ID: 1160844543

View in Genome Browser
Species Human (GRCh38)
Location 19:1160585-1160607
Sequence CAGTGAGCCGAGACCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160844543_1160844550 25 Left 1160844543 19:1160585-1160607 CCACTGGGGGTCTCGGCTCACTG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 1160844550 19:1160633-1160655 GATTTTTGTGCCTCAGCTTCTGG 0: 1
1: 10
2: 131
3: 780
4: 4394
1160844543_1160844544 -6 Left 1160844543 19:1160585-1160607 CCACTGGGGGTCTCGGCTCACTG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 1160844544 19:1160602-1160624 TCACTGCAGCCTTCGCCTCCTGG 0: 115
1: 4023
2: 56179
3: 183809
4: 167964
1160844543_1160844545 -5 Left 1160844543 19:1160585-1160607 CCACTGGGGGTCTCGGCTCACTG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 1160844545 19:1160603-1160625 CACTGCAGCCTTCGCCTCCTGGG 0: 68
1: 2484
2: 36118
3: 149938
4: 261479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160844543 Original CRISPR CAGTGAGCCGAGACCCCCAG TGG (reversed) Intronic
900626123 1:3609469-3609491 CTGTGAGCAGAGGCCTCCAGTGG + Intronic
900815735 1:4842714-4842736 CATTGAGCTGAGAAGCCCAGTGG + Intergenic
901021487 1:6258183-6258205 CAGTGAGCCGAGATCCACCCTGG - Intronic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
901497224 1:9629096-9629118 CAGTGGCCCGAGACCCCCAGGGG - Intergenic
901639584 1:10686576-10686598 CAGTGAGCTGAGACGGCCTGGGG - Intronic
902761099 1:18581301-18581323 CAGTGAGTGGGGACCCTCAGGGG - Intergenic
904013833 1:27405654-27405676 CAGTGAGCCGAGAGGCCCTCTGG - Exonic
904755213 1:32765226-32765248 CTGTGGGCAGAGGCCCCCAGAGG - Intronic
907002302 1:50873732-50873754 CAGTGTGCCGAGAGCCCTTGTGG - Intronic
909216795 1:72900539-72900561 CAGTGAGCCGAGATCCCGCCTGG - Intergenic
909441068 1:75696843-75696865 CAGTGAGCCGAGATCCAGACTGG + Intergenic
910686934 1:89927142-89927164 TAGTGAGGGGAGACCACCAGAGG + Intronic
910900042 1:92110598-92110620 CAGTGAGCCGAGATCCCAGATGG - Intronic
912145610 1:106790778-106790800 CACTGAACCGATAGCCCCAGAGG - Intergenic
912160084 1:106972165-106972187 CAGTGAGAGGAGACCAACAGGGG - Intergenic
913279260 1:117170359-117170381 CATTGATCCCAGAGCCCCAGGGG - Intronic
914770342 1:150678239-150678261 CAGTGAGCCGAGATCGCCTTGGG + Intronic
916066638 1:161141253-161141275 CGGTGAGCTGAGGCCCCCGGAGG + Intergenic
916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG + Exonic
918217461 1:182404945-182404967 CTGTGTGCTGACACCCCCAGTGG + Intergenic
919750071 1:201032024-201032046 CAGAGAGCAGAGACTACCAGAGG + Intergenic
922522316 1:226265734-226265756 CAGTGAGCCGAGATCACAAGTGG - Intronic
1064012627 10:11746875-11746897 CAGTGAGCCGAGATCTATAGAGG + Intronic
1065909209 10:30286862-30286884 CTGTGACCCCAGAGCCCCAGAGG + Intergenic
1069873519 10:71547625-71547647 CAGTGAGCCGGTCCCCGCAGGGG + Intronic
