ID: 1160843984

View in Genome Browser
Species Human (GRCh38)
Location 19:1158677-1158699
Sequence GGCCTCCAGGGACTGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843984_1160843993 8 Left 1160843984 19:1158677-1158699 CCACCGCACAGTCCCTGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1160843993 19:1158708-1158730 TCAGCCGAGGTTCTCCGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 69
1160843984_1160843995 15 Left 1160843984 19:1158677-1158699 CCACCGCACAGTCCCTGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1160843995 19:1158715-1158737 AGGTTCTCCGGGCAGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144
1160843984_1160843990 3 Left 1160843984 19:1158677-1158699 CCACCGCACAGTCCCTGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843984_1160843988 -5 Left 1160843984 19:1158677-1158699 CCACCGCACAGTCCCTGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1160843988 19:1158695-1158717 AGGCCGCATTACCTCAGCCGAGG 0: 1
1: 0
2: 1
3: 4
4: 36
1160843984_1160843991 4 Left 1160843984 19:1158677-1158699 CCACCGCACAGTCCCTGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843984 Original CRISPR GGCCTCCAGGGACTGTGCGG TGG (reversed) Intronic
900417908 1:2543491-2543513 GGGCTCCAGGGGCTGGGCCGGGG - Intergenic
900457177 1:2782845-2782867 GGGCTCCAGGGACAGTGCTCAGG + Intronic
901064755 1:6489436-6489458 GGCTTCCAGGGCCCGTGCGGTGG - Intronic
901446100 1:9309007-9309029 GGCCTCCTGAGACTGTCAGGAGG + Intronic
901631247 1:10649227-10649249 GGGCTCCAGGGCGGGTGCGGGGG + Intronic
902310582 1:15578771-15578793 GGCAGCCAGGGATTGAGCGGGGG - Intronic
902323401 1:15683803-15683825 GGTCTCCAGGGTCTCTGAGGAGG + Intergenic
902955113 1:19920272-19920294 GACCTCCAGGGACGGGGGGGAGG + Exonic
903045512 1:20561688-20561710 GACCTCCAGGGACTGGGAGTAGG - Intergenic
903479819 1:23645060-23645082 GCCCTCCATGGACTGTGCATGGG - Intergenic
903753752 1:25646611-25646633 GGCTGCCAGGGACTGGGCTGGGG - Intronic
904304749 1:29580874-29580896 AGCCTCCAGGGAGGGTCCGGAGG - Intergenic
904408688 1:30311808-30311830 GGCCTCCAGTGGCTGTGCAGAGG - Intergenic
904528738 1:31154841-31154863 GGTCTCCAGAGACAGTGGGGTGG + Intergenic
904972855 1:34432616-34432638 GGCCACCAGGGATTCTGTGGGGG + Intergenic
906711588 1:47934340-47934362 TGCCTGCAGGGACTGTGGGAGGG - Intronic
906733793 1:48105262-48105284 GGCCTGCAGGGAGTGGGCGAGGG - Intergenic
907401902 1:54229488-54229510 GGCACCCTGGGACTGTGGGGTGG + Intronic
908222997 1:62027133-62027155 GGCTTCCAGGGGCTGAGAGGAGG - Intronic
912178542 1:107190140-107190162 GGTTTCCAGGGACTGAGAGGAGG + Intronic
912370807 1:109172657-109172679 GCCCTCCAGGGACATTGGGGTGG - Intronic
912707497 1:111925852-111925874 GGCTTCCAGGGACTGTGCACAGG + Intronic
913314876 1:117541136-117541158 CGTCTTCAGGGACTGTGCTGTGG - Intergenic
913714367 1:121519251-121519273 GGCCACCTGCGAGTGTGCGGAGG + Intergenic
918038581 1:180898320-180898342 GGCATCCAGGGACCCTGGGGTGG + Intergenic
