ID: 1160843985

View in Genome Browser
Species Human (GRCh38)
Location 19:1158680-1158702
Sequence TGCGGCCTCCAGGGACTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843985_1160843997 30 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843997 19:1158733-1158755 CAAGGCGCTCCCTGCGTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 168
1160843985_1160843990 0 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843985_1160843991 1 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1160843985_1160843988 -8 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843988 19:1158695-1158717 AGGCCGCATTACCTCAGCCGAGG 0: 1
1: 0
2: 1
3: 4
4: 36
1160843985_1160843995 12 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843995 19:1158715-1158737 AGGTTCTCCGGGCAGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144
1160843985_1160843993 5 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843993 19:1158708-1158730 TCAGCCGAGGTTCTCCGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843985 Original CRISPR TGCGGCCTCCAGGGACTGTG CGG (reversed) Intronic
900103888 1:974111-974133 TGGGGCCTCTTGGGACTCTGAGG + Intronic
900117508 1:1034838-1034860 GACGGCCTCCAGGGACCGAGGGG - Intronic
900316784 1:2060931-2060953 TGCGTGCTCCAGGGTCCGTGAGG - Intronic
901736840 1:11318042-11318064 AGCAGGCTCCAGGGACTATGTGG + Intergenic
902331455 1:15732999-15733021 TGCTGCCTCAAGGGCCTGGGAGG + Intronic
902331979 1:15735246-15735268 TGCTGCCTCAAGGGCCTGGGAGG + Intergenic
906528240 1:46508834-46508856 TGCTGGCTCCAGGGACTGCAGGG - Intronic
908121673 1:60991748-60991770 AACGGGCTCCAGGTACTGTGGGG - Intronic
908661179 1:66436934-66436956 TGCCTCCTCTAGGGACTATGAGG - Intergenic
922672500 1:227521917-227521939 TGCTGGCACCAGGGACTGGGGGG - Intergenic
922870895 1:228901206-228901228 TGCGGCCACCAGGGTGTGGGTGG + Intergenic
923016130 1:230127970-230127992 AGCGGCCCCCAAGGGCTGTGTGG + Intronic
924385442 1:243495222-243495244 TGGGGCCTCCCTGGCCTGTGCGG + Intronic
1066068342 10:31778720-31778742 GGTGGCCTCCAGGAACTGGGAGG - Intergenic
1069302759 10:66928431-66928453 ATCGGGCTCCAGGGAGTGTGAGG + Exonic
1069587651 10:69619141-69619163 TGGAGCCTGCAGGTACTGTGGGG - Intergenic
1070358056 10:75659618-75659640 TGTGGTCACCAGGGACTGGGAGG + Intronic
1072524449 10:96259172-96259194 TGCTGTCTCCAGGGACAGAGAGG - Intronic
1075015009 10:118904037-118904059 AGCTGCCTCCAGGGTCTGGGAGG - Intergenic
1076754727 10:132563236-132563258 GCCAGCCCCCAGGGACTGTGAGG - Intronic
1077110449 11:859865-859887 TGCAGCCACGAGGGGCTGTGTGG + Intronic
1077215271 11:1392814-1392836 TGCGTCCTGCAGGGCCAGTGTGG + Intronic
1077266870 11:1655258-1655280 GGGGGCCTCCAGGGACAGTGGGG + Intergenic
1077422436 11:2459269-2459291 CGTGGTGTCCAGGGACTGTGTGG + Intronic
1078079285 11:8192434-8192456 TGCAGCCCTCAGGAACTGTGTGG + Intergenic