1070201151 10:74207575-74207597 CAGTGAGATGAGACCCCGAGGGG + Intronic
1070402071 10:76061729-76061751 CTGGAAGCCCAGACCCCCAGGGG - Intronic
1077372973 11:2192320-2192342 CAGTGAACTGAGACCCCCTCGGG - Intergenic
1077403040 11:2368408-2368430 CAGGGAGAGGAGACCCTCAGTGG + Intergenic
1077541562 11:3148998-3149020 CAGAGAGCATGGACCCCCAGAGG + Intronic
1079231104 11:18649505-18649527 CAGTGAGCCAAGGCCACCACTGG + Intergenic
1085197677 11:74682298-74682320 CAGTGAGCCTGGGCCCCCATCGG + Intergenic
1089700632 11:120241865-120241887 CAGAGAGCAGAGAACACCAGAGG + Intronic
1089752134 11:120659531-120659553 CACTGAGCCGAGACACAGAGGGG + Intronic
1090425863 11:126606691-126606713 CAGTGAGGGGAGAGACCCAGGGG + Intronic
1090491186 11:127162332-127162354 CATTGAGCTAAGAACCCCAGGGG + Intergenic
1092108038 12:5937899-5937921 CATGTAGCTGAGACCCCCAGGGG - Intronic
1092620987 12:10268217-10268239 CAGTGAGCCGAGATATTCAGTGG + Intergenic
1092865515 12:12757309-12757331 CAGTGGGCCGATACCCCCAGAGG - Intronic
1094851703 12:34385200-34385222 CTGTGGGCCGAGGCCCTCAGTGG + Intergenic
1098010540 12:66046150-66046172 CTTTCAGCCCAGACCCCCAGAGG + Intergenic
1098067163 12:66630671-66630693 CAGTGAGCAGAGACTCAGAGTGG + Intronic
1099313881 12:81061597-81061619 CACTGAGACGAAACCTCCAGAGG - Intronic
1100009432 12:89935879-89935901 CAGTGAGCCGAGACTCACGATGG - Intergenic
1102442673 12:112975459-112975481 CAGTGAGCCTAGCTCCCAAGGGG - Intergenic
1103239916 12:119404502-119404524 CTCTGAGCTGGGACCCCCAGAGG + Intronic
1104972141 12:132535690-132535712 CACTGAGCAGAGACCCAGAGGGG + Intronic
1111163966 13:84432903-84432925 CAGTGAGCCAAGATCGCCACTGG + Intergenic
1111625693 13:90782996-90783018 CAGTGTGCAGAGACAACCAGTGG - Intergenic
1112439408 13:99415381-99415403 AAGTGACCCGGGAGCCCCAGGGG + Intergenic
1113789760 13:113022097-113022119 CAGAGACCGGGGACCCCCAGAGG - Intronic
1117164012 14:53016177-53016199 CAGTGAGCCGAGACCGCGCCTGG - Intergenic
1121127417 14:91417344-91417366 CAGCCAGCCTAGAGCCCCAGCGG + Intronic
1121719702 14:96100713-96100735 CAGTGAGCCAGGACCAGCAGGGG + Intergenic
1122392591 14:101400291-101400313 CAGTGAGCGGACACCACCTGTGG + Intergenic
1122441879 14:101737517-101737539 CACTGGGAGGAGACCCCCAGTGG - Intergenic
1122662308 14:103305257-103305279 CATTGAGCCAAGACCCCCACCGG - Intergenic
1122927896 14:104917208-104917230 CACTGAGGCGAGACCCTCACCGG - Intergenic
1122999661 14:105286522-105286544 CACTGAGCCAGGAACCCCAGTGG + Intronic
1124626792 15:31312346-31312368 CAGTGAGCAGAGCTCACCAGGGG - Intergenic
1126083578 15:44989029-44989051 CAGTGAGCAGGAAACCCCAGGGG + Intergenic
1127268021 15:57376640-57376662 CAGGGCGGCGGGACCCCCAGGGG + Intronic
1130484701 15:84392251-84392273 CAGCGGGCCGAGCCCCACAGCGG + Intergenic
