ID: 1160853551

View in Genome Browser
Species Human (GRCh38)
Location 19:1206055-1206077
Sequence TCCGCGGGGCGGCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 483}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160853551_1160853556 -10 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853556 19:1206068-1206090 GCCCCGCGGACCGGACGCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1160853551_1160853569 17 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853569 19:1206095-1206117 TCGGGGCGGGGCGCGCGCTCGGG 0: 1
1: 0
2: 2
3: 31
4: 298
1160853551_1160853568 16 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853568 19:1206094-1206116 CTCGGGGCGGGGCGCGCGCTCGG 0: 1
1: 1
2: 1
3: 45
4: 281
1160853551_1160853566 4 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853566 19:1206082-1206104 ACGCTGAGGGCACTCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 131
1160853551_1160853570 30 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853570 19:1206108-1206130 CGCGCTCGGGCAGACGTTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 21
1160853551_1160853565 3 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853565 19:1206081-1206103 GACGCTGAGGGCACTCGGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 125
1160853551_1160853567 5 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853567 19:1206083-1206105 CGCTGAGGGCACTCGGGGCGGGG 0: 1
1: 0
2: 0
3: 15
4: 136
1160853551_1160853564 0 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853564 19:1206078-1206100 CCGGACGCTGAGGGCACTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1160853551_1160853562 -1 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853562 19:1206077-1206099 ACCGGACGCTGAGGGCACTCGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1160853551_1160853561 -2 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853561 19:1206076-1206098 GACCGGACGCTGAGGGCACTCGG 0: 1
1: 0
2: 1
3: 8
4: 79
1160853551_1160853558 -9 Left 1160853551 19:1206055-1206077 CCGCCGCCGCGCCGCCCCGCGGA 0: 1
1: 0
2: 6
3: 73
4: 483
Right 1160853558 19:1206069-1206091 CCCCGCGGACCGGACGCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160853551 Original CRISPR TCCGCGGGGCGGCGCGGCGG CGG (reversed) Intronic
900095975 1:940299-940321 TCCGCGGCGGGGCGGGGGGGGGG - Intronic
900126771 1:1072234-1072256 TCCGGCGGGCGGCACGGCCGTGG + Exonic
900221679 1:1512480-1512502 GCGGCGGGGCGGGGCGGCGCGGG + Intronic
900233332 1:1574179-1574201 GGCGAGGGGCTGCGCGGCGGCGG - Intronic
900233504 1:1574795-1574817 GCCGGGGGCCGGCGCGGCGTTGG - Exonic
900349498 1:2227987-2228009 GGGGCGGGGCGGCGCGGCGGCGG + Intergenic
