ID: 1160843986

View in Genome Browser
Species Human (GRCh38)
Location 19:1158689-1158711
Sequence CTGAGGTAATGCGGCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843986_1160843995 3 Left 1160843986 19:1158689-1158711 CCCTGGAGGCCGCATTACCTCAG 0: 1
1: 0
2: 0
3: 5
4: 164
Right 1160843995 19:1158715-1158737 AGGTTCTCCGGGCAGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144
1160843986_1160843990 -9 Left 1160843986 19:1158689-1158711 CCCTGGAGGCCGCATTACCTCAG 0: 1
1: 0
2: 0
3: 5
4: 164
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843986_1160843991 -8 Left 1160843986 19:1158689-1158711 CCCTGGAGGCCGCATTACCTCAG 0: 1
1: 0
2: 0
3: 5
4: 164
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1160843986_1160843997 21 Left 1160843986 19:1158689-1158711 CCCTGGAGGCCGCATTACCTCAG 0: 1
1: 0
2: 0
3: 5
4: 164
Right 1160843997 19:1158733-1158755 CAAGGCGCTCCCTGCGTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 168
1160843986_1160843993 -4 Left 1160843986 19:1158689-1158711 CCCTGGAGGCCGCATTACCTCAG 0: 1
1: 0
2: 0
3: 5
4: 164
Right 1160843993 19:1158708-1158730 TCAGCCGAGGTTCTCCGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843986 Original CRISPR CTGAGGTAATGCGGCCTCCA GGG (reversed) Intronic
900482113 1:2904424-2904446 CTGAGGCACTGCGGGCGCCAAGG - Intergenic
900520858 1:3104911-3104933 CGGAGGTAGGGTGGCCTCCAAGG + Intronic
901129736 1:6954825-6954847 CAGAGGGAAGGCGGCGTCCAAGG - Intronic
902186251 1:14727697-14727719 CTGAGGTAATCCGCCCACCACGG + Intronic
903815875 1:26064060-26064082 CTCAGGTAATGCGCCCGCCTTGG - Intronic
905091233 1:35432982-35433004 CTGAGCTCATGCTCCCTCCAGGG - Intergenic
907968914 1:59361499-59361521 CTGAGGAAATGAGACCTCCGTGG + Intronic
912281766 1:108322979-108323001 CTCAGGTAATCCGCCCTCCTTGG + Intergenic
912721958 1:112027954-112027976 CTGGGGTAATTGGCCCTCCAAGG - Intergenic
915269015 1:154739458-154739480 CTTAGGTAATCCTGCCTACATGG - Intronic
918344178 1:183591717-183591739 CTCAGGTGATTCGGCCTCCTCGG + Intronic
921228999 1:213050051-213050073 CTGAGGTAATCCGCCCGCCTCGG + Intergenic
924010037 1:239654630-239654652 CTCAGGTAATCCGCCCTCCTTGG + Intronic
924430116 1:243989505-243989527 CTGAGGTAGTAGGGCATCCAGGG + Intergenic
1070968155 10:80542627-80542649 CTCAGGTAATCCGCCCTCCTCGG + Intronic
1072147897 10:92658954-92658976 CTCAGGTAATCCGCCCTCCTTGG - Intergenic
1074633638 10:115288753-115288775 CTCAGGTAATCCGCCCACCATGG + Intronic
1076320918 10:129580747-129580769 CTGTGGTTATGGGGCATCCATGG - Intronic
1076327970 10:129643195-129643217 CTGAGGTTAAGCGTCCCCCATGG + Intronic
1077035245 11:491295-491317 CTGGGGTCATGCTGCCTCCGTGG + Exonic
