ID: 1160843981

View in Genome Browser
Species Human (GRCh38)
Location 19:1158667-1158689
Sequence GACTGTGCGGTGGCCTCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843981_1160843993 18 Left 1160843981 19:1158667-1158689 CCGGCAGAGGCCACCGCACAGTC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1160843993 19:1158708-1158730 TCAGCCGAGGTTCTCCGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 69
1160843981_1160843988 5 Left 1160843981 19:1158667-1158689 CCGGCAGAGGCCACCGCACAGTC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1160843988 19:1158695-1158717 AGGCCGCATTACCTCAGCCGAGG 0: 1
1: 0
2: 1
3: 4
4: 36
1160843981_1160843991 14 Left 1160843981 19:1158667-1158689 CCGGCAGAGGCCACCGCACAGTC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1160843981_1160843990 13 Left 1160843981 19:1158667-1158689 CCGGCAGAGGCCACCGCACAGTC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843981_1160843995 25 Left 1160843981 19:1158667-1158689 CCGGCAGAGGCCACCGCACAGTC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1160843995 19:1158715-1158737 AGGTTCTCCGGGCAGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843981 Original CRISPR GACTGTGCGGTGGCCTCTGC CGG (reversed) Intronic
900033935 1:391553-391575 GACTGTGAGCTGGTCTCTGTAGG + Intergenic
900054770 1:621443-621465 GACTGTGAGCTGGTCTCTGTAGG + Intergenic
900329872 1:2128745-2128767 CACTGTGCGCTGTCCACTGCAGG + Intronic
900682019 1:3921954-3921976 GGCTTTGCTGAGGCCTCTGCGGG + Intergenic
900954515 1:5878218-5878240 CACTGTGTGGAGGCTTCTGCAGG - Intronic
903009703 1:20320893-20320915 GTCTGGGCTGTGGCCTCTGGTGG + Intronic
905786203 1:40759759-40759781 GCCTGTGCTGTGCCCTCTACTGG - Intronic
906251304 1:44312869-44312891 GACTCTGGGGTAGCCTATGCTGG - Intronic
906647809 1:47488558-47488580 GCCTCTGCGGTTGCCTCAGCTGG + Intergenic
910492056 1:87783580-87783602 GTCTATGGGGTGGCCTGTGCTGG + Intergenic
915097469 1:153473590-153473612 CACTGTGAGCTGGCCTCTGTTGG - Intergenic
923525641 1:234770444-234770466 AGCTGTGCGGTGGCTTCCGCTGG + Intergenic
924337494 1:242998576-242998598 GACTGTGAGCTGGTCTCTGTAGG + Intergenic
1065025494 10:21535464-21535486 GCCTGTGGGGTGGCCGCGGCAGG + Intronic
1065963857 10:30754991-30755013 TCCTCTGCGGTGGCCTGTGCTGG + Intergenic
1067698983 10:48555351-48555373 GACTGTGCTGTGGCTCCTGCGGG + Intronic
1071225899 10:83527185-83527207 GGCTGTCAGGTGGCCTGTGCAGG - Intergenic
1072690467 10:97569540-97569562 GACTGTGGGGTGGCCATGGCAGG + Intronic
1075463366 10:122633137-122633159 GACTGTGCAGTGTGCTCTGGGGG + Intronic
1075785629 10:125048247-125048269 GGGTGTGCAGTGCCCTCTGCTGG - Intronic
1075978759 10:126719449-126719471 GAGTGAATGGTGGCCTCTGCAGG - Intergenic
1076070624 10:127485398-127485420 CACTGAGTAGTGGCCTCTGCAGG + Intergenic
1076643966 10:131938712-131938734 CACTGTGCGGTTGTCTGTGCTGG + Intronic