1078147734 11:8733242-8733264 TAAGGCCTCCATGAACTGTGAGG - Intronic
1082092854 11:48104024-48104046 TGCTGTCATCAGGGACTGTGGGG - Intronic
1083673649 11:64313902-64313924 GGCGGCCTCCCGGGGCTGGGAGG - Intronic
1084541345 11:69788924-69788946 TGCAGCCTCCAAGGCCTGTAAGG + Intergenic
1084676729 11:70639779-70639801 TCTGGCCTCCAGGGCCTGAGCGG + Intronic
1087141610 11:94769711-94769733 TGCGGCCTCCTGAGACGATGCGG + Intronic
1090716652 11:129437231-129437253 GGCAGGCTCCAGGGACCGTGTGG - Intronic
1091195654 11:133728683-133728705 TGCAGCTTCCAGTGGCTGTGAGG + Intergenic
1094263999 12:28534591-28534613 TGAGGCCTCCAGGGAGTATCAGG - Intronic
1095958581 12:47819854-47819876 TGCAGCCTCCGGCGACTGGGGGG - Intronic
1096973666 12:55686201-55686223 TTGGGGGTCCAGGGACTGTGGGG - Intronic
1100804035 12:98262365-98262387 TGTGGCCTCCAGGGACTGTTAGG - Intergenic
1101860197 12:108476296-108476318 TGCTGCATGCAGGGACTCTGGGG - Intergenic
1102464342 12:113119747-113119769 TGGGGCCTCCAGAGAATCTGAGG - Intronic
1103774217 12:123353920-123353942 TGTGGCCTGCAGGGGCTCTGTGG - Intronic
1103943790 12:124515050-124515072 TGGTGCCTGCAGGGCCTGTGGGG - Intronic
1104645881 12:130496938-130496960 TCCGGCCTCCAGGGCATGAGAGG - Intronic
1104653618 12:130556780-130556802 TGCAGCCCCCAGGAACAGTGTGG + Intronic
1104736211 12:131137378-131137400 TGTGGCCTCCTTGGACTCTGGGG + Intronic
1104903558 12:132201878-132201900 TGTGTCTTCCTGGGACTGTGGGG + Intronic
1105018118 12:132798535-132798557 TGGGGCCTCCAGGGACAGGCTGG - Intronic
1105026636 12:132853459-132853481 TGCATCCCCCAGGGCCTGTGGGG + Exonic
1106504543 13:30359838-30359860 TGCAGCCTTCAGGCTCTGTGAGG - Intergenic
1106856057 13:33854316-33854338 TGCTGCCTGCAGGAACTGAGTGG - Intronic
1112772829 13:102810134-102810156 TGTGGTTTCCAGGGACTGTGAGG - Intronic
1112806952 13:103173379-103173401 TGTGGCCTCCAGGGTCTGAACGG - Intergenic
1116697902 14:48200575-48200597 TGTGGCCTCCAGGCTCAGTGAGG - Intergenic
1118195225 14:63619151-63619173 TGGGGCCTGCTGGGACTGAGTGG + Intronic
1118326642 14:64785904-64785926 TGCAGCTTCCAGGGAGTCTGGGG + Exonic
1119863040 14:77950740-77950762 TACTGCCTCCAGGGACTTTCTGG + Intergenic
1121406155 14:93720496-93720518 TCAGGCCTCAGGGGACTGTGGGG + Exonic
1121910980 14:97792166-97792188 TCCAGCCTCAAGTGACTGTGTGG - Intergenic
1122122881 14:99563864-99563886 CACGGCCTCCAGGGTATGTGGGG + Intronic
1122255372 14:100472315-100472337 TGCTGCCTCCAGGATCTGGGAGG - Intronic
1124377638 15:29138790-29138812 TGAGGTCTCCAAGCACTGTGTGG + Intronic
1126785095 15:52171982-52172004 AGCAGCCTCCTGGGGCTGTGTGG - Intronic
1128967372 15:72072732-72072754 TGGGGACTCCAAGGAGTGTGAGG + Intronic
1130674061 15:85936990-85937012 TGCCTCCTCCAGGGTCTGGGAGG - Intergenic
1130940056 15:88499863-88499885 GGCGGCTGCCAGGGTCTGTGGGG + Intergenic
1131057319 15:89383390-89383412 TTCTGCCTCCAAGGACTGGGGGG - Intergenic