1078405008 11:11062902-11062924 CCCAGCTAATGAGGCCTCCAGGG - Intergenic
1080752087 11:35160040-35160062 CAGGGGCAATGGGGCCTCCAAGG + Intronic
1081489070 11:43553428-43553450 GTGAGGTACTGCGGCAGCCAAGG - Intergenic
1081851299 11:46276995-46277017 CTCAGGTGATCCGGCCTCCTTGG - Intergenic
1083376242 11:62224276-62224298 TTCAGGTAATGCAGTCTCCATGG - Intergenic
1083809704 11:65096673-65096695 CTGAGGTGATGCGGCATCTGAGG + Intronic
1085533612 11:77205613-77205635 CTGAGGTACAGCGGCCACCAGGG + Exonic
1085747397 11:79126929-79126951 CTGAGCTGATGCTGACTCCAGGG + Intronic
1086383457 11:86284088-86284110 CTGAGGAAAAGCAGCTTCCACGG + Intergenic
1086740969 11:90368583-90368605 CTCAGGTGATCCGGCCTCCTCGG + Intergenic
1088103128 11:106176466-106176488 TTGAGGTAAAGCAGTCTCCATGG - Intergenic
1089541477 11:119191571-119191593 CTCAGGTAATCCGCCCTCCTCGG - Intronic
1092486388 12:8906116-8906138 TTCAGGTAAAGCAGCCTCCATGG + Intergenic
1097123100 12:56751517-56751539 CTCAGGTAATCCGTCCTCCTCGG + Intronic
1101109030 12:101467732-101467754 CTCAGGTGATCCGGCCGCCATGG - Intergenic
1102235698 12:111293284-111293306 CTGAGGACATGCGGCCCGCAGGG + Intronic
1102577788 12:113867433-113867455 CTGATGTGCTCCGGCCTCCAGGG + Intronic
1103523255 12:121550074-121550096 CTCAGGTAATCCGCCCTCCTCGG - Intronic
1104534467 12:129605945-129605967 CTGCTGTACTGTGGCCTCCAGGG + Intronic
1106369873 13:29121891-29121913 CTGAGGTGATCCGCCCTCCTCGG + Intronic
1108397530 13:50004840-50004862 CTCAGGTAATCCGCCCTCCTTGG - Intronic
1108684178 13:52804594-52804616 CTGAAGGCATGCGCCCTCCAAGG - Intergenic
1110653396 13:77969485-77969507 CTGAGGTAATGCATTCTGCATGG + Intergenic
1110850385 13:80238689-80238711 CTGAGGTGATCCGCCCTCCTTGG + Intergenic
1111630085 13:90839330-90839352 CTGAGCTCATGCTGCCTTCAGGG + Intergenic
1112589206 13:100748427-100748449 CTGGGGCAGTGTGGCCTCCATGG - Intergenic
1114148244 14:20004040-20004062 ATGAGGAAATGCGGGCTTCAAGG - Intergenic
1114243257 14:20889089-20889111 CTCAGGTAATGCGCCCACCTCGG - Intergenic
1114456055 14:22854297-22854319 CTCAGGTAATCCGCCCTCCTCGG + Intergenic
1116889792 14:50257160-50257182 CTCAGGTAATCCACCCTCCATGG + Intronic
1120405383 14:84088550-84088572 CAGAGGTAATGTGGGGTCCATGG - Intergenic
1120860645 14:89252419-89252441 CTCAGGTAATCCGCCCTCCTCGG - Intronic
1202931510 14_KI270725v1_random:40129-40151 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1123444841 15:20320718-20320740 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1126303423 15:47225761-47225783 CTCAGGTAATCCGCCCACCATGG + Intronic
1130933475 15:88449342-88449364 CTAAGGAGATGCTGCCTCCAGGG + Intergenic
1132949646 16:2553846-2553868 CTGAGGCTGTGCTGCCTCCATGG + Intronic