900414731 1:2529749-2529771 GCTGCGGGGAGACGCGGCGGCGG + Exonic
900581714 1:3412829-3412851 TCCCTGGGGCGGGGCCGCGGCGG + Intronic
900589868 1:3454785-3454807 GCCGCGGGGCGGAGGGACGGAGG - Exonic
900648148 1:3718207-3718229 TCCCCGGGGCGGGGCGGGGCGGG + Intronic
901049674 1:6419960-6419982 TCCGCGGGGCGGGGCGGGGCGGG - Intronic
901059638 1:6466074-6466096 GCCGCGGGGCTGCGCGGCGGTGG - Exonic
901332759 1:8423714-8423736 GCGGCGGGGCCGCGCGGCGCGGG + Intronic
901373083 1:8817288-8817310 CCCGCGGGGAGGCGACGCGGAGG + Exonic
901443555 1:9293346-9293368 CCCGGGGCGAGGCGCGGCGGGGG + Intronic
901540070 1:9910034-9910056 GCCCCGGCGCGGCGCGGCGCGGG + Intronic
901638254 1:10680261-10680283 GGCACGGGGCGGGGCGGCGGGGG + Intronic
901641366 1:10694685-10694707 GCGGCGGGGGCGCGCGGCGGGGG - Intronic
901930795 1:12595397-12595419 GGCGCGGGGCGGGGCCGCGGGGG + Intronic
902336775 1:15758715-15758737 GGCGCGGGGCGGCGGGGCGGAGG + Intronic
902771278 1:18646875-18646897 GGCGCGGGGCGGCGCGGCGCGGG + Intronic
903132735 1:21290243-21290265 GCCGGGGCGGGGCGCGGCGGCGG - Intronic
903646783 1:24900876-24900898 TCCGCGGGGGGGAGAGGGGGCGG + Exonic
903736076 1:25530593-25530615 TCTGCGGGGCTGCGGGGCTGCGG + Intergenic
903750582 1:25618051-25618073 GCCCGGGGCCGGCGCGGCGGGGG - Exonic
903907584 1:26697117-26697139 TCCGGGCTCCGGCGCGGCGGCGG + Exonic
904171066 1:28592481-28592503 GCCGCGGGGCGGCGGGGTGGCGG + Intronic
904210979 1:28887010-28887032 TCAGCGGGGCGGGGAGGGGGAGG - Intergenic
904696957 1:32336203-32336225 GGCGCGGAGCGGAGCGGCGGCGG - Exonic
905048915 1:35031770-35031792 TGGGCGGGACGGCGGGGCGGAGG - Intronic
905414386 1:37794396-37794418 TCCGCGGTGCGGGGCGGCGGCGG - Exonic
906044497 1:42817314-42817336 TGGGCGGGGCCGCGCGCCGGGGG + Intronic
906292990 1:44632011-44632033 TCCCCGTGGCTGCCCGGCGGCGG - Intronic
907767355 1:57424142-57424164 CGCGGGGGGCGGCGGGGCGGGGG - Intronic
908242413 1:62198521-62198543 TCGGCGGGGTGGGGCGGCGGCGG - Intronic
908473923 1:64470529-64470551 ATCGCGGGGCTCCGCGGCGGTGG - Intergenic
908523513 1:64966562-64966584 GCCGCGGGGCGGGGCGGGGCGGG - Intergenic
910145808 1:84078397-84078419 TCCGCTGGGCGGGCCGGCGCGGG + Intronic
911618377 1:100038681-100038703 TCCGCGGGGCCTGGCGGCGAAGG - Intronic
912354288 1:109042227-109042249 TCGGCGGGGCGGGGCGGGGCGGG + Intergenic
912436854 1:109668163-109668185 TCCGCTGGGCGGTGGGACGGGGG + Intronic
914246016 1:145886170-145886192 TCCGAGGGGCGGGGCTGAGGCGG - Intergenic
914428560 1:147600065-147600087 TTCGTGGCGCGGTGCGGCGGGGG + Intronic
916694396 1:167221314-167221336 GCGGCGGGGCGGCGGGGCCGGGG + Intronic
917817476 1:178725434-178725456 GCCGCGGGGCGGTGCGGGGGAGG + Intronic
918332420 1:183472589-183472611 TTCGCGGGAAGACGCGGCGGCGG + Exonic
