ID: 1160846781

View in Genome Browser
Species Human (GRCh38)
Location 19:1169493-1169515
Sequence TCTACTCGAAGGGGCCCTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160846781_1160846795 21 Left 1160846781 19:1169493-1169515 CCCGTAGGGCCCCTTCGAGTAGA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1160846795 19:1169537-1169559 CGAAGCAGTGAGTGGTTCAGGGG No data
1160846781_1160846792 19 Left 1160846781 19:1169493-1169515 CCCGTAGGGCCCCTTCGAGTAGA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1160846792 19:1169535-1169557 TCCGAAGCAGTGAGTGGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1160846781_1160846796 30 Left 1160846781 19:1169493-1169515 CCCGTAGGGCCCCTTCGAGTAGA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1160846796 19:1169546-1169568 GAGTGGTTCAGGGGCAGAGCTGG 0: 1
1: 0
2: 2
3: 34
4: 370
1160846781_1160846788 13 Left 1160846781 19:1169493-1169515 CCCGTAGGGCCCCTTCGAGTAGA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1160846788 19:1169529-1169551 TGCCCCTCCGAAGCAGTGAGTGG 0: 1
1: 0
2: 2
3: 13
4: 108
1160846781_1160846794 20 Left 1160846781 19:1169493-1169515 CCCGTAGGGCCCCTTCGAGTAGA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1160846794 19:1169536-1169558 CCGAAGCAGTGAGTGGTTCAGGG 0: 1
1: 0
2: 2
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160846781 Original CRISPR TCTACTCGAAGGGGCCCTAC GGG (reversed) Intronic
904988691 1:34573886-34573908 TCTTCTCCAAGAGGCCCTGCTGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
916069346 1:161160872-161160894 TCTGCTCGAAGGGGGCCTCTGGG - Exonic
917033559 1:170721612-170721634 TCTACCCTCAGGGGCCCCACAGG - Intronic
920266769 1:204729853-204729875 CCTCCTCGAAGGGACCCTATAGG + Intergenic
923269834 1:232345737-232345759 TCTACTCGAAGGGGACAAAATGG - Intergenic
1071505078 10:86227254-86227276 TCCCCTCAAAGGGGCCCTTCTGG + Intronic
1077342248 11:2031338-2031360 CCTGTTCGAAGGGGCCCTACTGG - Intergenic
1202825234 11_KI270721v1_random:86527-86549 CCTGTTCGAAGGGGCCCTACTGG - Intergenic
1091584212 12:1806706-1806728 TCTGCTCAAAGGGGCCCTCCAGG - Intronic
1117796045 14:59395458-59395480 TGTACTCTAAGGGGCCCTTATGG + Intergenic
1118894719 14:69936163-69936185 TCTAGTCTAAGGGCCCATACAGG + Intronic
1128738681 15:70068438-70068460 TCTAAACAAAGGGGCCCTACTGG - Intronic
1132746839 16:1439697-1439719 TCTACTCTAAGGTGACCTCCTGG - Intronic
1136086950 16:27892076-27892098 TCTGTTTGAATGGGCCCTACAGG + Intronic
1144264564 17:13555513-13555535 TCCACTCTAAGGGGCCCTCAGGG - Intronic
1152671057 17:81606613-81606635 TCCACTCCAAGGGGCTCTTCTGG + Intronic
1156236906 18:35214443-35214465 TCTGCTTGATGGTGCCCTACAGG + Intergenic
1160846781 19:1169493-1169515 TCTACTCGAAGGGGCCCTACGGG - Intronic
927682924 2:25151975-25151997 TCTCCTCGAAGGGTGCCTTCTGG - Exonic
933724042 2:85416367-85416389 TAGACTCGAAGGGTCCCTTCTGG + Intronic
934063678 2:88320250-88320272 TCTGGTGGAAGGGGCCCAACAGG - Intergenic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
1169610729 20:7377542-7377564 GTTAGTCGAAGGGGCCCTAATGG - Intergenic
1182813533 22:33137971-33137993 TCTACTAGATGGAGCCCCACTGG - Intergenic
1185113503 22:48917915-48917937 CCAACTCGAAGGGACCCCACTGG + Intergenic
960343776 3:116507113-116507135 TCTCCTTGAAGGGGTCCTTCAGG + Intronic
966579033 3:181538374-181538396 TCTATTGGAAGGGGTGCTACAGG - Intergenic
970966294 4:21931946-21931968 TCTCTTGGAAGGGGTCCTACAGG - Intronic
989289759 5:39749392-39749414 TCTGCTTGATGGTGCCCTACAGG - Intergenic
1020116270 7:5478175-5478197 TCTTCTCCAAGAGGCCCTCCTGG - Intronic
1028561931 7:92185441-92185463 TCTCCTTGAAGGGGTCCTTCAGG + Intergenic
1030270442 7:107663548-107663570 TCTCCACTAAGGGGCTCTACAGG - Intronic
1044929510 8:97238573-97238595 TCCACTTGATGGGGCCCCACGGG + Intergenic
1045447895 8:102286373-102286395 TGTACTGGAAGGGGCTGTACTGG + Exonic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1061776690 9:132970351-132970373 GCTACTCGAAGGGGCTTGACTGG + Intronic
1191671295 X:63751137-63751159 TCTACTCAAAGGGGCCAGAGAGG + Intronic