ID: 1160844603

View in Genome Browser
Species Human (GRCh38)
Location 19:1160904-1160926
Sequence GCTCTGCCAGGACCACAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160844597_1160844603 -4 Left 1160844597 19:1160885-1160907 CCAGGGAAACCTGTGGGCAGCTC 0: 1
1: 0
2: 2
3: 24
4: 215
Right 1160844603 19:1160904-1160926 GCTCTGCCAGGACCACAAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160844603 Original CRISPR GCTCTGCCAGGACCACAAGG GGG Intronic
900534748 1:3171303-3171325 GCTCTGCCCGGACAGCGAGGAGG - Intronic
900660206 1:3778320-3778342 CCCCTGCCTGGAGCACAAGGTGG - Intergenic
901322007 1:8345736-8345758 GCTTTGCCAGATCCACAAAGGGG - Intergenic
902503530 1:16925607-16925629 GCTCTGCCACTACCACACAGGGG - Intronic
902565656 1:17309740-17309762 GGTCTCCCAGGGCCACATGGTGG + Intronic
902805624 1:18859600-18859622 GCTCAGCCAGGACCCATAGGAGG + Exonic
903348709 1:22704612-22704634 TCACTTCCAGGACCACCAGGTGG + Intergenic
906529037 1:46512681-46512703 GCCCTGCCTGGACCCCATGGAGG + Exonic
915529722 1:156496417-156496439 GCTGTGCCAGGAACACAGAGAGG + Intronic
915590715 1:156868670-156868692 GCTCTGCCTGGACCTCTTGGGGG - Intronic
916858686 1:168779164-168779186 CCTCTCCCAGGACCAGGAGGAGG + Intergenic
919165418 1:193885491-193885513 GCTCCTCCAAGAGCACAAGGAGG + Intergenic
919744249 1:200999010-200999032 GCTCTGCATGGACCACACTGGGG + Intronic
921988734 1:221340833-221340855 TCTCTCCTAGGACCCCAAGGTGG - Intergenic
922348905 1:224719966-224719988 CCTCTGCCTGGGCCACAGGGAGG + Intronic
922741119 1:228014737-228014759 GCTGGCCCAGGACCACAAGGCGG - Intronic
922969990 1:229728084-229728106 GCCCTGCTAGGATCAGAAGGAGG - Intergenic
1065615301 10:27515155-27515177 GCTGTGACAGGATCACATGGTGG + Intronic
1067692152 10:48508792-48508814 GCTCTGACAGGTCCAGAAGCTGG + Intronic
1067763156 10:49065153-49065175 GCTCTTCCAGGACTAAAAAGAGG + Intronic
1070510727 10:77158418-77158440 GTGCAGCCTGGACCACAAGGAGG + Intronic
1070783671 10:79151106-79151128 GCTCGCCCAGGAGCTCAAGGTGG - Intronic
1071302245 10:84264753-84264775 GCTCAGCAGGTACCACAAGGTGG + Intergenic
1075032140 10:119030446-119030468 GTTCTGCCGGAACAACAAGGAGG + Exonic
1076129586 10:128003944-128003966 CGTCTGCCAGGACCACAGAGAGG + Intronic
1076554537 10:131312584-131312606 GCTCCGCCCGGACCACACGCAGG + Intergenic
1077184244 11:1229252-1229274 GCTCTGCGAGGACCACTGTGTGG + Exonic
1077341894 11:2029957-2029979 GCTGTGCCAGGACGGCAAGCCGG + Intergenic
1077407981 11:2391162-2391184 GCCCTGCCAGGGGCACCAGGAGG - Intronic
1081570993 11:44290719-44290741 TCTGTGGCAGAACCACAAGGTGG - Intronic
1081864832 11:46353771-46353793 GCTCTGCCAGGAGCAAGGGGAGG - Intronic
1083265070 11:61542809-61542831 GCTGAGCCAGGGCCAGAAGGTGG - Intronic
1086497559 11:87420224-87420246 GCTCTGCAAGGAGCACCAGGAGG + Intergenic