920135988 1:203769771-203769793 TGCGGGGGGGGGGGCGGCGGGGG + Intronic
920184590 1:204152082-204152104 CCCGCGGGCCGGGGCGGGGGCGG - Intergenic
920914872 1:210251627-210251649 AGCGCGGCGCGGCCCGGCGGGGG + Intergenic
920920251 1:210292532-210292554 TCCGCGGGCCGGAGCCGCGCGGG + Intergenic
922196730 1:223365040-223365062 TCCCGGGGGCGGGGAGGCGGGGG + Intergenic
922416490 1:225427639-225427661 TTGGCGGCGCGGCGCGGCTGTGG - Intronic
923055834 1:230425687-230425709 TCCGGGGCGCGGGGCGGTGGCGG + Intronic
923506458 1:234609772-234609794 GGCGCGGCGCGGCGGGGCGGCGG + Intergenic
923631260 1:235650307-235650329 TCTGCGGGGCGGGGCCGGGGGGG + Intronic
923744288 1:236686376-236686398 TGCTCGGGGCGGGGCGGCTGGGG + Intergenic
924235801 1:241998735-241998757 TCCGCTGGGGGGCGTGGGGGTGG - Intronic
1062843905 10:690039-690061 CCCGCGGGGCGGGGCGGGGCGGG + Intergenic
1063298054 10:4826285-4826307 CGTGCGGGGCGGCGGGGCGGCGG + Exonic
1063363856 10:5478125-5478147 CCCCCAGGGCGGGGCGGCGGAGG - Intergenic
1063995087 10:11611515-11611537 GGCGCGGCGCGGCGCGGCGGCGG + Intronic
1064009594 10:11725029-11725051 ACGGCGGGGCGGGGGGGCGGGGG + Intergenic
1064208964 10:13347768-13347790 TCCCCGGCCCCGCGCGGCGGCGG + Intronic
1064354286 10:14603992-14604014 TGCGGGGGGCGCCGCGGAGGCGG - Intronic
1065020217 10:21496574-21496596 GCCCCAGGGCGACGCGGCGGGGG - Intronic
1065025370 10:21535065-21535087 TCGGCGGGGCGGGGCGGGGCAGG + Intronic
1065188924 10:23193227-23193249 TGCGGGGGGCCGGGCGGCGGCGG + Exonic
1065712949 10:28533902-28533924 CCCGCGGGGAGGGGCGGCGGGGG + Intronic
1065738011 10:28771767-28771789 GCGGCGGGGCGGCGGGGCAGCGG - Intergenic
1067474425 10:46556621-46556643 TCCGCGGGCCGGGCCGACGGCGG - Intergenic
1067694337 10:48524157-48524179 GCCCCGGGGCGGCGCGGCCGAGG + Intronic
1068788356 10:61001487-61001509 TCGGCGGGGCGGGGCGGGGTCGG - Intergenic
1069664630 10:70146286-70146308 TCCCGGGGGCGGCGCGGAGCGGG - Exonic
1070877198 10:79825804-79825826 GCGGCGGGGCGGCGGGACGGTGG + Intergenic
1071643694 10:87341848-87341870 GCGGCGGGGCGGCGGGACGGTGG + Intergenic
1073242052 10:102065521-102065543 TCGGCGGCGCGGCGCGGCTCCGG + Exonic
1074503344 10:114044974-114044996 TCCGGGCGGCGGCGCGGGCGCGG - Exonic
1075031971 10:119029837-119029859 TGGGCGGGGGGGCGCGGCCGCGG - Exonic
1075501734 10:122980721-122980743 GCCGCGGGGCGGGGCGGGGCGGG + Intronic
1076374018 10:129971768-129971790 TCCGTCGGGCGGCGCGCGGGCGG - Intergenic
1077285609 11:1763988-1764010 TGCGCGGGGCGGGGCGGAGCGGG + Exonic
1077544945 11:3165178-3165200 CCCGGGGGGCGGCAGGGCGGCGG - Intronic
1078066233 11:8081151-8081173 TCTGCGGGGCGGGGCGGGGCGGG + Intronic
1080406886 11:31987539-31987561 TCCGCGGTGCCGCCGGGCGGCGG - Intronic
