ID: 1160843987

View in Genome Browser
Species Human (GRCh38)
Location 19:1158690-1158712
Sequence GCTGAGGTAATGCGGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843987_1160843997 20 Left 1160843987 19:1158690-1158712 CCTGGAGGCCGCATTACCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1160843997 19:1158733-1158755 CAAGGCGCTCCCTGCGTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 168
1160843987_1160843991 -9 Left 1160843987 19:1158690-1158712 CCTGGAGGCCGCATTACCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1160843991 19:1158704-1158726 TACCTCAGCCGAGGTTCTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 110
1160843987_1160843993 -5 Left 1160843987 19:1158690-1158712 CCTGGAGGCCGCATTACCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1160843993 19:1158708-1158730 TCAGCCGAGGTTCTCCGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 69
1160843987_1160843990 -10 Left 1160843987 19:1158690-1158712 CCTGGAGGCCGCATTACCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843987_1160843995 2 Left 1160843987 19:1158690-1158712 CCTGGAGGCCGCATTACCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1160843995 19:1158715-1158737 AGGTTCTCCGGGCAGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843987 Original CRISPR GCTGAGGTAATGCGGCCTCC AGG (reversed) Intronic
900590321 1:3456560-3456582 GCAGAGGGAATGTGGCCTGCGGG - Intronic
905038092 1:34930125-34930147 GCTGAGGTCAGGCGGCCGACCGG - Intergenic
907263815 1:53242041-53242063 ACTTAGGTAATGCCTCCTCCAGG - Intergenic
907491573 1:54812013-54812035 GCAGAGGTGATGAGGCCTGCAGG - Intronic
911657680 1:100463423-100463445 GCTGATGTGATGCTGCCTCATGG + Intronic
912567286 1:110597200-110597222 GCTGAGGGAATGTGGCCTGGAGG - Intronic
913611435 1:120513319-120513341 CCTGAGGCACTGCAGCCTCCTGG + Intergenic
914579757 1:149008920-149008942 CCTGAGGCACTGCAGCCTCCTGG - Intronic
915300413 1:154948262-154948284 GCTGAGGTGGGCCGGCCTCCCGG + Exonic
917843900 1:179004366-179004388 GCTTAGGTGCTGCTGCCTCCCGG + Intergenic
920654360 1:207864641-207864663 GCTGAGGAACTCAGGCCTCCAGG + Intergenic
921670022 1:217914868-217914890 ACTGGAGTAATGCTGCCTCCAGG + Intergenic
1064698124 10:17988616-17988638 GCTGAGGAGATGCAGCCTTCTGG - Intronic
1068523693 10:58105070-58105092 GGTGAGGTCATCGGGCCTCCAGG + Intergenic
1069069047 10:63975401-63975423 GCTGAGGTAATGCTGCTCCTGGG - Intergenic
1070812467 10:79305352-79305374 GCTCAGGTTATGGGGGCTCCAGG + Intronic
1076780761 10:132723306-132723328 AGAGAGGAAATGCGGCCTCCCGG - Intronic
1077467635 11:2741112-2741134 GCTCAGGCAGTGCTGCCTCCGGG + Intronic
1084739727 11:71131864-71131886 GGGGTGCTAATGCGGCCTCCCGG - Intronic
1085533611 11:77205612-77205634 CCTGAGGTACAGCGGCCACCAGG + Exonic
1101038098 12:100725284-100725306 GCTGAGGTAAAGCCTTCTCCTGG - Intronic