1076670047 10:132115395-132115417 GGCTGTGCGGAGGCCTCCTCTGG - Intronic
1076774382 10:132686231-132686253 GGCTGTGCCGTGGCCTCCGGGGG + Intronic
1076794864 10:132793548-132793570 AACTGTGTGCTGGCCACTGCAGG - Intergenic
1076827422 10:132976102-132976124 GACCGTGCGGGGGCCTCTCCAGG + Intergenic
1076834839 10:133015873-133015895 GACTCTGCGGCGGAGTCTGCAGG - Intergenic
1081780636 11:45709091-45709113 CACTTTTCAGTGGCCTCTGCTGG - Intergenic
1084559391 11:69894202-69894224 GACAGTGAGATGGCCTCTGCGGG - Intergenic
1087023896 11:93630721-93630743 TACTCTGCGGTGGCCCCTGTAGG - Intergenic
1088170467 11:106990487-106990509 GACTGTGTGGGAGCCTCAGCGGG - Intronic
1088429691 11:109745317-109745339 GTCTAGGCTGTGGCCTCTGCTGG + Intergenic
1088551978 11:111022366-111022388 GACTGAGCGTTGGCCTCTCATGG + Intergenic
1089342268 11:117766152-117766174 TTCTGTGCGGAGGCCTGTGCTGG - Intronic
1089350289 11:117818192-117818214 GTTTGGGGGGTGGCCTCTGCAGG - Intronic
1090780282 11:130001925-130001947 GGGTGTGGGGTGGCCCCTGCGGG - Intronic
1091845820 12:3655711-3655733 GGCTGGGTGGTGCCCTCTGCAGG - Intronic
1096092786 12:48914490-48914512 GACTGAGCCGGTGCCTCTGCAGG - Exonic
1096495842 12:52038803-52038825 TCCTGTGCTGAGGCCTCTGCTGG + Intronic
1100467653 12:94861519-94861541 GCCTGTGCAGAGGGCTCTGCTGG - Intergenic
1101324821 12:103706372-103706394 GAAGGTGAGGAGGCCTCTGCAGG - Intronic
1102221416 12:111197418-111197440 GACTTTGCGGTGGCCACTGTTGG + Intronic
1103479961 12:121244537-121244559 GCCTGTGCCGTAGCCTCTGCTGG - Intronic
1103971600 12:124675991-124676013 AACTGAGCAGTGGCCTCTGAAGG + Intergenic
1104049044 12:125184367-125184389 TACTGTGTGCCGGCCTCTGCAGG - Intergenic
1104716406 12:131019148-131019170 GACTCAGCAGTGGCCTCTGGTGG + Intronic
1104736335 12:131137907-131137929 GGGTGTGGAGTGGCCTCTGCTGG - Intronic
1104899850 12:132182966-132182988 GCCTGTGCGGTAGCCCCTGGTGG + Intergenic
1105040063 12:132954965-132954987 GAGTATGGGGTGGCCTATGCTGG - Intronic
1107565627 13:41601065-41601087 GTCTGTGCTGTGCCCTCTTCTGG + Intronic
1113740281 13:112707863-112707885 CACTGTCTGGTGGCCTGTGCCGG + Intronic
1113949594 13:114064643-114064665 TCCTGTTCGGTGGCCTGTGCCGG + Intronic
1119259121 14:73226974-73226996 GACTGTGCTTGGGCCTGTGCAGG - Intergenic
1119587652 14:75851650-75851672 GGCTGCACGGTGGCCCCTGCTGG - Intronic
1121006842 14:90496129-90496151 GTCTGTGTGGAGGCCTCAGCTGG - Intergenic
1121614119 14:95301466-95301488 GAGTGTGGGGTGGCCACTCCTGG - Intronic
1122126554 14:99581562-99581584 GATTGTGCGGTGGCCGAGGCAGG - Intronic
1122173349 14:99896121-99896143 GACTGAAAGGTGGTCTCTGCAGG - Intronic
1122925145 14:104896008-104896030 GCCTCTGCCGTGGCCCCTGCTGG + Exonic
1123017842 14:105384071-105384093 GACCGTGCAGAGGCCTCGGCTGG - Intronic
1123117326 14:105900591-105900613 AACTGTCCAGTGGCCACTGCCGG - Intergenic
1124871932 15:33552242-33552264 CACTGTGCTGTGGTCTCTGGGGG + Intronic