1081636895 11:44727352-44727374 CCCCCGGGGCGGCGCGCGGGGGG - Intronic
1081699975 11:45146807-45146829 CCCGGCGGGCGGCTCGGCGGAGG - Intronic
1081861002 11:46333279-46333301 GCCGAGGGGCAGGGCGGCGGAGG + Intronic
1081963078 11:47152514-47152536 TCCGCGAGGCTGCGAGGCAGGGG + Intronic
1082059492 11:47848326-47848348 TCCGTTGGGCGTCGCGGCGACGG - Exonic
1082986121 11:59172463-59172485 TGCCCGGGGCGGCGGGGCGCGGG + Intronic
1083336089 11:61922703-61922725 TCCGCTGGGCGGGGCGGGGCAGG - Intergenic
1083572659 11:63768643-63768665 GCCCCGGGGCGGCGGGGCGCGGG + Exonic
1083644916 11:64166400-64166422 GCCGCGGGGCCGAGCGGCAGAGG - Intergenic
1083659800 11:64246771-64246793 TCCGCGCGGCTCCGCGGCGAGGG + Exonic
1083758401 11:64803200-64803222 GGCGCGGGGCGGCGCGGGGCGGG + Exonic
1084385809 11:68841988-68842010 TCGGCGGGGCGGGGCGTCCGCGG + Intronic
1084888123 11:72223833-72223855 TCCCCGGGGCGGCGCGGGGCGGG + Intronic
1085266731 11:75241832-75241854 CCCGCGGGGCGGCGCAGCGCAGG - Exonic
1087811161 11:102610358-102610380 GGGGCGGGGCGGGGCGGCGGGGG + Intronic
1087946241 11:104163988-104164010 AGCGCAGGGCGGCGCGGCGTCGG - Exonic
1089499882 11:118925725-118925747 GCCCCCGGGCGGCGCGGCGCCGG + Intronic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1090385544 11:126355871-126355893 CCCGCGGGGCGGGGCGGGGCGGG + Intronic
1092256235 12:6928061-6928083 GGGGCCGGGCGGCGCGGCGGGGG + Intronic
1094041110 12:26122617-26122639 CCCGGGGGGCGGCGCGGCGGCGG - Exonic
1095098880 12:38161813-38161835 ACAGCAGGGCGGCGCCGCGGTGG - Intergenic
1097107893 12:56635918-56635940 TCCACGGGGCGGCGGGGAGGGGG + Intronic
1097164609 12:57076946-57076968 TCTGCGGGGCGGGGCGGGCGGGG + Intronic
1097191519 12:57221648-57221670 TCGGCGCGGGGGCGGGGCGGAGG - Intronic
1100260665 12:92929349-92929371 GCCGCCGGGGGGCGGGGCGGTGG + Intergenic
1100260667 12:92929352-92929374 GCCGGGGGGCGGGGCGGTGGCGG + Intergenic
1101340892 12:103841178-103841200 GTCGCAGAGCGGCGCGGCGGCGG - Exonic
1101466909 12:104958326-104958348 GCCGCGCGGGGGCGGGGCGGCGG - Intronic
1102101294 12:110281059-110281081 TCCTAGGGGCGGCGCGCGGGAGG + Intronic
1103400613 12:120640797-120640819 GGCGCGGTGCGGCGCGGCGCGGG - Exonic
1103649685 12:122422778-122422800 GCGGCGGGGCGGCGCGGGGCCGG - Intergenic
1103749864 12:123151147-123151169 GCCGCGCGGGGGAGCGGCGGCGG + Intergenic
1103905514 12:124325496-124325518 CCCGCGGGGAGGCCCGGTGGGGG + Exonic
1104602360 12:130162326-130162348 GCGGCGGGGCGGCGGGGAGGAGG + Intergenic
1104929328 12:132329699-132329721 TCCCCGGGGGGGCGCGGTGGGGG - Intergenic
1104961200 12:132489522-132489544 TCCGCGGGGACGCGGGGAGGGGG + Intergenic
1105019964 12:132809431-132809453 ACCGGGGGGCGGGGGGGCGGGGG - Intronic