1132120922 15:99174667-99174689 GCCGGCCTCCAGGCACTGTCAGG - Intronic
1132681736 16:1145285-1145307 CGCGGCCTCCAGAGCCCGTGAGG + Intergenic
1132991916 16:2799771-2799793 TCCCCCTTCCAGGGACTGTGGGG + Intergenic
1133083094 16:3339022-3339044 TGTGGTTTCCAAGGACTGTGGGG - Intergenic
1133097480 16:3457691-3457713 TGCGCCTGCCAGGGCCTGTGCGG + Intronic
1137676663 16:50307026-50307048 TGGGGGCAGCAGGGACTGTGAGG - Intronic
1138124014 16:54424017-54424039 TGCCACCTCCAGCCACTGTGGGG + Intergenic
1139431054 16:66911228-66911250 GGCGCCCTGCAGGGACTGGGCGG + Exonic
1139590976 16:67932716-67932738 GGCGGCCTTCTGGGAGTGTGAGG + Intronic
1141840571 16:86571690-86571712 TGCGTCCTGCAGTGCCTGTGTGG + Intergenic
1142144945 16:88489059-88489081 TGGGGCCTCCTGGGGATGTGGGG - Exonic
1142308085 16:89296801-89296823 TGGGGGCCCCAGGGAGTGTGGGG + Intronic
1143322367 17:6076409-6076431 GGTGCACTCCAGGGACTGTGGGG + Intronic
1144127870 17:12219847-12219869 TGCTGCCTGCAGGGGCTCTGAGG - Intergenic
1144659434 17:17058539-17058561 GGAGAGCTCCAGGGACTGTGGGG + Intronic
1145045839 17:19615089-19615111 TGCTGCCCCCAGGGGCTGCGAGG - Intergenic
1145988739 17:29065379-29065401 TGGGGACTCCAGAGGCTGTGTGG - Intergenic
1148199397 17:45739962-45739984 TGGGGCCTCCTGGGACAGTTGGG + Intergenic
1148891018 17:50807163-50807185 TGCGGTTGCCAGGGGCTGTGGGG + Intergenic
1148954650 17:51343668-51343690 TGCAGGCTCCAGGGCATGTGAGG - Intergenic
1150264020 17:63820224-63820246 TGGGGCCTCCAGAGATTGGGTGG - Intronic
1150602715 17:66664375-66664397 TCCTGCCCCCAGGGCCTGTGAGG + Intronic
1151887502 17:76931886-76931908 TTGGGGCTCCAGGGACTGTGAGG + Intronic
1151957935 17:77389712-77389734 TGGGGCCGCCAGGGCCTGGGTGG - Intronic
1152064360 17:78102283-78102305 GGGGGTCTGCAGGGACTGTGAGG + Intronic
1152153948 17:78620933-78620955 AGCGGCAGCCAGGGACTGTGGGG + Intergenic
1152423831 17:80208353-80208375 TGCCCCTTCCCGGGACTGTGGGG + Exonic
1152578805 17:81157007-81157029 TGCCGCCACCAGGGCCTGTGGGG - Intronic
1152925578 17:83086141-83086163 TGTGACCTCCATGGTCTGTGTGG + Intronic
1152945403 17:83195146-83195168 TGCAGGCTCCAGGGGCTCTGTGG - Intergenic
1153446068 18:5174290-5174312 TACTGCCTATAGGGACTGTGAGG + Intronic
1154384343 18:13880010-13880032 AGGGGCCTCTAGGGACTGTAGGG - Intergenic
1156953900 18:42937960-42937982 TGAGGACTCCAGTGGCTGTGGGG + Intronic
1160266607 18:77344102-77344124 TGCTGCTTCTAGGCACTGTGGGG + Intergenic
1160412204 18:78682892-78682914 TGAGGCCTCCAGGGAGTGGGCGG - Intergenic
1160843985 19:1158680-1158702 TGCGGCCTCCAGGGACTGTGCGG - Intronic
1160845149 19:1162995-1163017 TGTGGCCCGCAGGCACTGTGGGG - Intronic
1160934037 19:1584804-1584826 AGCGGCCTCCCCGGACCGTGGGG - Intronic
1160976145 19:1793570-1793592 TGGGGCCTCTAGGGGCTGGGAGG + Intronic
1161217430 19:3101399-3101421 TGCAGCCCCCAGGGACTGTGGGG + Intronic
1161321068 19:3641804-3641826 TGCGGCCTGCAGGCAATGGGAGG + Exonic