1128377889 15:67090186-67090208 GACTGAGAGGTGGACTCTGAAGG + Intronic
1128501388 15:68229648-68229670 GAATTTGCGGCGGCCTCCGCCGG - Exonic
1128765414 15:70248234-70248256 CACTGCGGGGTGGCCTCTGGTGG + Intergenic
1129676269 15:77633666-77633688 GGCTCTGCGCTGCCCTCTGCTGG - Intronic
1130992119 15:88881777-88881799 GGGTGTGCGGTGGCCCTTGCAGG - Intronic
1132543079 16:520415-520437 TACTGGGCTGTGGCCCCTGCTGG - Intronic
1132565669 16:621468-621490 GAGTGGCCGGTGGCCTTTGCTGG - Intronic
1132829394 16:1919986-1920008 GACTGTGGGGTGGATGCTGCAGG - Intergenic
1132860009 16:2065755-2065777 GAGGGTGCGGTGGTCTCAGCAGG + Intronic
1132870251 16:2112603-2112625 GGCTGTGCTGAGGCCTCTCCCGG + Intronic
1133779357 16:8925628-8925650 GGATGCGCGGTGGCCTCTGCGGG - Intronic
1133780672 16:8936622-8936644 GGCTCTGCAGTGGCCTCTGCTGG + Intronic
1134522288 16:14924332-14924354 GGCTGTGCTGAGGCCTCTCCCGG - Intronic
1134709958 16:16322983-16323005 GGCTGTGCTGAGGCCTCTCCCGG - Intergenic
1134717173 16:16362983-16363005 GGCTGTGCTGAGGCCTCTCCCGG - Intergenic
1134949645 16:18345662-18345684 GGCTGTGCTGAGGCCTCTCCCGG + Intergenic
1134957579 16:18389176-18389198 GGCTGTGCTGAGGCCTCTCCCGG + Intergenic
1135557070 16:23446134-23446156 GGCAGTGAGGTGGCCCCTGCCGG + Intronic
1137789739 16:51165096-51165118 GACAGTGAGGAAGCCTCTGCAGG - Intergenic
1138101613 16:54256493-54256515 TGATGTGCGGTGGCCTCTGTGGG + Intronic
1138268432 16:55677479-55677501 GTCTCTGCTGGGGCCTCTGCTGG - Intronic
1141651615 16:85395937-85395959 GACAGGGCTGTGGGCTCTGCAGG - Intergenic
1141716230 16:85728629-85728651 AGGTGTGCGGGGGCCTCTGCAGG - Intronic
1142027002 16:87819759-87819781 GACTGTGTGCTGGCCTCTTTAGG - Intergenic
1142155316 16:88530271-88530293 GACTGGGAGGTGGTCTCCGCAGG - Intronic
1142903598 17:3027974-3027996 ACCTGTGCGGTGGGCACTGCTGG + Intronic
1143368788 17:6425578-6425600 GACTGTGCGGGTGGCTCTGTGGG + Exonic
1146617043 17:34364999-34365021 GACAGAGAGGTGGGCTCTGCAGG - Intergenic
1147536670 17:41326410-41326432 GCCTGAGCCCTGGCCTCTGCTGG - Intergenic
1148334648 17:46833062-46833084 GGCTGTGTGGTGGACTCTTCAGG - Intronic
1150616143 17:66773732-66773754 GACAGTGCTGTGGCATCTCCAGG + Intronic
1151604993 17:75130421-75130443 GGCTCTGCGGTGGCCCCTGTGGG + Exonic
1151959622 17:77398791-77398813 GATGGTGGGGTGGCCCCTGCGGG + Intronic
1153006025 18:499808-499830 CCCTGCGCGGTGTCCTCTGCAGG - Intronic
1153702717 18:7712180-7712202 TACTGTTCCGTAGCCTCTGCTGG + Intronic
1157362741 18:47034331-47034353 GACTGTGCTGAGGCCTCTTCTGG + Exonic
1157403099 18:47402653-47402675 CACAGTGCGGTGGCCCCGGCTGG - Intergenic
1157403109 18:47402695-47402717 CACAGTGCGGTGGCCCCGGCTGG - Intergenic
1160456451 18:79005769-79005791 GGCTGTGCTGTGGCCTGCGCCGG + Intergenic
1160588185 18:79924370-79924392 GTCTGTGCGCTCGCCTGTGCTGG - Intronic
1160742225 19:691987-692009 GCCAGTGCGGAGGTCTCTGCAGG + Exonic
