ID: 1160843990

View in Genome Browser
Species Human (GRCh38)
Location 19:1158703-1158725
Sequence TTACCTCAGCCGAGGTTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160843978_1160843990 28 Left 1160843978 19:1158652-1158674 CCGTGGTGATGGAGCCCGGCAGA 0: 1
1: 0
2: 2
3: 14
4: 128
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843987_1160843990 -10 Left 1160843987 19:1158690-1158712 CCTGGAGGCCGCATTACCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843981_1160843990 13 Left 1160843981 19:1158667-1158689 CCGGCAGAGGCCACCGCACAGTC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843986_1160843990 -9 Left 1160843986 19:1158689-1158711 CCCTGGAGGCCGCATTACCTCAG 0: 1
1: 0
2: 0
3: 5
4: 164
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843984_1160843990 3 Left 1160843984 19:1158677-1158699 CCACCGCACAGTCCCTGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843980_1160843990 14 Left 1160843980 19:1158666-1158688 CCCGGCAGAGGCCACCGCACAGT 0: 1
1: 0
2: 0
3: 24
4: 225
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1160843985_1160843990 0 Left 1160843985 19:1158680-1158702 CCGCACAGTCCCTGGAGGCCGCA 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160843990 Original CRISPR TTACCTCAGCCGAGGTTCTC CGG Intronic
901171317 1:7259820-7259842 TTCCCTCAGCCTTTGTTCTCTGG + Intronic
909434230 1:75621761-75621783 TCACCTCAGCTGAGGTTTTTAGG + Intergenic
910738955 1:90494522-90494544 TTACCACAGCTGATGCTCTCTGG - Intergenic
914346102 1:146799628-146799650 TTACCACAGCTGATGGTCTCTGG + Intergenic
914703421 1:150152941-150152963 TGACCTCAGCCTAGGATATCTGG + Intronic
916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG + Intergenic
918110655 1:181452557-181452579 CTACCTCAGCCAGGGCTCTCAGG + Intronic
921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG + Intergenic
924321382 1:242854652-242854674 TTACCACAGCTGATGCTCTCTGG - Intergenic
1063381684 10:5589841-5589863 TTATCACAGCCGAGGTTGTTCGG + Intergenic
1064908106 10:20370016-20370038 TTACCACAGCTGATGCTCTCCGG - Intergenic
1065163947 10:22954957-22954979 TTACATCAGCTTTGGTTCTCTGG - Intronic
1066062641 10:31737614-31737636 TTACCTCAGCAGCAGTTTTCAGG + Intergenic
1071164225 10:82786055-82786077 TTTCCTCAGTGGAGGCTCTCCGG - Intronic
1073576554 10:104630942-104630964 TTACGTCCGCCGTGGTGCTCCGG + Intergenic
1074350083 10:112728110-112728132 TTACCTCAGGAAAGTTTCTCAGG + Intronic
1079273679 11:19013392-19013414 CTACCACAGCTGATGTTCTCTGG - Intergenic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1085482468 11:76834127-76834149 TCCCCTCAGCCTAGGTTCACTGG + Intergenic
1085747856 11:79129876-79129898 CTACCACAGCTGAGGCTCTCTGG + Intronic
1093306429 12:17526706-17526728 TTACATCTGCTGAGGTGCTCAGG - Intergenic
1099758509 12:86887744-86887766 TTACCTCAGCTGACTTTCTAAGG - Intergenic
1101477526 12:105064733-105064755 TTGACTCAGCCCAGGCTCTCAGG - Intronic
1103393644 12:120591657-120591679 TTAACTCAGCCCAGGTGGTCAGG + Intergenic
1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG + Intergenic
1110661171 13:78060794-78060816 ATACCACAGCTGATGTTCTCTGG - Intergenic
1115265201 14:31493269-31493291 TTACCACAGCTGATGCTCTCTGG + Intronic
1115835462 14:37397490-37397512 TTACCACAGCTGATGCTCTCTGG - Intronic
1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG + Intergenic
1126351170 15:47746241-47746263 GTGCCTCATCAGAGGTTCTCAGG - Intronic
1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG + Intergenic
1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG + Intronic
1136075026 16:27811387-27811409 TTCCATCAGCAGAGGTGCTCAGG + Intronic
1138585896 16:57970300-57970322 TTAGCTCAGCCCTGGCTCTCGGG - Intronic
1139987877 16:70915639-70915661 TTACCACAGCTGATGGTCTCTGG - Intronic
1146595216 17:34162471-34162493 GTAACTCAGCCAAGATTCTCTGG - Intronic
1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG + Intronic
1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG + Intergenic