1162378889 19:10320768-10320790 TGCCACCTCCAGGGGCTGGGGGG + Exonic
1163294598 19:16404240-16404262 TGCAGCCTCCGGGATCTGTGAGG + Intronic
1163378215 19:16947272-16947294 TTGGGCCTCCAGGCACTGGGAGG - Intronic
1163378672 19:16949892-16949914 AGGGGCCTCCAGGGAGTGAGTGG - Intronic
1163501798 19:17680489-17680511 TGCGGCCTCAAAGGTCTTTGGGG + Intronic
1163612380 19:18308180-18308202 TGAGGGCCCCAGGGACTGAGTGG + Intronic
1165686369 19:37824452-37824474 TGTGGCCTCCAGGGCTTCTGTGG + Intergenic
1166522012 19:43486854-43486876 TGAGGCCTCCAGGGATTCTAGGG + Exonic
1166638568 19:44473716-44473738 TGGGGCCCCCAGGGAGTATGTGG + Intergenic
1167501522 19:49851255-49851277 TGCGGGCTCCACCGACTGAGGGG - Exonic
1168491921 19:56818179-56818201 TGGGGCCTCAAGGGAGTGGGTGG - Intronic
925166622 2:1719540-1719562 AGCGGCCTCCAGGGCCTCTCTGG + Intronic
925411694 2:3643316-3643338 TGCGGCCTCAAAGGCCCGTGGGG + Intronic
925911895 2:8579133-8579155 TGTGTCCACCAGGCACTGTGCGG - Intergenic
925922102 2:8645093-8645115 CGCGGCCACCAGGGAGCGTGGGG - Intergenic
926028129 2:9562427-9562449 AGTGGCTTCCAGGGACTGGGAGG - Intergenic
926221099 2:10935851-10935873 TGGGGCCTGGAGAGACTGTGTGG - Intergenic
927392148 2:22607559-22607581 TGCGGAGCCCAGGGTCTGTGGGG + Intergenic
929292951 2:40214255-40214277 AGCAGACTCCAGAGACTGTGAGG - Intronic
929783920 2:44975669-44975691 TTCTGCCTCCAGGGCCTGAGAGG - Intergenic
931701660 2:64914121-64914143 GGGGGCTTCCACGGACTGTGTGG - Intergenic
936025597 2:109028850-109028872 TGTGGCTGTCAGGGACTGTGAGG + Intergenic
937990987 2:127662223-127662245 AGCTACCTCCAGGGACTGTTGGG + Intronic
938291872 2:130154883-130154905 TGCAGCCACCAGGCACTGGGTGG - Intronic
938464676 2:131518081-131518103 TGCAGCCACCAGGCACTGGGTGG + Intergenic
939444053 2:142286521-142286543 TCTGGTCTCCAGTGACTGTGGGG + Intergenic
944690542 2:202154677-202154699 TGCTGCCTCCAAGGACTGCTGGG - Exonic
945749414 2:213762185-213762207 AGTGGCTTCCAGGGACTGGGAGG + Intronic
946002274 2:216492475-216492497 TGTGGCCCCCAGGGGCTTTGTGG + Intergenic
946252766 2:218423671-218423693 TGCGACCTCCTGGCACTGTTGGG + Intronic
947228357 2:227861229-227861251 TAAGTCCTGCAGGGACTGTGTGG + Intergenic
947505731 2:230707197-230707219 GGAGGCCTACAGGGGCTGTGGGG - Intergenic
947663010 2:231883998-231884020 TGCGGCCTCCAGGGAGAAAGAGG + Intergenic
947741472 2:232486870-232486892 TGCGGAAACCAGGGACTATGAGG + Intronic
948918776 2:241051862-241051884 TGCGGCCCCCAGGGGCAGGGGGG + Intronic
1169065910 20:2693936-2693958 TGCTGCCTCCTGAGGCTGTGGGG + Intronic
1171409321 20:24935444-24935466 TGCAACCTCCAAGGGCTGTGGGG - Intergenic
1171484801 20:25478962-25478984 TGCTGCACCCAGGCACTGTGTGG - Exonic
1172162654 20:32879271-32879293 TGAGGCCTCCAGGGCCTGGCTGG - Intronic
1175930817 20:62492989-62493011 TGCAGGCCCCAGGGGCTGTGGGG - Intergenic
1176127744 20:63483466-63483488 TGAGGCCTCGAGAGGCTGTGGGG - Intergenic