1088799141 11:113289584-113289606 GCTGTGCCAGGGTCACAAGGAGG - Intergenic
1089376673 11:117999683-117999705 CCTCTGCCTGGACCAGGAGGAGG + Exonic
1091305833 11:134535529-134535551 ACTCTGCCTGGAGCACAAGCAGG - Intergenic
1202824880 11_KI270721v1_random:85146-85168 GCTGTGCCAGGACGGCAAGCCGG + Intergenic
1092259631 12:6946095-6946117 GCCCAGCCAGGACCATAGGGAGG - Intergenic
1095559775 12:43551610-43551632 GCACTCCCAGGACCACACGGCGG - Intronic
1096678012 12:53236013-53236035 GTCCTGCTATGACCACAAGGAGG - Intergenic
1102386463 12:112514583-112514605 GCTCTGCTACCACCACAATGGGG + Intergenic
1102679064 12:114678233-114678255 GCTCTGCCATGGCCATTAGGTGG + Intronic
1102725536 12:115061131-115061153 GACCTGCCAGGGCCACAAGGAGG - Intergenic
1103936260 12:124478682-124478704 TCTCTGCTTGGACCACAAGGTGG - Intronic
1104855539 12:131900784-131900806 GGTCTCCCAGGACCCCAAGCAGG - Intronic
1105891982 13:24688542-24688564 GCTCTGCCAGCAAAACCAGGAGG - Intronic
1106026649 13:25961420-25961442 GCACTGGCAGGACCATCAGGGGG - Intronic
1106620161 13:31364904-31364926 GCTCCCCCAGGAGCACAGGGAGG - Intergenic
1110619529 13:77579547-77579569 GCTCTGCCAGGAGTACAAAAAGG + Intronic
1111958076 13:94780094-94780116 GATCTGCCAGGAAGAAAAGGGGG - Intergenic
1115868971 14:37778791-37778813 CCTCTCCCAGGACCCCAGGGTGG - Intronic
1119783712 14:77296935-77296957 GCTCTTCCAGGGCCACAGGCAGG - Intronic
1119784344 14:77301216-77301238 GCTGAGCCAGAACCACCAGGGGG + Exonic
1119787947 14:77326914-77326936 GCTGTGCCCAGACCACAATGTGG + Intronic
1121308719 14:92923454-92923476 GCGGTGCCCGGACCTCAAGGTGG - Intronic
1122152160 14:99731162-99731184 GCTCAGCCAGGACTGCCAGGAGG - Intergenic
1122446792 14:101775675-101775697 CCACTGCCAGGCCCACAGGGAGG - Intronic
1122623382 14:103072073-103072095 GCTGGGCCAGGAACTCAAGGAGG + Intergenic
1124142207 15:27087407-27087429 GTGCTGCCAGCACCCCAAGGCGG - Intronic
1124253493 15:28122558-28122580 GCCCTGCCTGGACCTCAGGGCGG + Intronic
1125518036 15:40333849-40333871 GCCATGGCAGGACCAGAAGGAGG + Exonic
1125680517 15:41527527-41527549 GCCCAGCCAGGAGGACAAGGAGG - Exonic
1126168706 15:45675969-45675991 GCTCTGCCAGGACATAATGGTGG + Intronic
1126423771 15:48503649-48503671 CCTCTGCCAAGACCCCAAGAAGG + Intronic
1126733960 15:51713038-51713060 TCTCTGCCAGGACATCAAGGTGG + Intronic
1128182798 15:65619757-65619779 GCTTTGGCAGGACGGCAAGGAGG - Intronic
1128240248 15:66096612-66096634 GCTGTGACAGGCCCACAAGAAGG + Intronic
1129157691 15:73728959-73728981 TCTCTGCCAGGGACAGAAGGTGG + Intergenic
1130160734 15:81397485-81397507 GCTCTGCCAGAAACACAGGATGG - Intergenic
1130831765 15:87608242-87608264 GCTCTCCAAGGACTCCAAGGAGG - Intergenic
1134018791 16:10907448-10907470 GCTCTGCCAGGGCCCCGGGGGGG - Exonic
1134207888 16:12252671-12252693 GGGCTGCCAGGACCAGAAGGAGG - Intronic