1132964702 16:2646321-2646343 CTGAGGCTGTGCTGCCTCCATGG - Intergenic
1133740058 16:8644673-8644695 CTGTGGGAAGGAGGCCTCCACGG - Exonic
1135678087 16:24434307-24434329 CTCAGGTAATCCGCCCTCCTCGG - Intergenic
1136721983 16:32328206-32328228 CTGAGGTAATCCGCCCACCTTGG + Intergenic
1136840307 16:33534169-33534191 CTGAGGTAATCCGCCCACCTTGG + Intergenic
1137432704 16:48431343-48431365 CTCAGGTAATCCGGCCACCTCGG - Intronic
1137861531 16:51851294-51851316 CTCAGGTTTTGCTGCCTCCAAGG + Intergenic
1139148308 16:64349228-64349250 CTGTAGTAATGCATCCTCCATGG + Intergenic
1139733895 16:68970922-68970944 CTGAGGTGATCCGCCCTCCTCGG - Intronic
1203004448 16_KI270728v1_random:189568-189590 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1203136058 16_KI270728v1_random:1725999-1726021 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1203150473 16_KI270728v1_random:1834462-1834484 CTGAGGTAATCCGCCCACCTTGG + Intergenic
1142736528 17:1903929-1903951 CTCAGGTGATCCGGCCTCCTCGG + Intergenic
1143127197 17:4650293-4650315 CTCAGGTGATGCGCCCTCCTCGG + Intergenic
1143211752 17:5193225-5193247 CTCAAGTGATGCGGCCTCCTAGG - Intergenic
1144697886 17:17317729-17317751 CTCAGGTGATTCGCCCTCCATGG - Intronic
1146394680 17:32454828-32454850 CTGATGTAATGAGGATTCCAGGG - Intronic
1150215548 17:63466925-63466947 CTCAGGTGATGCGCCCTCCTCGG - Intergenic
1152379882 17:79936973-79936995 CTGAGGCAAAGTGGCCTGCAGGG + Exonic
1152629194 17:81402174-81402196 GGGAGGAAATGGGGCCTCCAGGG - Intronic
1153368323 18:4284826-4284848 CTGAGGTAATGAAGGCACCAAGG + Intronic
1154063413 18:11084513-11084535 GTGAGGAAAGGGGGCCTCCATGG - Intronic
1160843986 19:1158689-1158711 CTGAGGTAATGCGGCCTCCAGGG - Intronic
1162812724 19:13174099-13174121 CTGAGGTAATTCAGCCGCCTCGG + Intergenic
1163565801 19:18050633-18050655 CTCAGGTAATCCGCCCTCCTCGG - Intergenic
1165876683 19:39012722-39012744 CTCAGGTGATCCGGCCTCCTCGG - Intronic
925153313 2:1632273-1632295 CTGAGACCATGAGGCCTCCAGGG + Exonic
927496314 2:23554040-23554062 CTGAGCTAATGGGGGCTCCATGG + Intronic
932740442 2:74286988-74287010 GTGAGGTAATGATGACTCCAGGG - Intronic
934462463 2:94225193-94225215 CTGAGGTAATCCGCCCACCTTGG - Intergenic
936278503 2:111119861-111119883 GTGAGGTGCTGCGGACTCCAGGG + Intronic
937291570 2:120785181-120785203 CTGAGGGCATGTGGCCTCCTGGG + Intronic
937361186 2:121231317-121231339 CTCAGGTACTGTGGTCTCCAGGG - Intronic
937866439 2:126754647-126754669 CTGAGTTAAGGTGCCCTCCAGGG + Intergenic
942933620 2:181527067-181527089 CTCAGGTGATGCGCCCTCCTCGG + Intronic
943647651 2:190424652-190424674 CTGAGGTAATTAGACATCCATGG - Intronic
945984169 2:216340835-216340857 CTGGGGTAGTGCAGCATCCAAGG - Intronic
948781066 2:240322254-240322276 GTGAGTTATTGCAGCCTCCAGGG - Intergenic