1176170749 20:63695388-63695410 AGAGGCCAGCAGGGACTGTGGGG + Exonic
1176245857 20:64096281-64096303 TGCGGCCTCTCGGGCCAGTGTGG - Intronic
1179571248 21:42280079-42280101 CGTGGCCTCCAGGTCCTGTGGGG - Intronic
1179955496 21:44736010-44736032 TGGAGCCTCCAGAGACAGTGCGG - Intergenic
1180132245 21:45834224-45834246 GCCGGGCTCCAGGCACTGTGCGG - Intronic
1180725639 22:17944866-17944888 AGCGGTCCCCAGGAACTGTGGGG - Intronic
1180921123 22:19522241-19522263 TTCCTCCTCCAGGGGCTGTGTGG - Intergenic
1182094207 22:27615071-27615093 TGCGTCCTCCAGTGCCTGTGAGG - Intergenic
1182743405 22:32585526-32585548 TGCTGGCCCCAGGGAGTGTGAGG + Intronic
1183663945 22:39236691-39236713 TTGGGTCTCCTGGGACTGTGGGG - Intronic
1183707029 22:39480498-39480520 TGTGGCCTCAAAGCACTGTGGGG - Intronic
1184239453 22:43204185-43204207 TGGGGCCTGTAGGGTCTGTGGGG + Intronic
1184405746 22:44299443-44299465 TCCGTCCTCCAGGGATGGTGAGG + Intronic
1184642622 22:45880441-45880463 TGAGGGCTCCCAGGACTGTGGGG + Intergenic
950289398 3:11771312-11771334 TGTGGCCTCCAGGGACGGGCTGG + Intergenic
950463418 3:13138985-13139007 TGAGGGCTCCCGGAACTGTGGGG - Intergenic
950888081 3:16378088-16378110 TGCAGCCTCCTGGATCTGTGAGG + Exonic
952863343 3:37833166-37833188 TGCATCCTGCAGTGACTGTGAGG - Intergenic
953128775 3:40117258-40117280 TTCAGCCTCCAGGGTCTTTGTGG - Intronic
954418460 3:50405754-50405776 TGAGGCCTGGAGGGACTGTCAGG + Intronic
954662224 3:52232232-52232254 TGGGGGCTCCAGGGAAGGTGAGG - Intronic
960854179 3:122086049-122086071 TGCAGGCTCCAGGGCCAGTGTGG - Intronic
968466167 4:752532-752554 TGAGGCCTCCGGGGACCGGGCGG + Intronic
968626750 4:1629314-1629336 AGCGGCCTCCAGGGGAAGTGCGG + Intronic
969339489 4:6531209-6531231 TGCTTCCTCGAGGGACTGAGAGG - Intronic
969430889 4:7153730-7153752 TGCTGCCTCCAGAGACTGCAGGG + Intergenic
970687346 4:18583664-18583686 TGCTGGCTTCATGGACTGTGTGG - Intergenic
975584927 4:75940321-75940343 TGCAGCCTCCCGGGAGTGGGGGG + Intronic
977011813 4:91644801-91644823 AGCGGCTTCCAGAGTCTGTGGGG + Intergenic
981545040 4:145884931-145884953 AGTGGCCTCCAGGGCCTGTGGGG + Intronic
985782261 5:1877596-1877618 TGAGGCCTCCTGGGCCTGTCGGG - Exonic
989727946 5:44609795-44609817 TGCAGACTCCAGGGAAAGTGTGG + Intergenic
997661829 5:135595089-135595111 TGCCTCCACCAGGGACTGTTTGG - Intergenic
999431326 5:151527829-151527851 TGGGGCCTCTGTGGACTGTGAGG - Intronic
1001112206 5:168906050-168906072 TGCAGACTCCATGGAATGTGGGG - Intronic
1002522765 5:179800625-179800647 TGCAGCCTCCAGGGGCTGAGAGG + Intronic
1003548952 6:7084989-7085011 TGCGGCCCACAGGGAGGGTGGGG + Intergenic
1004292448 6:14380709-14380731 CTCGAGCTCCAGGGACTGTGAGG + Intergenic
1007421944 6:41724796-41724818 TGGGGCCCGCAGGGACTGTGGGG + Intronic
1007422570 6:41728533-41728555 TGCACCCCTCAGGGACTGTGGGG + Intronic
1008520888 6:52361938-52361960 TGCAGCTACCAGGGACTGCGAGG + Intronic