1132838210 16:1965244-1965266 CGGTGAGCTGAGGCCCCCGGGGG - Intergenic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1135495876 16:22950710-22950732 CAGTGAGCCAAGATCGCCACTGG + Intergenic
1136592151 16:31224066-31224088 CAGTGAGCAGAGATGCCAAGAGG + Intronic
1140457837 16:75115057-75115079 CAGCCAGACCAGACCCCCAGAGG + Intronic
1141784330 16:86188461-86188483 CAGTGAGCCCAGACCTGAAGGGG - Intergenic
1142243310 16:88956873-88956895 CAGGCAGCTGAGAACCCCAGGGG - Intronic
1142892960 17:2957164-2957186 CATTGAACCGAGGCCTCCAGGGG - Intronic
1151653047 17:75481696-75481718 CAGTGAGACGAGGCAGCCAGGGG + Intronic
1152567860 17:81108141-81108163 CAGGGAGCCGAGGCCCCCGCAGG - Intronic
1154237954 18:12623979-12624001 CAGTGAGCCGAGACCACTCCAGG - Intronic
1155779859 18:29817695-29817717 CAGTGAGCCGAGATCACCCACGG - Intergenic
1159043888 18:63350060-63350082 ATGTGAGCTAAGACCCCCAGTGG - Intronic
1160190652 18:76711794-76711816 CAGTGAGCACAGACACCCAGAGG - Intergenic
1160844543 19:1160585-1160607 CAGTGAGCCGAGACCCCCAGTGG - Intronic
1160860536 19:1235613-1235635 CAAAGAGCCGAGACCCACTGTGG - Intronic
1160959979 19:1716378-1716400 AAGGGAGGCGAGACTCCCAGAGG - Intergenic
1162949417 19:14061844-14061866 CTGGGAGCCGAGAGCTCCAGTGG - Intergenic
1165216673 19:34279361-34279383 CAGTGAGCCGAGATCGCAATGGG - Intronic
1167286921 19:48603576-48603598 CAGCGCGCCCGGACCCCCAGCGG - Exonic
925082298 2:1079998-1080020 CAGGGTGCAGAGACCCCAAGTGG - Intronic
927890178 2:26743264-26743286 AAGTCAGCCGAGGTCCCCAGGGG + Intergenic
928035239 2:27816654-27816676 CAGTGAGCCGAGACCAGCCTGGG - Intronic
928396681 2:30947990-30948012 CAGTGGCCCAAGAGCCCCAGAGG - Intronic
929190471 2:39135003-39135025 CAGTGAGCCGAGATCCCGCCAGG + Intergenic
931975945 2:67644412-67644434 CAGTGAGAAGAGACCACCATGGG + Intergenic
932434460 2:71695043-71695065 AGGGGAGCCGAGGCCCCCAGGGG + Intergenic
933906172 2:86895502-86895524 CAGTGAGCCGAGATCACCCTGGG - Intergenic
934951469 2:98578604-98578626 CACTGAGCCCAGACCCGCAAGGG + Intronic
935270986 2:101434503-101434525 CAGTGAAGCTTGACCCCCAGTGG - Intronic
940145785 2:150542748-150542770 CAGTGGGCCGAGACCGCTGGGGG + Intergenic
940346137 2:152630950-152630972 CTGTGATCCAAGACCCCCAGTGG + Intronic
940853122 2:158706954-158706976 CTATGAGCAGAGACCCCCATGGG + Intergenic
941755802 2:169184451-169184473 CAGTCAGCCCAGACCTCCAGAGG - Intronic
942202359 2:173583968-173583990 GAGGGAACCGAGACCCACAGAGG + Intergenic
944413395 2:199462828-199462850 CGGTGAGCCTAGCACCCCAGAGG + Intronic
948643207 2:239388274-239388296 CAGCGAGCGGAGAGCCACAGTGG - Intronic
948751774 2:240137176-240137198 CACTCAGCCGAGGCCCCTAGAGG + Intergenic
1168877464 20:1181337-1181359 CAGTGAGGAGACACCCCCAGGGG + Exonic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171419211 20:25006604-25006626 CAGTGAGCCGGGTCCCTTAGGGG - Exonic
1172313696 20:33937221-33937243 CAGTGAGCCGAGTTCTACAGCGG - Intergenic
