGTGGCCAGTGGCTGG + Intergenic
1103296868 12:119895104-119895126 AATGTGCTGTTCCCTCTGCCTGG - Intergenic
1103479959 12:121244536-121244558 CCTGTGCCGTAGCCTCTGCTGGG - Intronic
1104049043 12:125184366-125184388 ACTGTGTGCCGGCCTCTGCAGGG - Intergenic
1105281496 13:18965203-18965225 ATTGTGGGGGCGCCTCTGCCTGG - Intergenic
1105290694 13:19051176-19051198 ACTGTGGGGGCGCCTCCGCCTGG - Intergenic
1107674371 13:42779272-42779294 TCTGTGAGGTTGTCTCTGCCAGG - Intergenic
1108648848 13:52455828-52455850 ACTGTGCGGTCGCTGCTGGCTGG + Intronic
1113945568 13:114042269-114042291 AGTGTGCGGAGGCCACTGGCAGG - Intronic
1115658459 14:35466570-35466592 ACTTTGCTGTGGCCCCTACCTGG - Intergenic
1118373332 14:65156438-65156460 ACTGTCTGGTGGCCTATGCTAGG + Intergenic
1118458761 14:65968961-65968983 GCTATGCAGTGCCCTCTGCCTGG + Intronic
1119562761 14:75604127-75604149 AGTGTGCGTTGGACTGTGCCAGG + Intronic
1119668020 14:76498715-76498737 ACGGTGCGGAGGCCTGGGCCAGG + Intronic
1121727104 14:96160765-96160787 ACTGTTCCGTGGGCTCTTCCAGG - Intergenic
1122228245 14:100291995-100292017 ACGGTGCAATGGCCTCAGCCAGG + Exonic
1122269987 14:100564716-100564738 ACTGTGCGCCAGCCTCTGCCAGG + Intronic
1124086730 15:26558348-26558370 AATGTTCGTGGGCCTCTGCCAGG + Intronic
1124256222 15:28145061-28145083 ACTGGGTGGTGGCTTCTGCCAGG - Intronic
1124517206 15:30376727-30376749 AAGGTGAGGTGGCCACTGCCCGG + Intronic
1124568027 15:30834081-30834103 ACTGGGCGATGGCTTCTGCCAGG + Intergenic
1124725738 15:32154267-32154289 AAGGTGAGGTGGCCACTGCCCGG - Intronic
1124816514 15:32999591-32999613 ACTGAGCGATGGCCTCTGGCAGG - Intronic
1128501387 15:68229647-68229669 AATTTGCGGCGGCCTCCGCCGGG - Exonic
1128765415 15:70248235-70248257 ACTGCGGGGTGGCCTCTGGTGGG + Intergenic
1128944997 15:71813884-71813906 CCTGTGGGGTGGGCTCTGCCAGG - Intronic
1129666222 15:77580919-77580941 ACTGTTCTCTGTCCTCTGCCAGG + Intergenic
1131447291 15:92511079-92511101 CCTGTGCAGTGGTCTCTGCTAGG - Intergenic
1132730038 16:1356647-1356669 GCTGGGAGGAGGCCTCTGCCTGG - Intronic
1132915400 16:2341039-2341061 AGGGCGCGGTGGCCTCTGACAGG + Intergenic
1132975874 16:2710984-2711006 AATGTGCGCGGGCCTGTGCCAGG + Intergenic
1133779356 16:8925627-8925649 GATGCGCGGTGGCCTCTGCGGGG - Intronic
1133780673 16:8936623-8936645 GCTCTGCAGTGGCCTCTGCTGGG + Intronic
1135557071 16:23446135-23446157 GCAGTGAGGTGGCCCCTGCCGGG + Intronic
1136111041 16:28063712-28063734 CCTGCGCCGTGGCCGCTGCCAGG - Intergenic
1136630818 16:31488357-31488379 ACGGCGCGGTGGCCTCTCTCTGG + Intronic
1138415762 16:56870522-56870544 CCTGTGCGGTGCACTCTGCTAGG - Intronic
1138450668 16:57092195-57092217 ACAGAGGGGTGGCCTCAGCCCGG - Intergenic
1141342526 16:83216107-83216129 TCTGTGCTGTTCCCTCTGCCTGG + Intronic
1141935564 16:87235955-87235977 TCTGTGCTCTGTCCTCTGCCTGG - Intronic