1105389199 13:19959169-19959191 CCGGCGGGGCGGCGGGACGGCGG + Intronic
1105389208 13:19959185-19959207 ACGGCGGGACGGCGGGGCGGGGG + Intronic
1105849758 13:24323301-24323323 TCCTGGGGACGGGGCGGCGGAGG + Intergenic
1106157640 13:27172188-27172210 GCGGCGGGGAGGCGCGGGGGTGG + Intergenic
1107467642 13:40665137-40665159 TCCGCCGGGCGCGGCGGGGGAGG - Intronic
1108220965 13:48233126-48233148 TCCCCTGGGAGGCGGGGCGGGGG - Intergenic
1108406552 13:50108772-50108794 GCGGCGGGGCGGGGCGGGGGCGG - Intronic
1112507827 13:99985497-99985519 TCCGCGGTGCACCGGGGCGGAGG + Exonic
1112551411 13:100424296-100424318 TCTGCAGGGCGGGGCGGGGGTGG + Intronic
1113655118 13:112063120-112063142 ACCGCGCGGGGGCGGGGCGGGGG - Intergenic
1113928257 13:113952876-113952898 TGGGCGGGGCGGCGGGGCAGAGG + Intergenic
1116018354 14:39432562-39432584 GCCGCGGGGCGGGGCGGGGCTGG + Intergenic
1116861785 14:50001324-50001346 TGGGCGGGGCGGGGCGGGGGCGG + Intronic
1117132041 14:52695949-52695971 TGGGCGGGGCGGCGCGGGGCGGG - Intergenic
1117157038 14:52951268-52951290 GGGGCGGGGCGGCGCGGGGGTGG + Intronic
1117978646 14:61321502-61321524 TCCGCGGCCCGGCCCTGCGGTGG - Intronic
1118030358 14:61812644-61812666 GGGGCGGCGCGGCGCGGCGGGGG + Intergenic
1118809073 14:69260630-69260652 TCTGCCGGGCGGCGGGGCTGGGG + Intronic
1118849319 14:69572372-69572394 AGCGCGAGGCGGCGCGGCGGCGG - Exonic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1120953354 14:90061717-90061739 GGGGCGGGGCGGGGCGGCGGGGG - Intergenic
1122066220 14:99175859-99175881 TCCAGGTGGTGGCGCGGCGGGGG + Exonic
1122581982 14:102777125-102777147 GACGCGGGGACGCGCGGCGGCGG + Intergenic
1122602953 14:102930329-102930351 TACGCGGGGCGGGGGCGCGGAGG + Intronic
1122690324 14:103529203-103529225 TCCGCGACGCGCGGCGGCGGCGG - Exonic
1122775919 14:104116942-104116964 TCCGCGCGCCCGCGCGGGGGTGG - Intergenic
1122978631 14:105181329-105181351 CGCGCGGGGCGGGGCGGCCGAGG + Intergenic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1124022724 15:25939032-25939054 TCGGGGGGGGGGGGCGGCGGGGG - Intergenic
1124249390 15:28097114-28097136 TCCGCAGGGCGGCGGGGAGCAGG - Intronic
1124427042 15:29570935-29570957 GCGGGCGGGCGGCGCGGCGGCGG - Intergenic
1124629350 15:31327923-31327945 GCCGCGGGTCGGAGCGGCAGGGG - Intronic
1124652327 15:31483274-31483296 TGAGCGGCGCGGCGCGGCGCGGG - Exonic
1125516432 15:40323733-40323755 AGCGCGCGGCGGCGTGGCGGCGG + Intergenic
1126113405 15:45188028-45188050 TCCGCCGGGCGGGGAGGGGGCGG + Intronic
1127103190 15:55588063-55588085 GCCTCGGGGCGGCGGGGCGGCGG + Intronic
1128865992 15:71115569-71115591 GGCGCGGGGCGGCTGGGCGGCGG + Intronic
1129199813 15:73992102-73992124 TCCCCGGAGCGGGGCGGCGTGGG - Exonic