1173556471 20:43969659-43969681 CAGTGAGCAGAGGCCCTGAGTGG - Intronic
1174102925 20:48140726-48140748 CAATGACCAGAGACCCTCAGGGG - Intergenic
1175987578 20:62771589-62771611 GAGACAGCAGAGACCCCCAGAGG - Intergenic
1176151107 20:63591373-63591395 CAGTAAGCACAGACCCCAAGAGG + Intronic
1176653596 21:9571108-9571130 CAGTGAGCACAGACCCTGAGTGG - Intergenic
1178790720 21:35697483-35697505 CAGTGAGCCCAGAACCACTGTGG - Intronic
1178992431 21:37366952-37366974 CAGAGAGCGGACACCCCGAGCGG + Intronic
1179644984 21:42770264-42770286 CTGTGAGCCCAGATCCCCGGGGG - Intronic
1180046135 21:45306626-45306648 CATGGAGCCCAGACCCCCACCGG + Intergenic
1181030128 22:20145590-20145612 CAGTGAGCCGACTTCCCCATGGG - Intronic
1183213577 22:36465509-36465531 CAGAGAGGCCAGACCCCCACTGG + Intergenic
1184449458 22:44574464-44574486 CAGTGAGCCGAGATCACTGGGGG + Intergenic
1185064254 22:48622852-48622874 CACACAGCCGAGACCTCCAGGGG - Intronic
949365877 3:3280098-3280120 CAGAGACCCGAGTCCCCCATGGG + Intergenic
952075510 3:29692037-29692059 CAGTGAGCCGAGATCCCAGGAGG - Intronic
952474352 3:33691168-33691190 CTGTGTTCCAAGACCCCCAGTGG - Intronic
953271424 3:41448973-41448995 CAGTGAGCCGAGAAACCAGGAGG - Intronic
953774303 3:45802400-45802422 CATTGGACCAAGACCCCCAGGGG - Intergenic
954450481 3:50568964-50568986 CAGTGGCCCGAGCCCACCAGGGG - Intronic
958086874 3:88820978-88821000 CAGTGAGCTGAGATCCCATGAGG + Intergenic
959505443 3:107151820-107151842 GAGTGAGCCAAGGCCCCAAGAGG - Intergenic
961885857 3:130095960-130095982 CAGTGAGGCAACACCCCCCGAGG - Intronic
965804900 3:172532009-172532031 CAGTGAGCCGAGATCGCGAGTGG - Intergenic
974310507 4:60202508-60202530 CTGTGAGCTGAGACCTACAGAGG - Intergenic
981652926 4:147079447-147079469 CACTGGGCAGAGACCCTCAGTGG + Intergenic
985318980 4:188687857-188687879 CACTGAGCCGATAGCCCCAGCGG - Intergenic
985565052 5:611533-611555 GAGTGAATCCAGACCCCCAGGGG - Intergenic
987796856 5:22638991-22639013 CAGTGAGCCGAGATCCCGCCAGG + Intronic
992838881 5:80668042-80668064 CATTGAGGGGAGACCCGCAGTGG + Intronic
996523310 5:124450991-124451013 CAGTGAGAAGAGGCCACCAGGGG - Intergenic
997375133 5:133392308-133392330 CTGTGAGAAGAGAGCCCCAGGGG + Intronic
999263810 5:150253619-150253641 CTGTGAGCCCAGGCCCCTAGAGG - Intronic
1002053392 5:176584620-176584642 CTGAGAACCCAGACCCCCAGGGG + Exonic
1002149363 5:177214755-177214777 CAGTGAGCCGAGAACCCACGAGG - Intronic
1003054013 6:2803024-2803046 CATAGAGGGGAGACCCCCAGGGG + Intergenic
1003283385 6:4713085-4713107 CAGTGAGCCGTGACCACATGAGG + Intronic
1003624287 6:7727823-7727845 CTGCGCGCCGAGGCCCCCAGAGG + Intronic
1007402007 6:41608080-41608102 GAGAGAGAGGAGACCCCCAGAGG + Intergenic
1010015777 6:71103913-71103935 CAGTGAGTTGACAGCCCCAGGGG - Intergenic
1012812935 6:103983925-103983947 CAGGGATCCAAGATCCCCAGTGG + Intergenic