1142057111 16:88004922-88004944 GCTGTGCAGTGGCCTCTGGCTGG + Intronic
1142220263 16:88850804-88850826 GCAGTGCGGCCGCCTCTGCCTGG + Intronic
1142279457 16:89140174-89140196 GCTGGGCGGTGGCCTGTGCCTGG + Intronic
1142614220 17:1125503-1125525 GCTGTGCGGGGGCCTGGGCCTGG + Intronic
1142903600 17:3027975-3027997 CCTGTGCGGTGGGCACTGCTGGG + Intronic
1143578683 17:7810725-7810747 ACTGTGCCCTGGGCCCTGCCAGG + Intronic
1143833266 17:9669772-9669794 CCTGTGCTGTGTCCTCTGCCTGG - Intronic
1143860358 17:9886068-9886090 CCTGTGCTCTTGCCTCTGCCTGG - Intronic
1144944720 17:18964017-18964039 CATTTGCTGTGGCCTCTGCCTGG + Intronic
1146822154 17:35992225-35992247 TTTGTGTGGTGCCCTCTGCCAGG - Intronic
1146958119 17:36948981-36949003 GCTGTGGGGTGGCCTCCGCGCGG + Exonic
1147588053 17:41664249-41664271 CCTGTGTGAGGGCCTCTGCCAGG - Intergenic
1148926432 17:51090069-51090091 CATGTGCTGTGACCTCTGCCTGG - Intronic
1149284471 17:55147054-55147076 ACTGTGAAGTGGCATCTGCTAGG - Intronic
1149540738 17:57466202-57466224 ACTGTGGGGAGGCTTCTGACTGG + Intronic
1149627409 17:58089667-58089689 ACTGTGCAGCTGCCTCTTCCTGG + Exonic
1152568161 17:81109496-81109518 CCGGTGCGATGGCCTCTGTCCGG + Intronic
1152844853 17:82593471-82593493 GCTGTGCGGGTGCCTGTGCCAGG + Intronic
1153486903 18:5608019-5608041 ACTGCTCAGTGGCCTCTGGCAGG + Intronic
1154175842 18:12086978-12087000 ACTCTGCCGTGGCTTTTGCCCGG + Intergenic
1155301216 18:24431273-24431295 CCTGTGCTGTGGCCTCTCACTGG - Intronic
1157403098 18:47402652-47402674 ACAGTGCGGTGGCCCCGGCTGGG - Intergenic
1157403108 18:47402694-47402716 ACAGTGCGGTGGCCCCGGCTGGG - Intergenic
1157552728 18:48592714-48592736 ACTGTGTGCAGGCCTCTGCCTGG + Intronic
1160456452 18:79005770-79005792 GCTGTGCTGTGGCCTGCGCCGGG + Intergenic
1160843980 19:1158666-1158688 ACTGTGCGGTGGCCTCTGCCGGG - Intronic
1161218014 19:3104425-3104447 ACTGTGGGGCGGCCTGTGGCAGG + Intronic
1161410498 19:4114392-4114414 ACTGTGAGGTGGCCTTGGGCAGG + Intronic
1161899984 19:7111186-7111208 CCTGTGCTGAGGCCTCTGCTGGG - Intergenic
1162432843 19:10639505-10639527 ACTGTACTGTTCCCTCTGCCTGG - Intronic
1162773609 19:12965485-12965507 ACTGTGCGGCGGCCGCGCCCAGG - Intronic
1163128521 19:15257601-15257623 CGTGTGCTGTGTCCTCTGCCTGG - Intronic
1163193507 19:15697132-15697154 ACGGTGCTGTCACCTCTGCCTGG + Exonic
1163573987 19:18099728-18099750 CACGTGCTGTGGCCTCTGCCCGG - Intronic
1164943403 19:32269144-32269166 ACTGTGCCCTGCCCTCAGCCCGG + Intergenic
1166041090 19:40203467-40203489 ACTGTGCTGTGGTCCCTGCAAGG - Intronic
1167037101 19:47001036-47001058 ACAGTGCCCTGGCCTTTGCCGGG + Exonic
1168414551 19:56160120-56160142 CCTGCGCGCTGGCCGCTGCCCGG - Exonic
925542333 2:4979327-4979349 CCCCTGCAGTGGCCTCTGCCAGG - Intergenic
926010441 2:9402043-9402065 ACTGTGTGGTGGGCTCAGCCTGG - Intronic