918373550 1:183885341-183885363 TGCCTCCAGGTACTGGGAGGGGG - Intronic
921058542 1:211563351-211563373 GGCCTGCAGGGTCAGTGAGGTGG + Intergenic
922728560 1:227938005-227938027 GGCCACCTGGGACTGTGGGAGGG + Intronic
923016133 1:230127973-230127995 GGCCCCCAAGGGCTGTGTGGGGG + Intronic
923249175 1:232163472-232163494 GGTTTCCAGGGGCTGTGTGGGGG + Intergenic
923318592 1:232805829-232805851 GGCCCCCAGGAGCTGTGGGGTGG - Exonic
923729906 1:236540163-236540185 GGTCTCCAGGGACAGTGTTGTGG + Intronic
1063411609 10:5840668-5840690 TGCCTCCAGGGACACTGCCGGGG - Intronic
1064217421 10:13411981-13412003 GGACACCAGGGACTGAGGGGAGG - Intergenic
1067219902 10:44336481-44336503 GGGCTGCAGGGACAGTGCTGAGG + Intergenic
1067242770 10:44510000-44510022 GGCCTCCAGGGCCTGGGGTGGGG + Intergenic
1069719312 10:70539569-70539591 GGCCTCCAGGGTCTGGGCAAGGG - Exonic
1070358057 10:75659621-75659643 GGTCACCAGGGACTGGGAGGTGG + Intronic
1070729949 10:78819882-78819904 GGCCTGCAGGGAGTGACCGGAGG - Intergenic
1071483823 10:86084856-86084878 GGTTTCCAGGGACTGAGGGGAGG + Intronic
1071531281 10:86391952-86391974 GGCCTCCTGGGCCTGTTGGGAGG + Intergenic
1072679909 10:97498985-97499007 GGCCACCTGGGACCGTGCTGGGG + Exonic
1073266397 10:102230761-102230783 GCCCTGCAGGGCCTGGGCGGGGG - Exonic
1074455263 10:113590547-113590569 GGCCTCAAGGGAGTGGGTGGAGG + Intronic
1075688389 10:124379392-124379414 GCCCTCCACGGCCTGTGCTGTGG - Intergenic
1075971423 10:126657319-126657341 GGCCCCCAGGGGCTGGGAGGAGG - Intronic
1077021967 11:420911-420933 GGGCTCCCGGGGCTGGGCGGGGG + Intronic
1077063630 11:628157-628179 CGCTTCCAGGGACTGCGCGCAGG + Intergenic
1077068609 11:656732-656754 GTCCTCCAGGAACTATGCTGGGG - Intronic
1078136687 11:8657728-8657750 AGCCTTCAGGGGCTGTGTGGTGG - Intronic
1078246066 11:9574017-9574039 GCCCTGCAGCGACTGTGAGGAGG + Exonic
1081655397 11:44853849-44853871 GGCCTCCCGGTTCTGTGTGGTGG + Intronic
1081671576 11:44945552-44945574 GACCACCAGGGACTTTCCGGGGG - Intronic
1081992290 11:47344341-47344363 AGCCCCCAGGGCCAGTGCGGTGG + Intronic
1083471887 11:62889518-62889540 GGCTTCCTGGGACTGAGGGGTGG + Intergenic
1084153295 11:67301197-67301219 GCTCTCCAGGGACTGCGCTGAGG - Intronic
1084271726 11:68032756-68032778 GGCCTCCAGGGTCCTTGCTGAGG + Intronic
1084374114 11:68764339-68764361 GGCCACCAGGGCCTGTGCCAGGG - Intronic
1084569623 11:69951555-69951577 GGCCTCGAGGGACTGAGCTCTGG + Intergenic
1084691436 11:70729362-70729384 GGGCTCCAGGGACTGGGGGCTGG + Intronic
1084720449 11:70902361-70902383 GGCCTCCAGGGAAGATGCAGAGG + Intronic
1084948481 11:72651852-72651874 GGCCACCAGGGAAGGTGGGGAGG - Intronic
1085776359 11:79370186-79370208 GGCCTCCATGGCCTGTGAGCAGG - Intronic
1085818560 11:79768304-79768326 GGGCTCCAGGGACCATGCTGAGG + Intergenic
1088106842 11:106216471-106216493 GGGCTCCAGGGTTTGTCCGGAGG + Intergenic
1088436189 11:109815624-109815646 GGCCTCCAGGGACATAGCAGTGG - Intergenic