1136045246 16:27610133-27610155 CTTCTGCTAGGACCCCAAGGGGG - Intronic
1136630076 16:31484857-31484879 TCCCTGCCAGGCCCACAAAGTGG - Exonic
1138405054 16:56785557-56785579 GCTCTGACAGTACCATAATGTGG + Intronic
1139504194 16:67390979-67391001 GCTGTGCAAGGACTGCAAGGTGG - Exonic
1139940476 16:70601807-70601829 GCTCTGCCAGGGCCATGAGAAGG - Intronic
1140420918 16:74818032-74818054 GCTCTGCCGAGAACCCAAGGTGG + Intergenic
1141089025 16:81117372-81117394 GCGCTGCCGGAACCACAGGGAGG - Intergenic
1141167762 16:81671841-81671863 GCTCTGCCAGCGCCACTTGGGGG - Intronic
1141323535 16:83034761-83034783 GCTCTCCCAGGCCCTCAAGGTGG - Intronic
1141485967 16:84340593-84340615 ACTCTTCCAGGAACAGAAGGAGG + Intergenic
1141990336 16:87605677-87605699 GATCAGGCAGGACCACAAGGAGG - Intronic
1142261448 16:89044337-89044359 TCTTTGCAAGGACCACATGGGGG - Intergenic
1142913749 17:3116764-3116786 GATAAGCCATGACCACAAGGAGG - Intergenic
1143039289 17:4021149-4021171 GCTCATCCAGGCCCTCAAGGGGG + Exonic
1143406764 17:6682900-6682922 GCTCTGGCAGGACAAAACGGTGG - Intergenic
1143684612 17:8503935-8503957 CCTCTGCCAGGACAGCAAGCTGG + Intronic
1144580033 17:16453391-16453413 GCACTGCCATTGCCACAAGGGGG + Intronic
1144823908 17:18094576-18094598 GCTCTCTGAGGAGCACAAGGAGG + Intronic
1147161244 17:38570646-38570668 TCCCTCCCAGGACCACGAGGTGG - Intronic
1148328813 17:46800590-46800612 GCTCTGCCAGGAAGACCAGCTGG - Intronic
1151743852 17:76001193-76001215 GCCCAGCCCGGACCCCAAGGGGG - Intronic
1152700988 17:81819748-81819770 GCTCTGCAGGGGCCACAGGGTGG - Intergenic
1156204668 18:34872745-34872767 GCTGCTCCAGCACCACAAGGTGG + Intronic
1156450032 18:37261707-37261729 GCTCTGCCAGGGCTGCAAGGTGG - Intronic
1159822572 18:73164714-73164736 GCTTTCCCAAGGCCACAAGGAGG + Intronic
1160844603 19:1160904-1160926 GCTCTGCCAGGACCACAAGGGGG + Intronic
1160973500 19:1780742-1780764 GGTCTGACAGGGCCACGAGGAGG - Exonic
1161060736 19:2213583-2213605 CCACTGCCAGGCCCAGAAGGAGG + Exonic
1161114203 19:2487922-2487944 GCACTGCCCCGACCACGAGGTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161653519 19:5499115-5499137 GCTCAGCCAGATCCAGAAGGTGG + Intergenic
1162474966 19:10894303-10894325 GCTCTGCCCGGACCACATGCAGG - Intronic
1162933726 19:13970073-13970095 GCACTGCCAGGAGCAGAAGCTGG - Exonic
1163033108 19:14557068-14557090 GCCATGCCAGGTGCACAAGGGGG - Intronic
1163447058 19:17353040-17353062 CCTCTGCCAGGCCCAGGAGGGGG - Intronic
1163578529 19:18124387-18124409 GTTCTGCCTGGACCCCAAGCTGG - Intronic
1163641461 19:18464762-18464784 GCTCTGCCTGGACTAAGAGGCGG + Intronic
1163751172 19:19078745-19078767 GCTCTGGCAGGATAACAGGGTGG - Intronic
1163801312 19:19367474-19367496 GCTGTGACAAGACCAAAAGGAGG + Intergenic
1164513649 19:28916579-28916601 GCTCTGACATGTCCACAAAGAGG - Intergenic