1102235697 12:111293283-111293305 GCTGAGGACATGCGGCCCGCAGG + Intronic
1103701757 12:122851743-122851765 GGATAGGTAATGGGGCCTCCTGG + Intronic
1104831885 12:131758054-131758076 GATGAGGTACTGCTGCCTCTGGG - Intronic
1117042590 14:51780373-51780395 GCGGGGGTGATGCGGCTTCCAGG + Intergenic
1128841686 15:70855538-70855560 GCTTAGGAAATGAGGTCTCCTGG + Intronic
1130933474 15:88449341-88449363 GCTAAGGAGATGCTGCCTCCAGG + Intergenic
1131267179 15:90923337-90923359 GCTGTGGTACTGAGGCCTCACGG + Intergenic
1131542988 15:93290031-93290053 GGAGAGGAAATGCAGCCTCCAGG - Intergenic
1134170048 16:11961254-11961276 GCTGAGGGAGTGGAGCCTCCTGG + Intronic
1136519418 16:30786592-30786614 GCGGCGGGAATGCGGCCGCCCGG + Intronic
1136777381 16:32879161-32879183 GCTGAGGTAAGGCTCCCTCCCGG - Intergenic
1136893244 16:33982352-33982374 GCTGAGGTAAGGCTCCCTCCCGG + Intergenic
1138078338 16:54064894-54064916 GCTAAGGTCATGCGGCTTCTTGG + Intronic
1141504239 16:84464118-84464140 GATGAGGAAATGGGGCCTCCAGG - Exonic
1142221731 16:88858285-88858307 GCTGAGGCAGAGTGGCCTCCAGG + Intronic
1203079794 16_KI270728v1_random:1141270-1141292 GCTGAGGTAAGGCTCCCTCCCGG - Intergenic
1147534131 17:41307729-41307751 GCTGAGCTGCTGCGGCCTCACGG + Exonic
1152073664 17:78146270-78146292 CCTGGGGTGCTGCGGCCTCCAGG + Intergenic
1152514670 17:80816348-80816370 GCTGAGGGCCTGGGGCCTCCGGG + Intronic
1152523048 17:80871523-80871545 GCTGAGGTCAGGCGTCCCCCGGG + Intronic
1152629195 17:81402175-81402197 GGGGAGGAAATGGGGCCTCCAGG - Intronic
1157271828 18:46282125-46282147 GCTGAGCTAAGGAGTCCTCCAGG - Intergenic
1160843987 19:1158690-1158712 GCTGAGGTAATGCGGCCTCCAGG - Intronic
1161418522 19:4161915-4161937 GCTGAAGTACTGCCTCCTCCGGG - Intronic
1162743872 19:12788637-12788659 GCTGAATTACTGTGGCCTCCTGG + Intronic
1164257918 19:23545382-23545404 GGTGAGGTAATGCTTCATCCTGG - Intronic
1164513808 19:28917703-28917725 GCTGAGGTTCTGTGGGCTCCTGG - Intergenic
1165451354 19:35885543-35885565 GCTGAGATAATGGAGCTTCCAGG - Intergenic
925190903 2:1882545-1882567 GATAAGGAAATACGGCCTCCTGG + Intronic
932740443 2:74286989-74287011 GGTGAGGTAATGATGACTCCAGG - Intronic
936481701 2:112890796-112890818 GCTGAGGTTCTGTGGCCTCTGGG - Intergenic
937061153 2:118981441-118981463 GCAGGGGTCATGGGGCCTCCTGG + Exonic
937291569 2:120785180-120785202 GCTGAGGGCATGTGGCCTCCTGG + Intronic
937361187 2:121231318-121231340 GCTCAGGTACTGTGGTCTCCAGG - Intronic
938252702 2:129827889-129827911 GCTGAGGGTCTGCTGCCTCCAGG + Intergenic
948408269 2:237739304-237739326 CCTGTGGTAAGTCGGCCTCCTGG + Intronic
1171063997 20:21995336-21995358 GCTCAGGCAATCCGCCCTCCTGG + Intergenic
1172893749 20:38285147-38285169 GATGAGGAACTGAGGCCTCCTGG - Intronic
1176327234 21:5511141-5511163 GATGCGGTAATGCTGCCTGCTGG + Intergenic
1176400523 21:6309810-6309832 GATGCGGTAATGCTGCCTGCTGG - Intergenic