1013195803 6:107844639-107844661 CAGTGAGCCTATAGTCCCAGTGG + Intergenic
1015631406 6:135235646-135235668 CATTCATCCGGGACCCCCAGAGG + Intergenic
1016939576 6:149473247-149473269 AAGTGAGCCCAAATCCCCAGGGG + Intronic
1018016744 6:159719468-159719490 CAGTGAGCCGAGATCGGGAGAGG + Intronic
1018963171 6:168463129-168463151 CAGTGAGCCTGAGCCCCCAGTGG - Intronic
1019707283 7:2502708-2502730 CAGGGAGCCGAGAGCCCTGGTGG - Intergenic
1023599233 7:41865182-41865204 CAGTGATCCCAGAGCCCCATAGG + Intergenic
1023883612 7:44335396-44335418 CAGTGGGCCCAGACCCTCACAGG + Intergenic
1026593083 7:71712929-71712951 CAGGGAGCCCTGACTCCCAGAGG + Exonic
1027708556 7:81567400-81567422 CTGTGACCCCAGAGCCCCAGAGG - Intergenic
1029590289 7:101502733-101502755 CTGTGAGCTGAGACTCCCATGGG - Intronic
1032243000 7:130180424-130180446 CAGTGAGCCGAGATCGTCTGGGG - Intronic
1032499914 7:132392561-132392583 CAGGTAGCCGAGTGCCCCAGAGG + Intronic
1039579301 8:38650967-38650989 CAGGGAGCCGGGACCCACCGCGG - Intergenic
1042843257 8:73146112-73146134 CAGTGAGCCCAGACACCAAAAGG + Intergenic
1044291077 8:90471268-90471290 CATTGAGCAGAGATCCTCAGAGG + Intergenic
1045139126 8:99259890-99259912 GAGTGAGCAGAAACCGCCAGTGG + Intronic
1046140466 8:110083781-110083803 CACTCAGAGGAGACCCCCAGTGG - Intergenic
1047467668 8:125133684-125133706 CAGTGAGCCGAGATCACGACTGG + Intronic
1047516499 8:125559149-125559171 CAGGGTTCCGAGACCCTCAGTGG + Intergenic
1048741930 8:137570943-137570965 CAGTGAGCCGAGATCACCCCAGG - Intergenic
1048846299 8:138606360-138606382 CGGTAAGCAGAGAACCCCAGTGG - Exonic
1049012582 8:139897275-139897297 CAGTGAGCCGTGAGGTCCAGGGG + Intronic
1049950272 9:636807-636829 CAGTGAGCCGAGATTGCCATTGG + Intronic
1050351004 9:4741224-4741246 AAGTGAGCCGACAGCCCCTGGGG + Exonic
1053310355 9:37014425-37014447 CTGAGAGCCCAGAACCCCAGTGG - Intronic
1056729207 9:89150222-89150244 CAATGTTCCAAGACCCCCAGTGG - Intronic
1057046977 9:91893503-91893525 CCGTGAGGCGTGTCCCCCAGTGG - Intronic
1057768036 9:97940797-97940819 CAGTGAGCCAAGCCTCCCACCGG - Intronic
1060186427 9:121566765-121566787 CGGGGAGCCCAGCCCCCCAGGGG - Intergenic
1061614139 9:131768347-131768369 CAGTGAGCCGAGATCACACGTGG - Intergenic
1062005102 9:134235041-134235063 CTGTGAGCTGAGAGCCCCCGAGG + Intergenic
1062070297 9:134551892-134551914 CAGGGAGCCCAGACTCCCCGTGG + Intergenic
1062401313 9:136373881-136373903 GAGACAGCAGAGACCCCCAGGGG + Intergenic
1203631316 Un_KI270750v1:74555-74577 CAGTGAGCACAGACCCTGAGTGG - Intergenic
1185620924 X:1451742-1451764 GAGTAAGCCGAGACCCCCCTAGG - Intronic
1187637830 X:21251751-21251773 CAGTGAGACCTGAGCCCCAGAGG + Intergenic
1191617291 X:63182782-63182804 CCGTGAGCTGACACCCCCATGGG + Intergenic
1191619007 X:63196141-63196163 CCGTGAGCTGACACCCCCATGGG - Intergenic
1198130316 X:133687479-133687501 CAGTGAGCTGAGAACCCAGGAGG - Intronic