1164518260 19:28955164-28955186 TCTCTGGCAGGAACATAAGGAGG - Intergenic
1165724187 19:38101051-38101073 GCTCTGCCGGAAGCACAAGGTGG + Exonic
1166380659 19:42353607-42353629 CTTCTGCCAGGACCACACCGAGG + Exonic
1166750692 19:45162781-45162803 CCTCTGCCAGGAGCACGGGGAGG + Intronic
1167533651 19:50034884-50034906 TATCTGCCAGGACCACAAACAGG - Intronic
1168493417 19:56830286-56830308 GCTATTCCAGGAATACAAGGAGG + Intronic
1168543746 19:57233219-57233241 GCTGTGCTAGGACAACAGGGAGG + Intronic
925349081 2:3188665-3188687 GCCCTGCCCGGCTCACAAGGTGG + Intergenic
925900976 2:8509127-8509149 CCTCTGCCAGGTTCACAAGGAGG - Intergenic
926554019 2:14335454-14335476 GGTCTGCCTGGACCACAGGAAGG + Intergenic
926838539 2:17051907-17051929 GCTCTGACAGGACCAAAAACTGG - Intergenic
927926661 2:27018384-27018406 ACTCTGCCAGGTCCCCAGGGAGG - Intronic
932732158 2:74228993-74229015 GCTCTAACATGACCACAAGGAGG - Intronic
934573207 2:95384812-95384834 TCTCTGCCAGCTCCACAGGGTGG + Exonic
934681205 2:96285182-96285204 GCTCTGCCAGGGCCTCCATGGGG + Exonic
934715779 2:96542475-96542497 GCTCTGCCTGGACCACACCAGGG - Intronic
934852001 2:97707472-97707494 GCTCTGGGAGGGCCACATGGTGG - Intergenic
937013486 2:118582523-118582545 GCTCTGCTAGGGCAACCAGGAGG - Intergenic
937955496 2:127419854-127419876 GCTCTGCCTGCACCCCCAGGTGG - Intronic
941243274 2:163068250-163068272 GGTCCTCCAAGACCACAAGGAGG - Intergenic
943534553 2:189131625-189131647 GCTCTGTCTGGACCCGAAGGAGG + Intronic
945418189 2:209600700-209600722 GCTCTGTCAGCCCTACAAGGAGG - Intronic
945585441 2:211655672-211655694 GCTCTGCCAGGGTCTCAAGAAGG + Intronic
946131473 2:217610174-217610196 ACTGTGCCAGGACCATGAGGGGG + Intronic
946881920 2:224185126-224185148 GCTCTGCCACTATCACAAGCAGG + Intergenic
946976223 2:225154631-225154653 GTTTTGCCAGGAGTACAAGGAGG - Intergenic
947165137 2:227254102-227254124 TCTTTGGCAGGACCTCAAGGGGG + Exonic
948284055 2:236770273-236770295 GCTCTGCCAGGCTCACAGTGAGG + Intergenic
948284075 2:236770418-236770440 GCTCTGCCAGGCTCACAGTGAGG + Intergenic
948284082 2:236770486-236770508 GCTCTGCCAGGCTCACAGTGAGG + Intergenic
948284095 2:236770562-236770584 GCTCTGCCAGGCTCACAGTGAGG + Intergenic
948445295 2:238027898-238027920 TCCCTGCCGGGACAACAAGGTGG - Intronic
948801922 2:240436917-240436939 GCTCCTCCGGGACCACAGGGAGG - Intronic
948937189 2:241174532-241174554 GAACTTTCAGGACCACAAGGAGG - Intronic
1169846668 20:10000604-10000626 GCACTGCCAGTACCAAAAGCGGG + Intronic
1170036549 20:11995898-11995920 GCTCTGCCATCATCACCAGGAGG - Intergenic
1170629271 20:18054416-18054438 GGGCTCCCAGGACCACAAGAAGG - Intronic
1172132401 20:32664467-32664489 GAGCTTCCAGGACCCCAAGGTGG - Intergenic
1173150892 20:40565791-40565813 GCTCTGACAGCCCCACAAGGTGG - Intergenic