1088805118 11:113345408-113345430 GGCCCCCAGGTACTGTTCTGAGG + Intronic
1089470198 11:118714563-118714585 GGCCTCCTGAGACTGTGCCATGG - Intergenic
1089479293 11:118791804-118791826 GGACTCCAGAGAGTGCGCGGGGG + Intergenic
1090716651 11:129437228-129437250 AGGCTCCAGGGACCGTGTGGTGG - Intronic
1090807287 11:130210445-130210467 TGACTCCAGGGTCTGTGCTGAGG - Intergenic
1091387912 12:106444-106466 GGCCTCAAGGGGCAGGGCGGAGG - Intronic
1091617979 12:2064410-2064432 GTCCTCCCTGGACTGTGAGGGGG + Intronic
1091927996 12:4371006-4371028 GGCCTCCAGGCAGTAAGCGGAGG - Intronic
1092124472 12:6065756-6065778 GGCCTCCAGGGACTCTCCAGGGG - Intronic
1097250911 12:57631987-57632009 GGCCTGCGGGGGCTTTGCGGGGG + Exonic
1098133953 12:67381858-67381880 GACCTCCAGGGAATGTTGGGGGG - Intergenic
1103712888 12:122926065-122926087 GGCGGCCAGGGGCTGTGTGGAGG + Intronic
1104689378 12:130813845-130813867 GGACTCCAGAGACGGGGCGGGGG - Intronic
1104797493 12:131529702-131529724 GACCCCCAGGGACAGTGAGGAGG - Intergenic
1104836544 12:131795658-131795680 GACCTCCAGGGCCTGTGCACAGG - Intronic
1105033141 12:132898788-132898810 GACCTCTTGGGACTGTGCCGTGG + Intronic
1105067963 12:133216708-133216730 GGACTCCAGGGACAGCGAGGTGG - Intergenic
1107103376 13:36618000-36618022 GGCCTCCTGGATCTGTGCAGAGG + Intergenic
1107684544 13:42883886-42883908 GTCCTCCAGGGACGGTGAGAAGG + Intergenic
1112359997 13:98708712-98708734 GGCCTCCATGGCCTTTGTGGTGG - Exonic
1112402346 13:99087215-99087237 TGCCTCCGGGGACTGAACGGTGG - Intergenic
1113538914 13:111091817-111091839 GGGCTTCAGGGAAAGTGCGGTGG - Intergenic
1113633583 13:111904795-111904817 GGCCTCCAGGGCCTGCCGGGAGG - Intergenic
1113656188 13:112068843-112068865 GGACGCCGGGGACTCTGCGGCGG + Exonic
1113929478 13:113958805-113958827 GGCCCCAAGGGCCTGTGCTGGGG - Intergenic
1113949527 13:114064334-114064356 GGCCTCCAGTGATGGTGCTGTGG - Intronic
1114374932 14:22134449-22134471 GGTTTCCAGGGACTGGGGGGAGG - Intergenic
1118635174 14:67742226-67742248 GGTTACCAGGGACTGTGAGGAGG + Intronic
1118780766 14:69006208-69006230 CTCCTCCAGGAACTGTGCGGGGG + Intergenic
1118991613 14:70801897-70801919 GACCTCCAGGGAGTCTGCTGTGG + Intronic
1121195474 14:92067999-92068021 GGCCTCCACGGACATTGTGGAGG + Intronic
1121313228 14:92946277-92946299 GGCCTCCAGAGACTGTCCTCAGG - Intronic
1122788461 14:104174572-104174594 GCACCCCAGGGCCTGTGCGGGGG - Intronic
1122973588 14:105162197-105162219 GGCCTCCAGAGACTGGGCAGGGG - Intronic
1124428470 15:29584646-29584668 GGCTGCCAGGGACTTTGGGGTGG + Intergenic
1124937512 15:34186673-34186695 AGCCTGCAGGGACAGTGGGGAGG - Intronic
1125444934 15:39744514-39744536 CACCTCCAGGGGCTGTGCCGGGG - Intronic
1125516501 15:40323976-40323998 GGCCTGCAAGGACTGGGCAGGGG - Intergenic
1126185800 15:45829594-45829616 AGCCTGCAGGGACTGGGAGGCGG + Intergenic
1126344776 15:47681427-47681449 GGTTTCCAGGGACTGGGAGGAGG + Intronic
1127117791 15:55744245-55744267 ATCCTCCTGGGACGGTGCGGTGG + Intergenic