1160778705 19:868397-868419 GCCTGTGCGGTGGGCTCTGGTGG - Exonic
1160843981 19:1158667-1158689 GACTGTGCGGTGGCCTCTGCCGG - Intronic
1161083927 19:2325275-2325297 GAGGGTGGGCTGGCCTCTGCTGG - Intronic
1161899986 19:7111187-7111209 TCCTGTGCTGAGGCCTCTGCTGG - Intergenic
1163572546 19:18090946-18090968 GCCTCTGCTGTGGCCTCTGCCGG - Intronic
1164678381 19:30118122-30118144 CACTGTTTGGTGGCCTCTGCTGG + Intergenic
1165800052 19:38543788-38543810 GACTGTGCGCCAGGCTCTGCTGG - Exonic
1166384674 19:42374130-42374152 GACTGTGCTGGGGCCTCAGTGGG + Intronic
1167037100 19:47001035-47001057 GACAGTGCCCTGGCCTTTGCCGG + Exonic
1168152797 19:54457999-54458021 GAAGGTGAGCTGGCCTCTGCGGG + Exonic
925081004 2:1066512-1066534 CACTGTCCGGTGGTCTGTGCCGG - Intronic
926055990 2:9774352-9774374 GCCTCTGCAGTGGCTTCTGCGGG - Intergenic
929146194 2:38708925-38708947 GAATCTGTGGTGGCCTCTGCCGG + Intronic
929891128 2:45919303-45919325 GGCTGGGCCGTGGACTCTGCAGG + Intronic
930053425 2:47234480-47234502 AACTGAGAGGTGGCATCTGCAGG + Intergenic
931721783 2:65072171-65072193 GGCAGGGCAGTGGCCTCTGCTGG - Exonic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
935592714 2:104856146-104856168 GACTCTGCGGCGGCGGCTGCTGG - Exonic
937305817 2:120869903-120869925 GACTGTCCAGAGGGCTCTGCAGG + Intronic
937863185 2:126729484-126729506 GGCTCAGCTGTGGCCTCTGCAGG - Intergenic
938059437 2:128240573-128240595 GTCTGTGCTTTGGCCTCTGGTGG - Intronic
938062710 2:128265452-128265474 GGGTGTGCTGTGGTCTCTGCGGG - Intronic
939865980 2:147472905-147472927 GGCTGGGAGGTGGACTCTGCAGG + Intergenic
940912998 2:159225343-159225365 GCCTGCACGGTGGCCGCTGCAGG + Intronic
948634731 2:239327864-239327886 GACTGTCCAGGGGCCTCTGCTGG - Intronic
948776486 2:240291515-240291537 GATTGTGCCGTTGCCTCTCCGGG - Intergenic
948825940 2:240573491-240573513 GGCTGTGCGGGGGCCTTGGCAGG - Intronic
1172538838 20:35695591-35695613 GTCTTTGTGGTGCCCTCTGCAGG - Intronic
1174517344 20:51102755-51102777 GGCTGTGCGGTGCCCTGTTCAGG + Intergenic
1176051962 20:63124663-63124685 GGCTGTGCAGTGGCCTGAGCCGG - Intergenic
1176145892 20:63565316-63565338 GACTGTGGGATGGCCTTCGCCGG - Exonic
1176156850 20:63626525-63626547 CCCTGTGGGGTGGCCCCTGCGGG + Intronic
1176334565 21:5583879-5583901 GACAATGTGGGGGCCTCTGCTGG - Intergenic
1176393192 21:6237069-6237091 GACAATGTGGGGGCCTCTGCTGG + Intergenic
1176468227 21:7079105-7079127 GACAATGTGGGGGCCTCTGCTGG - Intronic
1176491788 21:7460883-7460905 GACAATGTGGGGGCCTCTGCTGG - Intergenic
1176508854 21:7677500-7677522 GACAATGTGGGGGCCTCTGCTGG + Intergenic
1180089261 21:45525409-45525431 GTCAGTGCGCAGGCCTCTGCGGG - Intronic
1180159045 21:45990928-45990950 GAGGCCGCGGTGGCCTCTGCCGG + Intronic
1181085751 22:20438583-20438605 GCCTGGGCGGTGGATTCTGCTGG + Intronic
1181138136 22:20783846-20783868 GACTGTGGGGTCGGCTCTGCAGG + Intronic