1155906527 18:31458740-31458762 TTCCCTCAGGCGAGGCTCTGTGG - Intronic
1160765117 19:804209-804231 GTACCTGAGCCGCGTTTCTCCGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG + Intronic
1162141153 19:8586292-8586314 ATACCTGGGCTGAGGTTCTCTGG - Intronic
1163572635 19:18091303-18091325 TTATCTCAGACGAGCTTCTGGGG - Intronic
1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG + Intronic
928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG + Intergenic
930476242 2:51886214-51886236 GTACCTGAGCCGAAGTTCTAGGG - Intergenic
937348635 2:121144282-121144304 TTGCCTCAGGCGAAATTCTCAGG - Intergenic
944209858 2:197195701-197195723 TTACATCCGCAGAGGTTCTGTGG - Intronic
945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG + Intergenic
946581524 2:221133390-221133412 TTACCTCTGTCTAGGTTGTCAGG + Intergenic
948308823 2:236969969-236969991 TAACCACAGACGAGGTCCTCAGG + Intergenic
1178301710 21:31458784-31458806 CTACTTCAGCTTAGGTTCTCAGG + Intronic
1183551488 22:38489450-38489472 TTACCCGAACCCAGGTTCTCCGG - Intronic
1185208364 22:49553093-49553115 GTACCTCAGACGAGGCTCCCAGG - Intronic
954922579 3:54204373-54204395 TTATATTAGCCAAGGTTCTCCGG - Intronic
958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG + Intronic
959317929 3:104832942-104832964 TCAGCTCAGCCGAGCTTCTCTGG - Intergenic
960161232 3:114352128-114352150 CTACCTCAGCCGAAGCTCTGGGG - Intronic
961551163 3:127671391-127671413 TTTCCTCAGCTGAGGTCCTGGGG - Intronic
965874348 3:173299287-173299309 GTACCACAGCTGATGTTCTCTGG - Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG + Intergenic
975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG + Intergenic
983841722 4:172465036-172465058 TTTCCTCGGCTGAGGTTCTTTGG + Intronic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
989189444 5:38655713-38655735 TTAACTCAGTCTAGCTTCTCTGG - Intergenic
990676764 5:58195433-58195455 TCCCCACAGCAGAGGTTCTCTGG - Intergenic
990696106 5:58419515-58419537 TTACCTTAGTCTAGGTTCTTGGG - Intergenic
992560311 5:77945876-77945898 TGACCTCAGCCCAGGGTCTGGGG + Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
993671563 5:90766797-90766819 ATACTCCAGCCAAGGTTCTCAGG - Intronic
994222147 5:97208514-97208536 CTACCACAGCTGAGGCTCTCTGG - Intergenic
994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG + Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG + Intergenic
1001260363 5:170223208-170223230 GTCCCTAAGCCTAGGTTCTCAGG - Intergenic
1004141641 6:13023513-13023535 TAACCTCAGCAGAGGCTCTTGGG + Intronic
1007998510 6:46334502-46334524 TTACCTCAGCCTCCCTTCTCAGG - Intronic
1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG + Exonic
1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG + Intronic
1019675130 7:2306932-2306954 TTACCTAACCTGAGTTTCTCCGG + Intronic
1029104829 7:98166319-98166341 TGATTTCAGCAGAGGTTCTCTGG + Intronic
1030322280 7:108181870-108181892 GTACCTTAGCCGAGGTGCACTGG - Exonic
1039095513 8:33880725-33880747 TTACCACAGCTGATGCTCTCTGG - Intergenic
1039583033 8:38682420-38682442 TTACTTCAGCTGTGGTTCTGAGG - Intergenic
1041246513 8:55893889-55893911 TCACTTCAGCCCAGGATCTCAGG - Intronic
1042563337 8:70090113-70090135 ATTCCTCAGCAGAGGTCCTCGGG - Intergenic
1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG + Intergenic
1043149913 8:76702937-76702959 TTACAGTAGCTGAGGTTCTCAGG + Intronic
1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG + Intergenic
1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG + Intronic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1060400886 9:123349059-123349081 TTAGCTCTGCCACGGTTCTCTGG + Intergenic
1188723541 X:33551975-33551997 TTAGCACAGCAGAGCTTCTCTGG - Intergenic
1196276308 X:113769375-113769397 CTTCCTCAGCGGAGTTTCTCAGG - Intergenic
1196862360 X:120040193-120040215 TTATCTCAGCCGAGGTGATGGGG + Intergenic
1196880742 X:120196151-120196173 TTATCTCAGCCGAGGTGATGGGG - Intergenic