1128530154 15:68439679-68439701 TGCCTTCAGGGAGTGTGAGGAGG - Intergenic
1128547863 15:68579604-68579626 TCCCTCCAGGGAGTGCGCGGCGG + Intronic
1128780803 15:70357503-70357525 GGCCATCAGGGACTGAGGGGAGG + Intergenic
1128965181 15:72051547-72051569 AGCCTGCAGGGACTGGGCGGGGG - Intronic
1128967373 15:72072735-72072757 GGACTCCAAGGAGTGTGAGGAGG + Intronic
1129528392 15:76239545-76239567 GGCTTCCAGGGGCTGGGAGGTGG - Intronic
1130032049 15:80324701-80324723 GGCCTTCAAGGACTGTGAGACGG + Intergenic
1130275043 15:82472119-82472141 GCCCTTCTGGGACTGTGCGCTGG - Intergenic
1130373299 15:83305710-83305732 GGGCTCCAGGGGCAGTGCTGAGG - Intergenic
1130467392 15:84199488-84199510 GCCCTTCTGGGACTGTGCGCTGG - Intergenic
1130496868 15:84474047-84474069 GCCCTTCTGGGACTGTGCGCTGG + Intergenic
1130589687 15:85204086-85204108 GCCCTTCTGGGACTGTGCGCTGG - Intergenic
1130940057 15:88499866-88499888 GGCTGCCAGGGTCTGTGGGGAGG + Intergenic
1131083977 15:89560053-89560075 GGCCTCCACTGACTTTGCAGGGG - Intergenic
1132056034 15:98650355-98650377 GGCGTCCCGGGGCTGGGCGGTGG + Intronic
1132582926 16:693732-693754 GGGCTCCAGGTATGGTGCGGTGG + Exonic
1132672099 16:1106195-1106217 GGTCCCCTGGGACTGTGCGTGGG - Intergenic
1133083093 16:3339019-3339041 GGTTTCCAAGGACTGTGGGGAGG - Intergenic
1133097483 16:3457694-3457716 GCCTGCCAGGGCCTGTGCGGGGG + Intronic
1136115504 16:28091854-28091876 GGCACCCAGGGACGGTGCTGGGG + Intergenic
1136385918 16:29925980-29926002 GGCTTCCAGGGACGGGGCCGCGG + Exonic
1136541954 16:30932666-30932688 ACCCTCCAGGCACTGTGCTGCGG - Intronic
1141093720 16:81148170-81148192 GTCCTCCATGGGCTGTGGGGAGG + Intergenic
1141744480 16:85916320-85916342 GGGCTGCAGGGTCTGTGCTGCGG + Intronic
1141761753 16:86033249-86033271 TGCCTCCCTGGACTGTGGGGAGG + Intergenic
1142467679 17:145546-145568 GGTGGCCAGGGACTGTGTGGGGG + Intergenic
1142666644 17:1467444-1467466 GGCCCCCGGGGACAGGGCGGGGG - Intronic
1143510521 17:7393133-7393155 GGCCTCCAGGAGGTGGGCGGAGG - Exonic
1144306360 17:13972451-13972473 GGCCTCCAGTGATTGTCCTGAGG - Intergenic
1144576072 17:16430310-16430332 GGCTTCCAGGGACTGGGGGAAGG - Intronic
1144683900 17:17213888-17213910 GGGCTCGAGGGATTGTGCTGTGG - Intronic
1144702276 17:17347495-17347517 GGCCACCAGGCTCTGTGCTGGGG + Exonic
1144753824 17:17667823-17667845 GCCCTCCAGGGCCTGTGGGATGG - Intergenic
1145992890 17:29089851-29089873 GGCCTCTGAGGACTGTCCGGGGG + Intronic
1147160026 17:38564221-38564243 GGTCTCCAGCGACTCGGCGGAGG + Exonic
1148151315 17:45397911-45397933 GGCCTCTAGGGGCAGTGGGGAGG - Intronic
1148206364 17:45782834-45782856 GCCCTCCAGGCACTGTGAGCTGG + Intergenic
1148585977 17:48780657-48780679 GGTTGCCAGGGACTGGGCGGAGG - Intronic
1151391760 17:73791902-73791924 AGCCTCTAGGGCCTGTGCAGGGG - Intergenic
1151887503 17:76931889-76931911 GGGCTCCAGGGACTGTGAGGAGG + Intronic
1152153949 17:78620936-78620958 GGCAGCCAGGGACTGTGGGGAGG + Intergenic