926727860 2:16012676-16012698 TCAGTGAGGTGGCCTCTGCCAGG - Intergenic
926978240 2:18536276-18536298 ACTGTACTGTGGCCTCAGGCTGG - Intergenic
930053426 2:47234481-47234503 ACTGAGAGGTGGCATCTGCAGGG + Intergenic
930085624 2:47495131-47495153 AGTGTGAGGTGGCCATTGCCAGG + Intronic
932244061 2:70181538-70181560 TCAGAGGGGTGGCCTCTGCCTGG + Exonic
936040279 2:109144739-109144761 AGTGTGAGGTGGCCCCTGCCAGG - Intronic
938928229 2:136063700-136063722 AATGTGCTGTTCCCTCTGCCAGG + Intergenic
939683405 2:145167746-145167768 ACTGGGCAGTGGACACTGCCAGG - Intergenic
942630102 2:177945483-177945505 GATGTGAGGAGGCCTCTGCCCGG + Intronic
946026608 2:216675474-216675496 ACGGAGGGCTGGCCTCTGCCTGG + Exonic
946115062 2:217454001-217454023 ACTTTGATGTGGCCACTGCCAGG + Intronic
948568469 2:238901500-238901522 CCTGTGCGGAGGCCTCTGCTAGG + Intronic
1168964923 20:1893667-1893689 ACAGTGCGGAGCCTTCTGCCAGG + Intergenic
1170898507 20:20437603-20437625 TGTGTGCTGTGCCCTCTGCCTGG + Intronic
1170941152 20:20848981-20849003 ACCCTGCTGGGGCCTCTGCCTGG + Intergenic
1171303141 20:24081246-24081268 ACTGTGCTGTTTCCTCTGACGGG + Intergenic
1173920206 20:46738783-46738805 GCTGTGCCGTGCCATCTGCCTGG - Intergenic
1174396420 20:50249860-50249882 CCTGGGCTGTGCCCTCTGCCTGG + Intergenic
1174569657 20:51492594-51492616 ACTGTGCGGGGCCCTCTGCGCGG + Intronic
1176048626 20:63105154-63105176 ACTGGGAGGTGGCCTCTGCGTGG - Intergenic
1176051961 20:63124662-63124684 GCTGTGCAGTGGCCTGAGCCGGG - Intergenic
1176145891 20:63565315-63565337 ACTGTGGGATGGCCTTCGCCGGG - Exonic
1176219309 20:63962538-63962560 ACAGCGCCGTGGCCTCTGCGTGG - Intronic
1176247713 20:64105300-64105322 GCTGTGTGGGGGCCTCTGCCAGG + Intergenic
1179504540 21:41831764-41831786 AGTGGGAGGTGGCCTCTGCCAGG + Intronic
1179884796 21:44309318-44309340 GCTATGCTGTGGGCTCTGCCTGG - Intronic
1183173589 22:36205571-36205593 ACGGGGCAGTGGCCTCTGCTTGG - Intergenic
1183179773 22:36252261-36252283 ACGGGGCAGTGGCCTCTGCTGGG + Intergenic
1183733052 22:39629038-39629060 ACTGAGGGGCTGCCTCTGCCTGG + Intronic
1184206131 22:43004780-43004802 CCTGTGACGGGGCCTCTGCCTGG - Intronic
954249077 3:49354459-49354481 CCTGTGCCGTGTGCTCTGCCAGG - Intergenic
956297277 3:67728313-67728335 ACTGTGCTGTGTCCACTCCCTGG - Intergenic
956402415 3:68894771-68894793 TCTGTGCTGTTGCCTCTTCCAGG - Intronic
961654931 3:128435935-128435957 TCAGTGGGGTGCCCTCTGCCTGG + Intergenic
962192740 3:133328510-133328532 ACTGTATGGTGGCCCCAGCCTGG + Intronic
964194276 3:154044889-154044911 TCAGTGTGGTGGCCACTGCCAGG + Intergenic
964317197 3:155457213-155457235 TCTATGCTGTGGCCTCTGCTGGG + Intronic
964636732 3:158865976-158865998 ACAGGTTGGTGGCCTCTGCCAGG + Intergenic
967121079 3:186383479-186383501 GCTGTGCGGAAGCCACTGCCCGG + Intergenic