1172516485 20:35537922-35537944 CTCAGGTAATCTGGCCTCCTCGG + Intergenic
1174458013 20:50663186-50663208 CTGACGTGATTCTGCCTCCAAGG + Intronic
1176593539 21:8668282-8668304 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1177751296 21:25287412-25287434 CTAAGTTAATGCTGCTTCCAGGG + Intergenic
1178191066 21:30281784-30281806 CTGATGAAATGGGGCCTCCATGG - Exonic
1180128193 21:45806056-45806078 CTGAGTCATTGCTGCCTCCAGGG + Intronic
1180276383 22:10645410-10645432 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1180925424 22:19550456-19550478 CAGAGGTAAGGCAGGCTCCAGGG - Intergenic
1181353135 22:22275476-22275498 CTGAGGTAATCCGCCCACCTTGG + Intergenic
1183644729 22:39118135-39118157 CTGAGGTCATGCGACCTCCTTGG + Intergenic
1183805149 22:40203038-40203060 CTGAGCTAATGCAACCTGCAAGG - Intronic
951216539 3:20030522-20030544 CTGAGGTAATCCACCCTCCTGGG - Intergenic
951800078 3:26586057-26586079 ATGAGGTAATGCTGTCACCATGG - Intergenic
955029948 3:55206229-55206251 CAGAGGTCAAGTGGCCTCCAAGG + Intergenic
955682804 3:61519682-61519704 CTCAGGTAATCCGCCCTCCTTGG - Intergenic
956694038 3:71903563-71903585 CTCAGGTGATCCGCCCTCCATGG - Intergenic
957329868 3:78748210-78748232 CTCAGGTAATCCGCCCTCCTTGG - Intronic
961392109 3:126558344-126558366 CTGTGGTAATGCTGCTTCCCCGG - Intronic
963137646 3:141922417-141922439 CTCAGGTAATGCGCCCGCCTTGG - Intronic
963162099 3:142161334-142161356 CTCAGGTAATCCGTCCTCCTTGG + Intergenic
966373219 3:179270167-179270189 CTCAGGTTATGCTGCCTCCTTGG + Intergenic
966699228 3:182826948-182826970 CTCAGGCAATGAGGCCTCAATGG - Intronic
966865719 3:184258305-184258327 TTGAGATAAACCGGCCTCCAGGG - Intronic
966868647 3:184276287-184276309 CGGAGGTAAGGCTGCCTCCCGGG + Intronic
966890907 3:184406920-184406942 CTGAGGTGATCCGCCCTCCTCGG + Intronic
968509849 4:990817-990839 CTGAGGCCATGTGGCCTCCCAGG - Intronic
969342875 4:6553297-6553319 CACAGGTGATGCAGCCTCCAGGG + Intronic
970595573 4:17597185-17597207 CTGTGGTTATGTGGCCACCACGG - Intronic
972751862 4:41996798-41996820 CTGAGGTAATCCACCCTCCTTGG - Intronic
982527030 4:156491083-156491105 CTGAGTTAATGTGGATTCCAGGG + Intergenic
985567241 5:625419-625441 CAGAGGTCACGCAGCCTCCAGGG - Intronic
985912043 5:2892359-2892381 CTGAGGTGATGCGGACTCACAGG + Intergenic
991993533 5:72365029-72365051 CTGTGGTAATGCTGCCTCTGAGG - Intergenic
997593824 5:135092859-135092881 CTGAGGCAGTGAGGCCCCCAGGG - Intronic
1000302165 5:159966006-159966028 CTCAGGTAATCCGCCCTCCTTGG + Intronic
1001391684 5:171384591-171384613 CTCAGGTGATGCGCCCTCCTCGG + Intergenic
1003041048 6:2687569-2687591 CTGAGGTATTTGGGCCTTCAGGG - Intronic
1003092423 6:3115248-3115270 CTCAGGAAATGCGGCCTCAGTGG - Intergenic