1152329621 17:79664783-79664805 GGTCTCCAGGGACCGGGGGGAGG - Intergenic
1152813386 17:82392758-82392780 GGCCAGCAGGGACTCTGTGGTGG + Intronic
1152817148 17:82414845-82414867 GGCCTACAGGGGGTGTGCGGTGG + Intronic
1153404973 18:4727620-4727642 GGTCTCCAGGGATTGTGGGTAGG + Intergenic
1156402579 18:36753212-36753234 AGCCTGCAGGGCCTGTGGGGAGG - Intronic
1156530125 18:37806898-37806920 GGGTTCCAGGGACTGAGGGGAGG - Intergenic
1159212716 18:65347795-65347817 GGACTCATGGGACTGTGAGGAGG - Intergenic
1160291943 18:77602973-77602995 GAACTCCAGGGACGGTGAGGGGG + Intergenic
1160800658 19:966588-966610 GGCGGCCAGGGACTGTGATGGGG - Exonic
1160843984 19:1158677-1158699 GGCCTCCAGGGACTGTGCGGTGG - Intronic
1161043320 19:2121549-2121571 GTCTTCCAGGGCCTGTGTGGAGG - Intronic
1161108505 19:2456044-2456066 GGTCTCCAGGGGGTTTGCGGGGG - Intronic
1162481435 19:10929051-10929073 GGCCTGCAGGGACGCTTCGGCGG + Exonic
1162773612 19:12965496-12965518 CGGCTCCCGGGACTGTGCGGCGG - Intronic
1163218485 19:15897668-15897690 GACCTCCAGGGACAGTGGAGAGG + Intronic
1163378212 19:16947269-16947291 GGCCTCCAGGCACTGGGAGGGGG - Intronic
1163378671 19:16949889-16949911 GGCCTCCAGGGAGTGAGTGGTGG - Intronic
1163560679 19:18017557-18017579 GGCTTCTAGTGACTGTGCTGTGG - Intergenic
1163665971 19:18604246-18604268 GCCCTCCCGGGGCTGGGCGGGGG + Intronic
1163676402 19:18657631-18657653 GGCCTGCTGGGACACTGCGGTGG + Intronic
1168321342 19:55511833-55511855 GGCCTCCAGGATCAGTGTGGGGG + Intronic
1168491920 19:56818176-56818198 GGCCTCAAGGGAGTGGGTGGAGG - Intronic
925304541 2:2838971-2838993 CACCACCAGGGACTGTGCGCAGG + Intergenic
925407267 2:3613797-3613819 TGCCTCGTGGGACTGTGCCGAGG + Intronic
925427595 2:3763252-3763274 TGCCTCCTGGGGCTGTGCTGGGG - Intronic
925922101 2:8645090-8645112 GGCCACCAGGGAGCGTGGGGCGG - Intergenic
926028128 2:9562424-9562446 GGCTTCCAGGGACTGGGAGGAGG - Intergenic
926247720 2:11133183-11133205 GGCCTAAAGGGACAGTGAGGAGG + Exonic
926718554 2:15942498-15942520 GGCTCCCGGGGACTGGGCGGTGG - Exonic
927204571 2:20599066-20599088 GGCCCCCAGGGGCGGTGCTGAGG - Intronic
927885379 2:26714971-26714993 GGCCTCCAGGGTCTCTGGGCTGG - Intronic
928531679 2:32198994-32199016 GGTTTCCAGGGGCTGTGAGGAGG - Intronic
929783919 2:44975666-44975688 TGCCTCCAGGGCCTGAGAGGCGG - Intergenic
930204443 2:48574000-48574022 GGTTTCCAGGGCCTGTGGGGAGG + Intronic
932124599 2:69132335-69132357 TTCCTCCAAAGACTGTGCGGGGG - Intronic
932223552 2:70021075-70021097 GGCCACCAGGGACTGGGGGAGGG - Intergenic
932676491 2:73786090-73786112 GGCTTCCAGGCAGGGTGCGGTGG + Intronic
932750027 2:74365692-74365714 AGTTTCCAGGGACTGTGGGGAGG - Intronic
932873184 2:75424445-75424467 GGTCCCCAGGGGCTGTGGGGAGG + Intergenic
933815966 2:86069088-86069110 TACCTCCAAGGACTGTGGGGAGG + Intronic
934572907 2:95383537-95383559 GTTCTCCAGGGACTGGGCTGAGG - Intronic
935582379 2:104767756-104767778 GGCCTTCAGAGACTCTGCTGAGG - Intergenic