967771905 3:193343420-193343442 ACTGTGCGATCGTCTTTGCCCGG + Intronic
967864311 3:194177810-194177832 CCTGGGCTGTGGCCTCTGCAAGG + Intergenic
967876988 3:194274133-194274155 CCAGTGCTGTGCCCTCTGCCTGG + Intergenic
968048030 3:195635078-195635100 ACTGTGCTTCCGCCTCTGCCGGG - Intergenic
968306581 3:197654843-197654865 ACTGTGCTTCCGCCTCTGCCGGG + Intergenic
968761301 4:2443833-2443855 ACTGTGCTGACCCCTCTGCCTGG - Intronic
969302153 4:6303471-6303493 ACTGTGGGGTGGCCTGGGCATGG + Intergenic
973710084 4:53621268-53621290 CCTGTGCAGTGCCCTCTGCCTGG + Intronic
978411473 4:108430688-108430710 TCTGGGCTGTGGCTTCTGCCTGG + Intergenic
978800871 4:112754240-112754262 ACTGTGGCATGTCCTCTGCCTGG + Intergenic
978981103 4:114946561-114946583 TCTGTGCTGTCTCCTCTGCCTGG - Intronic
980878125 4:138682804-138682826 ACTGTGCTGGCACCTCTGCCTGG - Intergenic
983918354 4:173316254-173316276 CCTGTGCTGTTCCCTCTGCCAGG + Intronic
984396772 4:179211660-179211682 GCTGAGCGGGGTCCTCTGCCTGG + Intergenic
985654650 5:1123594-1123616 TCTGTGCGGCGGTCTCTGGCCGG - Intergenic
986032891 5:3910116-3910138 CATGTGCGATGGCCTCTCCCGGG - Intergenic
992639397 5:78755958-78755980 GCTGTGGGTTGGGCTCTGCCAGG + Intronic
999331664 5:150677682-150677704 ACTGTGCGCTAGACACTGCCAGG + Exonic
1002157440 5:177294300-177294322 CCTGTCCAGTGGCCTCTGGCTGG - Exonic
1002429875 5:179197107-179197129 TCTGTCTGGTGGCCTCTGGCAGG + Intronic
1002570949 5:180139073-180139095 GATGTGCTCTGGCCTCTGCCTGG - Intronic
1002971862 6:2031241-2031263 CCTGTGTGGAGGCCTCAGCCTGG - Intronic
1003133543 6:3415938-3415960 ACGGTGCGGTGGTCCCTGCAGGG - Intronic
1003479721 6:6519857-6519879 CATGTGCTGTTGCCTCTGCCTGG - Intergenic
1005517851 6:26571598-26571620 TCTGAGTGTTGGCCTCTGCCAGG - Intergenic
1006360637 6:33585276-33585298 ACTGCGTGTTGGCCTCTTCCAGG + Intergenic
1006364513 6:33607497-33607519 TCTGTGAGGGGTCCTCTGCCGGG + Intergenic
1007105451 6:39280425-39280447 ACTGTGCATTGGCCCCTGCATGG + Intergenic
1007175815 6:39896724-39896746 ACTTTGCGGTGGCATCTTCCTGG + Intronic
1007231728 6:40352885-40352907 ACTTTGCTGTTTCCTCTGCCCGG + Intergenic
1008973855 6:57401759-57401781 CCTGTGCTGTGGCCCCAGCCAGG + Intronic
1009162745 6:60303264-60303286 CCTGTGCTGTGGCCCCAGCCAGG + Intergenic
1013474987 6:110498852-110498874 AATGTATTGTGGCCTCTGCCTGG - Intergenic
1013663767 6:112325944-112325966 ACAGTGCAGAGGCCTCTGCTGGG - Intergenic
1014736791 6:125103174-125103196 ACTGTGCTGTGGCCTGTCCTAGG - Intergenic
1018837865 6:167498648-167498670 ACTGGGCTGTGGCTTCTCCCTGG - Intergenic
1018876842 6:167827845-167827867 CCTCTGCGGCGGCCTCTGCCCGG + Intronic
1019565291 7:1675981-1676003 GCTGTGCTGTGGCTCCTGCCTGG + Intergenic
1022585235 7:31602718-31602740 CCTGCCCGGTGGCCTCAGCCTGG + Intronic
1023348191 7:39293134-39293156 GCTGTGCGCCTGCCTCTGCCCGG + Intronic