1006976542 6:38107596-38107618 CTGAGGTAATCCGCCCACCTCGG - Intronic
1007483733 6:42166642-42166664 CCTTGGTAATGCAGCCTCCATGG + Intronic
1016965529 6:149715300-149715322 CTCAGGTAATCCGCCCTCCTTGG + Intronic
1018893593 6:167998816-167998838 CTCAGGTAATGCGCCCGCCTCGG - Intronic
1019428497 7:988110-988132 CTGGGGTCATGTGGCCTCCCTGG + Intronic
1022109046 7:27216744-27216766 CTGAGGGAATGCTTTCTCCAAGG + Intergenic
1034300034 7:150007238-150007260 CTGAGGAACTGAGGCTTCCAAGG + Intergenic
1034589805 7:152129334-152129356 CTGGAGAACTGCGGCCTCCATGG - Intergenic
1034806010 7:154090072-154090094 CTGAGGAACTGAGGCTTCCAAGG - Intronic
1035079669 7:156205425-156205447 CTCAGGTAATCCGCCCCCCACGG + Intergenic
1036616282 8:10390216-10390238 CTGAGGGGATGGGGCCTCCGTGG + Intronic
1045516696 8:102865992-102866014 CTCAGGTAATCCGCCCTCCTCGG - Intronic
1048084024 8:131158170-131158192 CTGAGCTAATGCTGATTCCAGGG - Intergenic
1049373291 8:142277820-142277842 CTGAGTTCCTGCAGCCTCCAGGG + Intronic
1050444242 9:5701975-5701997 CTCAGGAAATAAGGCCTCCAAGG + Intronic
1051710184 9:19923544-19923566 CTGCGGCAATGTGGCTTCCAAGG - Intergenic
1051971312 9:22890820-22890842 CTGAGTCAATGCTGCCACCATGG - Intergenic
1054271857 9:63034250-63034272 CTGAGGTAATCCGCCCACCTTGG + Intergenic
1054402963 9:64729084-64729106 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1054436586 9:65214574-65214596 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1054493812 9:65807420-65807442 CTGAGGTAATCCGCCCACCTTGG + Intergenic
1056105431 9:83342244-83342266 TTGAGGGAAGGAGGCCTCCAGGG - Intronic
1056850681 9:90081325-90081347 CTGATGTCATAAGGCCTCCACGG + Intergenic
1059186733 9:112280286-112280308 CTCAGGTAATGCGCCCACCTTGG + Intronic
1061876905 9:133548630-133548652 TTGAGATAATGCGACCCCCAGGG - Intronic
1062030602 9:134360246-134360268 CTCAGGCAGTGCAGCCTCCAGGG - Intronic
1062193290 9:135258654-135258676 CTGAGGTGATGCCGACTGCATGG + Intergenic
1062193295 9:135258682-135258704 CTGAGGTGATGCCGACTGCATGG + Intergenic
1203623673 Un_KI270749v1:148504-148526 CTGAGGTAATCCGCCCACCTTGG - Intergenic
1186169380 X:6860703-6860725 CTCAGGTAATCCGCCCTCCTCGG + Intergenic
1188689245 X:33108640-33108662 CTCAGGTAATCCGCCCTCCTGGG - Intronic
1190953233 X:55166571-55166593 CTGAGGTAATAAGGCAGCCATGG - Intronic
1192320129 X:70084034-70084056 CTGTGTGCATGCGGCCTCCAGGG - Intergenic
1195052995 X:101115195-101115217 CTCAGGTAATCCGCCCTCCTTGG + Intronic
1199767202 X:150949927-150949949 CTGAGACAATGCTCCCTCCATGG - Intergenic
1200135521 X:153872795-153872817 CTGTGGCCATGGGGCCTCCAGGG - Intronic
1201227657 Y:11833878-11833900 CTGAGGTAAAGCGGCTAACAAGG + Intergenic