1176436634 21:6679294-6679316 GATGCGGTAATGCTGCCTGCTGG + Intergenic
1176460896 21:7006364-7006386 GATGCGGTAATGCTGCCTGCTGG + Intergenic
1176484457 21:7388142-7388164 GATGCGGTAATGCTGCCTGCTGG + Intergenic
1179418163 21:41214973-41214995 GCTTTGGAAATGCGCCCTCCTGG - Intronic
1180875456 22:19173096-19173118 GCTGTGGGACTGAGGCCTCCAGG - Intergenic
1181633807 22:24165096-24165118 GCTGACGGAGTGAGGCCTCCAGG - Intronic
1183991552 22:41600376-41600398 GCTGAGGAAAGGCAGCCTCGGGG + Exonic
951216540 3:20030523-20030545 CCTGAGGTAATCCACCCTCCTGG - Intergenic
951868058 3:27329440-27329462 GCTGTGGAAATGCGGCTCCCAGG + Intronic
955006042 3:54969839-54969861 GATGAGGTAAGACGGCCTCCTGG + Exonic
966868646 3:184276286-184276308 GCGGAGGTAAGGCTGCCTCCCGG + Intronic
966956777 3:184888867-184888889 GATGAAGTAATTCTGCCTCCTGG + Intronic
967404484 3:189100284-189100306 GCTGAGGCAATTTGGCCTTCAGG - Intronic
967988202 3:195111779-195111801 ACTGAGGTAATCCAGCCTCAAGG - Intronic
975457567 4:74609996-74610018 CCTCAGGTGATGCGCCCTCCTGG + Intergenic
977689346 4:99887954-99887976 GCTGATGTATTACTGCCTCCAGG - Intronic
1004044283 6:12011324-12011346 GCTGACGTCATGGGGTCTCCCGG - Intronic
1007470736 6:42088628-42088650 GCTGAGGCAAGGAGGCCTCAGGG - Intergenic
1007527877 6:42512610-42512632 GCTGAGCTACTGCTGCCTCATGG + Intergenic
1015115770 6:129647831-129647853 GATGAGATAATGAGGCCTCAAGG + Intronic
1018060581 6:160086774-160086796 GCTGAGGTACTGAGGGCTGCTGG - Intronic
1022113466 7:27244892-27244914 GCTAGGGTACTGCGGCCTCTGGG - Intronic
1023372578 7:39526937-39526959 GGTGAGGAACTGAGGCCTCCAGG + Intergenic
1026596164 7:71735806-71735828 GCTGAGGTCATGAGCCATCCAGG + Intergenic
1031963759 7:128012548-128012570 GCTGAGGGCATGTGGACTCCTGG - Intronic
1032304555 7:130720515-130720537 CCTCAGGTAATTCGCCCTCCTGG + Intergenic
1039215023 8:35260221-35260243 GCTGAGGTAATGGGGCTGGCTGG - Intronic
1047509069 8:125502439-125502461 GCTGGGTTAAAGCGGCCCCCAGG - Intergenic
1049069338 8:140344916-140344938 GCTGAGGCAGTGAAGCCTCCAGG + Intronic
1057410313 9:94811750-94811772 GCTGAGGAGATGCCGCCTCTGGG - Intronic
1057432251 9:95004986-95005008 CCTGAGGTGATGCGGACCCCGGG + Intronic
1061010273 9:127950568-127950590 GCTGAGGGAGTGTGGGCTCCTGG + Intronic
1062030603 9:134360247-134360269 GCTCAGGCAGTGCAGCCTCCAGG - Intronic
1062592754 9:137281420-137281442 GCAGAGGTCCTGCGGCTTCCCGG + Exonic
1203434880 Un_GL000195v1:129365-129387 GATGCGGTAATGCTGCCTGCTGG - Intergenic
1187045850 X:15647001-15647023 GCTGAGGATATGTGGCCGCCAGG + Intronic
1187547868 X:20269402-20269424 GCTCAGGTAATCCGCCCACCTGG - Intergenic
1188689246 X:33108641-33108663 CCTCAGGTAATCCGCCCTCCTGG - Intronic
1192266472 X:69542086-69542108 GCTGGGGTACTGCAGACTCCAGG - Intergenic
1200102473 X:153694884-153694906 GCTGAGGTAAGGCTCCCGCCCGG + Exonic