1026800244 7:73395880-73395902 CCAGGGCAGTGGCCTCTGCCTGG - Intergenic
1026980727 7:74525161-74525183 CCTGTGCTGTGCCCTCTGTCTGG + Intronic
1030906913 7:115197172-115197194 TCTGTGAGGTGGGCTCAGCCAGG - Intergenic
1032167126 7:129554268-129554290 GCTGAGCTGTGGCCACTGCCTGG + Intergenic
1032391084 7:131556005-131556027 AGTGGGCGGTGGATTCTGCCCGG - Intronic
1034880582 7:154759496-154759518 ACCGCACAGTGGCCTCTGCCTGG - Intronic
1035207054 7:157300577-157300599 GCTGTGCTGAGGCCTCTCCCAGG - Intergenic
1035466813 7:159084694-159084716 CCTGTTGGGGGGCCTCTGCCTGG + Intronic
1035666473 8:1384281-1384303 CCTCTGCCGTGGCCTATGCCCGG + Intergenic
1038066448 8:23968413-23968435 AATGTCTTGTGGCCTCTGCCTGG + Intergenic
1042370865 8:67989003-67989025 ACTGTTTTGTGACCTCTGCCTGG + Intronic
1042591850 8:70403968-70403990 ACTTGGCGGCGGCCACTGCCGGG - Intergenic
1047955628 8:129973316-129973338 CCTGTGCGGAGAGCTCTGCCTGG - Intronic
1048326870 8:133446726-133446748 ATGGTGAGCTGGCCTCTGCCTGG + Intergenic
1048407812 8:134140881-134140903 ACTGTGTGGTTGGCTCTGCCTGG - Intergenic
1049619655 8:143592318-143592340 CCTGAGCGGCGGCTTCTGCCCGG - Intronic
1049681540 8:143920756-143920778 ACTGTGCGGCGGGCTCTCCGGGG - Exonic
1049777321 8:144412785-144412807 ACAGGCCGGTGGCCACTGCCAGG + Exonic
1051535445 9:18152336-18152358 ACTTTGCAGTGCCCTGTGCCTGG - Intergenic
1052968671 9:34363034-34363056 CCTGTGGGGTGGACTCTGGCTGG + Intergenic
1053188154 9:36036754-36036776 ACTGTGTGTCGGCTTCTGCCAGG - Exonic
1057039449 9:91836821-91836843 CCTGGGCAGTGGCCTCAGCCAGG + Intronic
1057271330 9:93653328-93653350 ACTCTGGGGGCGCCTCTGCCTGG + Exonic
1057517245 9:95732241-95732263 CATGTGCTGTGCCCTCTGCCAGG - Intergenic
1059654853 9:116348254-116348276 ACTGTGCTGAGGCTTCTGCTTGG + Intronic
1059727454 9:117023354-117023376 ACTGTGTTGTTTCCTCTGCCTGG + Intronic
1060176832 9:121503390-121503412 AAGGTGAGGTGGCCTCTGGCAGG + Intergenic
1060806121 9:126578370-126578392 ACTGTCCTGTGGCCTCTGCATGG - Intergenic
1060989309 9:127839060-127839082 GCTGTGCACTGGCTTCTGCCTGG + Intronic
1061591180 9:131598598-131598620 ACTGTGCGGTGGGCCTTGGCAGG - Intronic
1062121160 9:134834810-134834832 CATGTGCGCTGGCCTCGGCCGGG + Intronic
1062282915 9:135759947-135759969 ACAGTGCGGGGGCCACTCCCAGG + Intronic
1062482771 9:136760062-136760084 AGTGAGCCATGGCCTCTGCCTGG + Intronic
1062518006 9:136945699-136945721 GCAGTGTGGTGGCCTCGGCCCGG - Exonic
1062697348 9:137882227-137882249 AGGCTGCTGTGGCCTCTGCCTGG + Intronic
1189653113 X:43211278-43211300 ACTGTCTGCTGGCCTCTCCCAGG + Intergenic
1192156087 X:68747709-68747731 TCTCTGTGCTGGCCTCTGCCAGG - Intergenic
1196040066 X:111193190-111193212 ACTGTGCGGTGTTCTCTGGAGGG + Intronic
1198519013 X:137433775-137433797 AAGCTGCGGTGGGCTCTGCCTGG - Intergenic