1173992194 20:47312060-47312082 GCTGTGCCAAGACCATAGGGGGG + Intronic
1175936611 20:62517193-62517215 GCTCAGCCAGGGCCTCACGGTGG + Intergenic
1176059118 20:63164509-63164531 GCTCTGCCAGAACCCCCAGGGGG + Intergenic
1176307330 21:5130615-5130637 GCTCTGCGTGGGCCACACGGAGG - Intergenic
1176516646 21:7789256-7789278 GCCCTGCCAGGCCCACCTGGGGG - Intergenic
1178650674 21:34419268-34419290 GCCCTGCCAGGCCCACCTGGGGG - Exonic
1179117413 21:38506866-38506888 GCTCTGCCAGTAGAACAGGGAGG + Intronic
1179849729 21:44131415-44131437 GCTCTGCGTGGGCCACACGGAGG + Intergenic
1184388641 22:44190585-44190607 GCTTGGCCAGGGCCACAAGGAGG - Exonic
1185011573 22:48317534-48317556 GCTCTGCTAGGACCAAGTGGGGG - Intergenic
950186004 3:10945891-10945913 CCTGAGCCAGGACCACAGGGAGG - Intergenic
950415718 3:12868108-12868130 GCCCGGCCAGGACCACTAGAGGG + Intronic
950508955 3:13414272-13414294 GCTCTGTCAGCCCCACGAGGTGG - Intronic
953237097 3:41116586-41116608 GCACAGCCAGGATCACAAAGAGG - Intergenic
955692540 3:61604767-61604789 GCTGTGCCACGGCCACATGGAGG + Intronic
961327082 3:126115199-126115221 GCTCTGCCACTAATACAAGGAGG - Intronic
964446778 3:156767570-156767592 TCCCTTCCAGGGCCACAAGGGGG + Intergenic
964506340 3:157404241-157404263 GTTATGCCAGGGCCACGAGGAGG + Intronic
966881563 3:184353856-184353878 GCCATCCCAGGGCCACAAGGAGG + Intronic
968440460 4:621365-621387 GCACTTCCAGGGCTACAAGGAGG + Intergenic
968754837 4:2409828-2409850 GCCCTGCCAGCAGCACAGGGTGG + Intronic
970909977 4:21263589-21263611 GCTCTGGCAGGAACAGAAAGTGG - Intronic
980180101 4:129392253-129392275 GCCCTGCCAAGAGCACAGGGAGG - Intergenic
982446066 4:155492042-155492064 CCTCTGCCAGGATCCCAAGATGG + Intergenic
984768596 4:183418911-183418933 CCACTCCCAGGACCACAAGCTGG + Intergenic
992614357 5:78534802-78534824 GTTTTGCCAGGACGGCAAGGTGG - Intronic
995534136 5:113118870-113118892 GCTCTGCCAGATCCCCCAGGAGG - Intronic
996296066 5:121918383-121918405 GTTCTGCTAAAACCACAAGGAGG - Intergenic
997355079 5:133257348-133257370 GGTCTGCCAGGCACACAGGGAGG - Intronic
997895199 5:137709780-137709802 AGGCTGCCAGGACCACACGGTGG + Exonic
999199596 5:149806256-149806278 GCTCTGGCATGACAGCAAGGCGG + Intronic
999454346 5:151702588-151702610 GCCCTCCCATGAGCACAAGGTGG - Intergenic
1001284493 5:170412623-170412645 GCACTGCAAGGACCTCCAGGAGG - Intronic
1002460962 5:179373657-179373679 GCTCTGCCAGGCCGCCAAGATGG + Intergenic
1002467554 5:179415215-179415237 GCTCTGCCAGCACTGCAAGGTGG + Intergenic
1003014824 6:2460062-2460084 GCTCTGCCAGGAGCACACATTGG - Intergenic
1003324185 6:5080410-5080432 GCTCTTCCAGGGGCACATGGAGG - Intergenic
1004006597 6:11642544-11642566 GGTGTGCCATGACCACAGGGTGG + Intergenic
1006919243 6:37616595-37616617 GTACTACCAGGACCACCAGGAGG - Intergenic
1013274622 6:108572273-108572295 GCCCTGACAGGGCCAAAAGGAGG - Intronic