937264050 2:120605011-120605033 GGCCTCCAAGGCCTGTGATGTGG - Intergenic
937295297 2:120806542-120806564 GGCCCCCTGGGAGTGTGGGGAGG + Intronic
937990988 2:127662226-127662248 TACCTCCAGGGACTGTTGGGAGG + Intronic
938118415 2:128617582-128617604 AGTGTCCAGGGACTGTGCTGGGG + Intergenic
939153687 2:138501166-138501188 GGCCTCCTGGGACCGCACGGTGG - Intergenic
945669201 2:212782207-212782229 GGCTTCTAGGGACTGAGAGGAGG - Intergenic
946326002 2:218985076-218985098 CGCCGCCGGGGACTGGGCGGTGG + Exonic
946711648 2:222512640-222512662 GGCTTCCAGGGACTGAGGAGAGG - Intronic
947196867 2:227576788-227576810 GGTTTCCAGGGCCTGTGGGGAGG + Intergenic
947377498 2:229511459-229511481 GGCCTCTAGGGAGAGTGCAGTGG - Intronic
947713104 2:232326896-232326918 TGACTCCTGGGACTGTGCTGGGG + Intronic
947720176 2:232365366-232365388 TGACTCCGGGGACTGTGCTGGGG + Intergenic
947732796 2:232440353-232440375 TGACTCCTGGGACTGTGCTGGGG + Intergenic
948949468 2:241239640-241239662 GGGCGCCAAGGACTGTGTGGAGG - Exonic
1168860467 20:1042879-1042901 GGTCTCCAGGCACTGTGCTGAGG + Intergenic
1169825107 20:9759005-9759027 TTCCTCCAGGGACTGTGTTGTGG - Intronic
1171127382 20:22614456-22614478 CCCTTCCAGTGACTGTGCGGTGG - Intergenic
1172162651 20:32879268-32879290 GGCCTCCAGGGCCTGGCTGGGGG - Intronic
1172277124 20:33685939-33685961 GCCCTCCCGGGTCTGCGCGGGGG + Intronic
1172894634 20:38291936-38291958 GACATACAGGGACTGTGCTGAGG - Intronic
1173766833 20:45619013-45619035 GGACTCCAGGGACTTGGCTGAGG + Intronic
1175108849 20:56631608-56631630 GGCATCCAGGGCGTGTGCGTGGG - Exonic
1175232745 20:57484286-57484308 GGTCTCCAGGGGCTGGGTGGAGG + Intergenic
1175277924 20:57784422-57784444 AGCCCCCAGGCACTGTGCTGGGG + Intergenic
1176094329 20:63333031-63333053 AGCCCCCAGGGACTGAGCCGGGG + Intronic
1176268452 20:64222964-64222986 GTCCTCCAAGGACTGAGTGGAGG + Intronic
1176307251 21:5130244-5130266 GGCCTGCAGGTACAGTGCTGTGG + Intergenic
1179178542 21:39026220-39026242 GGGCTCCTGGGACTGTGAAGGGG + Intergenic
1179571247 21:42280076-42280098 GGCCTCCAGGTCCTGTGGGGAGG - Intronic
1179605542 21:42513550-42513572 GGCCGCCTGGGACTGCCCGGAGG + Intronic
1179849808 21:44131786-44131808 GGCCTGCAGGTACAGTGCTGTGG - Intergenic
1180245902 21:46546997-46547019 GGGCTCCACGGCCAGTGCGGTGG - Exonic
1181461671 22:23089469-23089491 AGCCTCCAGGGATTGTGCCTGGG + Intronic
1181748119 22:24970125-24970147 AGCCTGCTGGGACTGTCCGGTGG - Intronic
1183483900 22:38079131-38079153 GGCCTCCTGGGACAGAGGGGTGG - Intronic
1184417833 22:44362431-44362453 TGCCTCCAGGGACTGTTCTTAGG + Intergenic
1184443827 22:44535665-44535687 TGCCTCCAGGTATTGTGCAGAGG + Intergenic
1184478471 22:44734310-44734332 GGCCTCAAGGGGCTGTCAGGGGG - Intronic
1184479339 22:44737762-44737784 GGTTTCCAGGGTCTGTGTGGAGG + Intronic
1184642623 22:45880444-45880466 GGGCTCCCAGGACTGTGGGGCGG + Intergenic
1184663838 22:45977360-45977382 GCCCTCCGGGGACTGGGCGGGGG + Intergenic