1183179772 22:36252260-36252282 CACGGGGCAGTGGCCTCTGCTGG + Intergenic
1183258997 22:36782150-36782172 GCCTGAGCTGTGGCCTCGGCGGG + Intergenic
1183311124 22:37109919-37109941 GACTGTGCAGAGGCCGGTGCAGG + Intergenic
1183472809 22:38018621-38018643 GACTGTGAGGTGGCCCAGGCTGG + Intronic
1183748581 22:39706195-39706217 GACAGTGCAGGGGCCTCCGCAGG - Intergenic
950182785 3:10926966-10926988 TGCTGTGCAGGGGCCTCTGCAGG + Intronic
950305588 3:11913447-11913469 AACTGTGCGGCTTCCTCTGCAGG - Intergenic
953236582 3:41112718-41112740 GACTGTGCAGAGGCCTATACAGG - Intergenic
954881274 3:53837540-53837562 GCGTGGGCGCTGGCCTCTGCGGG + Intronic
955330722 3:58044809-58044831 GACAGTGCTGTCTCCTCTGCAGG - Intronic
960364801 3:116758072-116758094 GGCTGTGCTGTGGCATCTCCTGG - Intronic
960890723 3:122444722-122444744 TGCTGTTCTGTGGCCTCTGCTGG + Intronic
964317196 3:155457212-155457234 TTCTATGCTGTGGCCTCTGCTGG + Intronic
966977325 3:185096594-185096616 GAGGGTGCGGAGGACTCTGCAGG + Intronic
967987791 3:195107875-195107897 CACTGTGCGGAGGCCTGGGCGGG - Intronic
968048031 3:195635079-195635101 GACTGTGCTTCCGCCTCTGCCGG - Intergenic
968306580 3:197654842-197654864 GACTGTGCTTCCGCCTCTGCCGG + Intergenic
968540846 4:1167586-1167608 GACTGTGCGGAGGCCACTGTGGG - Exonic
969441673 4:7220717-7220739 CGCTGTGGGGTGGCCTCTCCAGG + Intronic
969476583 4:7425669-7425691 GACTGAGCTGGGCCCTCTGCAGG - Intronic
973552716 4:52051634-52051656 GACCAGGCGGTGGCCTCCGCAGG - Exonic
978132878 4:105220839-105220861 GACTGTGGGGTGGACTCAGCAGG - Intronic
979239635 4:118436727-118436749 GACTGTGAGCTGGTCTCTGTAGG - Intergenic
985549031 5:524055-524077 GGGTGTGCGGCCGCCTCTGCTGG - Intronic
985553703 5:545944-545966 GACTCTGCCATGGCCTCTGGGGG + Intergenic
986384667 5:7220319-7220341 AACTGTGCTGTTGCCTCTCCCGG + Intergenic
989241830 5:39210666-39210688 GACTTTGCCATGGCCTCTGAGGG + Intronic
990777195 5:59315562-59315584 GACTGTCAGGTGGCCTCTTCAGG + Intronic
992069442 5:73135928-73135950 GACGGTGGGCTGGCTTCTGCTGG + Intergenic
992383750 5:76264756-76264778 TACTGTTCTGTAGCCTCTGCTGG - Intronic
992715451 5:79506805-79506827 GACAGTGCAGTGGCCCATGCTGG - Intronic
997694301 5:135849505-135849527 TAATGTGTGGTGGCCTCTGATGG - Intronic
997964530 5:138346866-138346888 GGCTGTGCGGTGGGGTCGGCAGG + Exonic
998647265 5:144076199-144076221 GACTATTAGGTGGCATCTGCTGG - Intergenic
999624357 5:153504757-153504779 GACTGGGAGGTGGTCTCTCCAGG + Intronic
1002739885 5:181427315-181427337 GACTGTGAGCTGGTCTCTGTAGG - Intergenic
1003133544 6:3415939-3415961 AACGGTGCGGTGGTCCCTGCAGG - Intronic
1006364512 6:33607496-33607518 GTCTGTGAGGGGTCCTCTGCCGG + Intergenic
1007382367 6:41499103-41499125 GACGGGGCTGTGGCCTCAGCTGG - Intergenic
1007729900 6:43939453-43939475 GACTGTCCGGGGCCCTCTGGTGG - Intergenic
1010117290 6:72329095-72329117 GACTGTGCTGTTGCCTCTTGAGG + Intronic