1018587491 6:165377904-165377926 CCTCTTCCTGGACCACAAAGAGG - Intronic
1018906974 6:168081150-168081172 GCTCTCCCAGGAATACAACGGGG - Intronic
1021561521 7:21972534-21972556 GCTCCCCCAGGAGCACAGGGAGG + Intergenic
1021663974 7:22954846-22954868 CATCTGCCAGGACCAAAAGTAGG + Intronic
1023187090 7:37543390-37543412 ACTCTGGCAGGATCACAATGAGG - Intergenic
1024532707 7:50406661-50406683 CCTCAGCCAGGAGCACAAGGTGG + Intergenic
1029962921 7:104707562-104707584 GCTCTGCTGGGACCACAAGGAGG + Intronic
1030008601 7:105143006-105143028 GTTCTGCCAGGTCAACATGGGGG - Intronic
1032790832 7:135241339-135241361 GCTCTGCCAGGCCAAAGAGGAGG - Intronic
1032904534 7:136348876-136348898 TCTCTGCCAAGACCAAAAGCAGG - Intergenic
1032988141 7:137361681-137361703 GCCCTACCAGTACCACCAGGAGG - Intergenic
1036760152 8:11503082-11503104 GCTGAGCCAGGACCAGAGGGAGG + Intronic
1037981160 8:23255300-23255322 GCTCTGACAGGGCCACCACGGGG - Exonic
1038223288 8:25631138-25631160 GCTTTGCCAGGCCCACCAGATGG + Intergenic
1041136529 8:54765036-54765058 TCTCTGCCAGGCCGTCAAGGCGG - Intergenic
1043324632 8:79034487-79034509 GCTCTCCAAGGACCACAGGTTGG - Intergenic
1045030200 8:98127833-98127855 GCAGAGCCAGGACCACAAGGAGG - Intronic
1046310548 8:112431010-112431032 GCTCTGCCAGCCCCAAAATGTGG + Intronic
1047352747 8:124091477-124091499 GCTCTGCAAAGACAACAAGCTGG + Exonic
1047927356 8:129694621-129694643 ACTCTGGCAGGACCAGGAGGTGG + Intergenic
1050253192 9:3767520-3767542 GTTCTGCCATTATCACAAGGAGG + Intergenic
1052350717 9:27455824-27455846 GCACAGCCAAGAACACAAGGTGG - Intronic
1053370484 9:37557448-37557470 GCTCTGCCAGGACCTGAGTGGGG + Intronic
1054810232 9:69428483-69428505 CCTCTGCCTGGACCAGGAGGGGG + Exonic
1056693557 9:88827798-88827820 GCTCTTCCAGGTGCTCAAGGAGG - Intergenic
1057527524 9:95816149-95816171 GCTCTGCCTGGAGCACAGGTGGG + Intergenic
1058561246 9:106231643-106231665 AGTGTGCCAGGACAACAAGGTGG - Intergenic
1059288543 9:113199897-113199919 GCTCTCCCAGGACCTCATTGTGG - Exonic
1061083712 9:128387107-128387129 GCTCCCCCAGAACCACAAGGAGG + Intronic
1061664315 9:132151624-132151646 GCTGTGGGAGGACCCCAAGGTGG + Intergenic
1061762961 9:132863153-132863175 GCACTGCCCGGACCAGAGGGTGG + Intronic
1062533423 9:137011403-137011425 GCTCTTCGAGCACGACAAGGTGG - Exonic
1187576622 X:20563280-20563302 CCTCAGTCAGGACCACAAAGGGG - Intergenic
1193012848 X:76697086-76697108 GCTCTAGCAAGACCACCAGGTGG + Intergenic
1198750161 X:139931612-139931634 CCTCTGCCACGAGCACATGGAGG - Intronic
1200078989 X:153566283-153566305 ACTCTGGCAGGACCTCAGGGAGG - Intronic
1200140932 X:153902629-153902651 GCTCAGCCAGGACCCCGGGGAGG - Intronic
1201397821 Y:13567555-13567577 TCTCTGCCAGCACAAAAAGGGGG - Intergenic
1201553403 Y:15242772-15242794 GGGCTGCCAAGACCACAATGGGG - Intergenic