1185116275 22:48940055-48940077 GACCTCCAGGGCCAGGGCGGGGG - Intergenic
950004913 3:9685433-9685455 GGCCTCGCGGGCCTGTGCTGTGG + Intronic
950431815 3:12955307-12955329 GGCCTCCTGGGACTGTGGGAGGG - Intronic
950522658 3:13505852-13505874 GACCTCCAGGAAGTGGGCGGGGG + Exonic
953454755 3:43032601-43032623 GGCATCCAGGGAGGGTGAGGAGG + Exonic
954420513 3:50416592-50416614 GGGCCCCAGGGGCTGTGCAGAGG + Intronic
954796134 3:53162008-53162030 GGCCTCCAGGGACCCAGGGGCGG - Intronic
957143212 3:76387748-76387770 GGACTCCAGAGTCTGTGCTGTGG + Intronic
961781843 3:129325088-129325110 GCCCTACAGGGACTCTGCGGTGG + Intergenic
962396488 3:135019098-135019120 GGCCTCCAGGTATTGTGGAGTGG - Intronic
966724764 3:183099431-183099453 GGGCTCCAGGGACATGGCGGCGG - Exonic
967035381 3:185645379-185645401 GGCGGCCAGGGACTCTGCCGAGG - Exonic
968483953 4:849840-849862 GGCCTTCAGGGGCGGGGCGGGGG - Intronic
968520107 4:1031307-1031329 GGGCTCGAGGGTCTGTGCAGGGG + Intergenic
969230472 4:5826912-5826934 GGGCTCCAGGGACAGAGGGGAGG - Intronic
969257226 4:6010705-6010727 TGCCTCCAGGGACAGTTGGGTGG + Intergenic
969338937 4:6528332-6528354 GGCTTCCAGGGCCTGTGCTCAGG + Intronic
969696945 4:8740312-8740334 CGCCATCAGGGACTGGGCGGGGG - Intergenic
970687992 4:18590153-18590175 GGCCTGGAGGGACTGAGGGGTGG - Intergenic
972180073 4:36453584-36453606 GGTTTCCAGGGACTGTAGGGAGG - Intergenic
977011814 4:91644804-91644826 GGCTTCCAGAGTCTGTGGGGAGG + Intergenic
979060421 4:116052309-116052331 GGTTTCCAGGGACTGAGGGGAGG + Intergenic
981168181 4:141588242-141588264 GGCCTCCAGGGATTGTTATGAGG - Intergenic
982110303 4:152047270-152047292 AGGCTCCAGGTACTGTGCGAAGG - Intergenic
998907127 5:146918012-146918034 GGACTGCAGGGAGTGTGAGGGGG - Intronic
999519078 5:152331917-152331939 GCCCTCCTGGGACTGTGGGCTGG + Intergenic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
1000329844 5:160197858-160197880 GGTCTCCAGGGACAGAGCAGAGG - Intronic
1002454876 5:179340206-179340228 AGCCTCCATGGGCTGGGCGGTGG - Intronic
1002563639 5:180098468-180098490 GGGCTGCATGGACTTTGCGGAGG + Intergenic
1002789729 6:428239-428261 TGCCTCCCGGGACAGTGGGGTGG + Intergenic
1002959242 6:1898219-1898241 GGCCTCCAGGGTCTCTTCCGGGG - Intronic
1003567167 6:7231107-7231129 GCCCTGCAGGGGCTGTGCTGGGG - Exonic
1005807335 6:29487107-29487129 GGCCACCAGGGTCTATGCGGTGG - Exonic
1012225574 6:96699826-96699848 GCCCTCCAGGGTCTGGGCAGTGG - Intergenic
1014736413 6:125099895-125099917 GCCCTCCCGGGACTGTGCTCCGG - Intergenic
1014759105 6:125335843-125335865 GGCCTCCAGGGAGTGTTCATTGG + Intergenic
1015976399 6:138795863-138795885 TGCCTCCAGGGAGCTTGCGGTGG - Intergenic
1017693692 6:156992760-156992782 GGGTTGCAGGCACTGTGCGGTGG + Intronic
1018907839 6:168085548-168085570 GGGCTCCAGGGGGTGTGCAGAGG + Intergenic
1019068924 6:169325695-169325717 GGGCACCATGGACTGTGGGGTGG + Intergenic
1019068940 6:169325758-169325780 GGGCACCATGGACTGTGGGGTGG + Intergenic
1019421547 7:953477-953499 GGCCCCCAGGGAGGGAGCGGGGG - Intronic