1013663768 6:112325945-112325967 GACAGTGCAGAGGCCTCTGCTGG - Intergenic
1019136480 6:169911766-169911788 GCCTGGGCGGGGGGCTCTGCAGG + Intergenic
1019244999 6:170702901-170702923 GACTGTGAGCTGGTCTCTGTAGG - Intergenic
1019364890 7:628200-628222 GACTCAGCGATGGGCTCTGCGGG + Intronic
1019514880 7:1435197-1435219 GACTGTCCGGAGGCCCCTCCAGG - Intronic
1022110238 7:27225665-27225687 CTCTTGGCGGTGGCCTCTGCGGG - Intergenic
1023862551 7:44225074-44225096 GTCTGTGCTGTGGCCCCTGAAGG + Intronic
1025929620 7:65983155-65983177 GACGGTGCAGTGGCCATTGCTGG + Intergenic
1026463316 7:70633093-70633115 GACTGTCCGGGGGCCTTTTCAGG + Intronic
1026592161 7:71706294-71706316 GACTGCCATGTGGCCTCTGCAGG + Intronic
1027746797 7:82085310-82085332 GACTGTCAGATGGCCCCTGCGGG + Intronic
1029252993 7:99250364-99250386 GCCTGTTAAGTGGCCTCTGCAGG + Intergenic
1034138829 7:148797731-148797753 GACTGTGAGGTTGCCTGTGGTGG + Intronic
1035468001 7:159092177-159092199 GCCTGAGCTGTGGACTCTGCAGG + Intronic
1035503124 8:105286-105308 GACTGTGAGCTGGTCTCTGTAGG + Intergenic
1038311439 8:26449149-26449171 CACCGTGCGGGGGCCGCTGCGGG - Intronic
1041757216 8:61327832-61327854 GACTGTGCAGTGGCCTTCTCTGG + Intronic
1042591851 8:70403969-70403991 GACTTGGCGGCGGCCACTGCCGG - Intergenic
1048309170 8:133305168-133305190 GCCTTTGCTGTTGCCTCTGCAGG + Intergenic
1049681541 8:143920757-143920779 CACTGTGCGGCGGGCTCTCCGGG - Exonic
1049780190 8:144425340-144425362 TCCTGTGCGGTGGCCTGTGACGG + Intronic
1050462524 9:5889036-5889058 CACTGTTTGGTGGTCTCTGCTGG + Intronic
1053168157 9:35859250-35859272 CACTGTGCGGTGGGCTGAGCAGG + Intergenic
1054085543 9:60739537-60739559 GACTTTGCAGTTGCCTCTGATGG + Intergenic
1056115124 9:83434257-83434279 GACTGTGCCGTGGTCTCCACAGG + Intronic
1057298342 9:93862123-93862145 GGCTGTCCTGGGGCCTCTGCAGG + Intergenic
1058034495 9:100236679-100236701 TACTGTTCCGTAGCCTCTGCTGG - Intronic
1059430682 9:114248486-114248508 GCCTGTGCGGTGCCCGCTGTGGG + Intronic
1061138028 9:128747412-128747434 CACTGTGTGGAGGACTCTGCTGG - Intronic
1061826342 9:133260647-133260669 GCCTGTGCTATGGCCTCTGTTGG - Intronic
1062213564 9:135377406-135377428 GAATGCGCAGTGGCCTCTGCGGG - Intergenic
1062421700 9:136485529-136485551 CACTGGGTGGAGGCCTCTGCTGG - Exonic
1203427065 Un_GL000195v1:51039-51061 GACAATGTGGGGGCCTCTGCTGG + Intergenic
1203605192 Un_KI270748v1:52122-52144 GACTGTGAGCTGGTCTCTGTAGG - Intergenic
1187443862 X:19343932-19343954 GACTGAGGCGTGGCGTCTGCTGG + Exonic
1192202492 X:69075546-69075568 GCCTGTGAGCTGGCCTCTGAGGG - Intergenic
1193043825 X:77031783-77031805 GACTGTGCAGAGCCCACTGCAGG - Intergenic
1194872738 X:99153232-99153254 GACTGTTAGGTGGGGTCTGCTGG - Intergenic
1196040065 X:111193189-111193211 CACTGTGCGGTGTTCTCTGGAGG + Intronic
1202387377 Y:24338523-24338545 GACTGTGAGCTGGTCTCTGTAGG - Intergenic
1202483409 Y:25331605-25331627 GACTGTGAGCTGGTCTCTGTAGG + Intergenic