1012996640 6:105981678-105981700 TGCGGCCTGCGGGGCCTTTGGGG + Intergenic
1020074847 7:5251135-5251157 TGCTCCCTCCAAGGACTCTGTGG + Intergenic
1022195483 7:28062511-28062533 TGCAGCATGCAGGGTCTGTGTGG - Intronic
1023621183 7:42074703-42074725 TGTGGCCTCCTGGGACTGCCTGG - Intronic
1024870270 7:53956606-53956628 TGTGGCCTCCAGGTGCAGTGAGG + Intergenic
1029581350 7:101438549-101438571 TGAGTCCACCAGAGACTGTGCGG - Intronic
1034224827 7:149474351-149474373 TGCGGCCGGCAGGGGCTATGGGG + Exonic
1034423601 7:151001644-151001666 TGGGGCCCCCAGGGTGTGTGTGG - Intronic
1034891759 7:154845906-154845928 TGTGGCCTGCAGGGCCTCTGTGG + Intronic
1034891776 7:154845998-154846020 TGTGGCCTGCAGGGCCTCTGTGG + Intronic
1035013097 7:155738261-155738283 TGCAGCCTCCAGGTCCGGTGGGG + Exonic
1038690722 8:29760667-29760689 TGCTGCCTCCAGGACATGTGTGG - Intergenic
1040303330 8:46199411-46199433 TGCGGGCTGCAGGGACTCAGGGG + Intergenic
1040316427 8:46263316-46263338 GGCGGGCTGCAGGGACTCTGAGG + Intergenic
1042837926 8:73093664-73093686 TGCGGCCTGCGGGGACTGAGAGG - Intronic
1042877988 8:73457376-73457398 GGCTGCCCCCAGGGGCTGTGTGG + Intronic
1047850911 8:128856789-128856811 TGCTGGCTCCAGGTACTGTGTGG + Intergenic
1049659015 8:143811457-143811479 CCCGGTCTCCAGGGGCTGTGAGG - Intronic
1052978057 9:34426533-34426555 TGCATGCTCCAGGCACTGTGAGG - Intronic
1056277213 9:85005054-85005076 TGGGACCTTGAGGGACTGTGAGG + Intronic
1058654646 9:107208685-107208707 TCCTGCCTACAGTGACTGTGGGG - Intergenic
1060740346 9:126093738-126093760 TGCGCCCAGCAGGGAGTGTGAGG + Intergenic
1061679098 9:132233994-132234016 TGAGGCCTCCAGGGGCTATGAGG + Intronic
1062376502 9:136264153-136264175 TGCGTCCACCAGGGACGCTGTGG - Intergenic
1062562078 9:137146195-137146217 TGGGGCCTCCAGGGAGCGAGGGG - Intronic
1186901877 X:14065867-14065889 CGCGGACACCAGGGACTGGGAGG - Intergenic
1186927564 X:14352025-14352047 TGCTGTCTCTGGGGACTGTGGGG - Intergenic
1187802900 X:23084195-23084217 GGTGGTTTCCAGGGACTGTGGGG + Intergenic
1189049266 X:37627391-37627413 TGCTGACTCCAGGGTATGTGAGG + Intronic
1190050859 X:47147351-47147373 TGCTTCCTGCAGGGACTCTGGGG - Exonic
1190317762 X:49162792-49162814 TTCAGCCTCCAGGGCCTGGGCGG + Intronic
1193639353 X:83992930-83992952 GGTGGTTTCCAGGGACTGTGGGG + Intergenic
1194977459 X:100409170-100409192 TGCGCCCTCCGGGGTCTGGGGGG + Exonic
1196216363 X:113056675-113056697 TGGAGCCTCCAGGGACTTTGGGG + Intergenic
1198236552 X:134740874-134740896 TGCTTCCTCCAGGGGCTGTAGGG - Intronic
1199628798 X:149762168-149762190 TTAAGCCTCAAGGGACTGTGGGG - Intergenic
1200238221 X:154479337-154479359 TGGGGCCTCCAGGGACAAGGGGG - Intergenic
1200334494 X:155335331-155335353 TGATGCCTCCAGGGGCTGGGAGG + Intergenic
1200361436 X:155611384-155611406 TGATGCCTCCAGGGGCTGGGAGG - Intronic
1200835785 Y:7729826-7729848 TGCAGCCTCCTGGATCTGTGCGG + Intergenic