1020401984 7:7789622-7789644 GGTTTCCAGGGTCTGTGGGGAGG - Intronic
1023221128 7:37920957-37920979 GGGCGCCCGGGACGGTGCGGAGG - Exonic
1023264673 7:38392764-38392786 GGCCTCCTGGGACTGGGGGAGGG - Intronic
1024041108 7:45555553-45555575 GGTTTCCAGGGACTGAGGGGAGG + Intergenic
1025042854 7:55662906-55662928 GGCCTCCAGGTAGTGTGTGCTGG - Intergenic
1027138060 7:75638781-75638803 GGACTCCAGGGACTGGGCTGCGG - Intronic
1028621856 7:92835176-92835198 AGCCCCCAGGGACTGCCCGGGGG + Intronic
1028912726 7:96226185-96226207 GGCTACCAGGGGCTGTGAGGAGG - Intronic
1029736996 7:102470489-102470511 GGCCTCAGGGGACTCTGCTGAGG + Intronic
1034502500 7:151459844-151459866 TGCAATCAGGGACTGTGCGGGGG + Intergenic
1035174041 7:157037845-157037867 GTCTTTCAGGGACTGTGGGGAGG - Intergenic
1036768034 8:11561210-11561232 AGCCCACAGGGGCTGTGCGGGGG + Intronic
1037605325 8:20433434-20433456 TCCTTCCAGGGGCTGTGCGGAGG + Intergenic
1039473466 8:37827426-37827448 GGGCTGCAGGGACAGTGCTGAGG - Intronic
1040040799 8:42915162-42915184 TGTCTCCAGGGACTGTCCGATGG + Intronic
1040318651 8:46277954-46277976 GGCCTCCATGGACAGTGGTGGGG - Intergenic
1042961932 8:74312681-74312703 GGTCGCCAGGGACTGTAGGGTGG - Intronic
1044962283 8:97542812-97542834 AGCCAGCAGGGACTGTGGGGAGG - Intergenic
1045045927 8:98277615-98277637 GGCTGCCATGGACTGTGGGGAGG - Intronic
1045137077 8:99232896-99232918 GGCGGCCAGGGACTCTGCAGAGG - Intronic
1047250789 8:123180810-123180832 GACCTCCAGGGATTGTAGGGAGG + Intronic
1047556173 8:125933047-125933069 GGCTTCCAGGGGCTGGGAGGAGG + Intergenic
1048013387 8:130476636-130476658 GGGCCCCAGGGACTGTGCTGAGG - Intergenic
1048367508 8:133751176-133751198 GGCCTCCTGGGGCTGTTGGGAGG + Intergenic
1049211049 8:141386572-141386594 AGCCTCAAAGGACTGAGCGGAGG + Intergenic
1049706671 8:144046286-144046308 GGCCTCCAGGGACTGAGGGCAGG - Intronic
1049966986 9:788855-788877 GGCCTGCAGGGTATGTGCAGTGG - Intergenic
1053762610 9:41356818-41356840 GCCCTCCCGGGTCTGTGCTGAGG + Intergenic
1054982630 9:71223743-71223765 GGCCTACAGGGAGTGTGCCAGGG - Intronic
1056910854 9:90699098-90699120 GGCTGCCAGGGACTGAGGGGTGG - Intergenic
1061208514 9:129177635-129177657 GGCGCCCAGGGGCTGCGCGGCGG - Exonic
1061373130 9:130209057-130209079 GGTCTCCAGGGAGTGTGGGGAGG + Intronic
1061927587 9:133813515-133813537 GTCCTCCAGGGAAGGTGCTGAGG - Intronic
1185619099 X:1442539-1442561 GGCCTTCAGGGACTGACCAGGGG + Intronic
1186940121 X:14497556-14497578 TGTCTCCAAGGACTGTGCTGTGG - Intergenic
1191830263 X:65407786-65407808 GGCGTTCGGGGACTGTGCGCGGG - Intronic
1195687101 X:107597337-107597359 GGCCCCCAGTGACAGGGCGGTGG - Exonic
1197971331 X:132118498-132118520 GGCCTCCAGTTCCTGTGTGGTGG - Intronic
1198160856 X:134006646-134006668 GGTTGCCAGGGACTGTGGGGAGG + Intergenic
1200334497 X:155335334-155335356 TGCCTCCAGGGGCTGGGAGGGGG + Intergenic
1200361433 X:155611381-155611403 TGCCTCCAGGGGCTGGGAGGGGG - Intronic