1129985930 15:79919795-79919817 GCCGCGGGGAGGGGGGGCGGGGG - Intronic
1130540340 15:84817347-84817369 GCCGCGGGCGGGAGCGGCGGCGG + Exonic
1130613434 15:85381165-85381187 TCCCCGGGTCGGCGCCGCCGGGG + Intronic
1130979494 15:88803181-88803203 TCCCCGGGGCGGCGCGGACCCGG - Intergenic
1131827374 15:96332044-96332066 TGCGGGCGGCGGCGGGGCGGCGG - Exonic
1131838084 15:96409877-96409899 GCTGGTGGGCGGCGCGGCGGGGG - Intergenic
1132498840 16:275882-275904 GCCGGGGGGCGGCGCGGGGCCGG + Exonic
1132499778 16:280271-280293 TCTGCGGGGCGCCGTGGCGCAGG - Intronic
1132588107 16:715017-715039 GGCGCGGGGCGGAGCGGGGGCGG - Intronic
1132875554 16:2135487-2135509 TCCGCGGGGATGCGCAGCGCGGG + Exonic
1133197828 16:4183717-4183739 TCCGCGGCGTGAAGCGGCGGAGG + Intergenic
1134419388 16:14071536-14071558 CGCGCGGGGCGGGGCGGCCGGGG + Intronic
1134519433 16:14911873-14911895 TCCGCGGGGATGCGCAGCGCGGG - Intronic
1134554503 16:15154362-15154384 TCCGCGGGGATGCGCAGCGCGGG + Intergenic
1134707103 16:16310528-16310550 TCCGCGGGGATGCGCAGCGCGGG - Intergenic
1134960437 16:18401596-18401618 TCCGCGGGGATGCGCAGCGCGGG + Intergenic
1135296448 16:21283658-21283680 TGCGCGGGGTGGGGCGGTGGGGG + Intronic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136365220 16:29806494-29806516 GCCGCGGAGCGCCGCGGCGACGG - Intronic
1137926673 16:52547207-52547229 TGGGAGGGGCGGAGCGGCGGCGG - Intronic
1138178704 16:54928774-54928796 CCCGCGCGCCCGCGCGGCGGAGG - Intergenic
1138595059 16:58025508-58025530 TCCGCGGGGGGTCGCGTTGGAGG + Intergenic
1140033851 16:71358609-71358631 ACCGGGGCGCGGCGCGGCGGGGG - Intergenic
1141054790 16:80804633-80804655 CCCCCGGGGCGGGGAGGCGGGGG + Intergenic
1141441388 16:84031814-84031836 TCGGCGGGGAGGCACGGCAGGGG - Intronic
1141709399 16:85689135-85689157 TCCGCGGGCCGGGGCGGGGCCGG - Intronic
1141831141 16:86510519-86510541 TCCGCGGCGCAGAGCAGCGGCGG + Exonic
1142156261 16:88534092-88534114 GCGGCCGGTCGGCGCGGCGGCGG - Exonic
1142175562 16:88643456-88643478 TCGGCCGGGGGCCGCGGCGGGGG + Exonic
1142417201 16:89949167-89949189 TCCCCGGGGTGGGGCGGCCGAGG - Intronic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142683379 17:1562778-1562800 TCCGCAGCGCCGCGCGGGGGCGG + Exonic
1143030472 17:3964483-3964505 TCCCCGGGGCGGGGCGGCGCGGG + Intergenic
1143554424 17:7651665-7651687 GCCGCGGGGCGACGCCTCGGGGG + Intronic
1143723963 17:8832888-8832910 CCCGCGGCGGGGCGCTGCGGTGG - Exonic
1144021292 17:11241500-11241522 TCCGGTTGGCGGCGCGGCCGCGG - Exonic
1144527152 17:15999894-15999916 GCCGCGGGGCGGCGGTGCCGGGG + Exonic
1144548114 17:16215895-16215917 TCCGCGGCGTGGTGGGGCGGCGG + Intronic
1144764232 17:17724223-17724245 TGCGCGCGGCGGCGGGCCGGGGG - Intronic
1144953030 17:19004215-19004237 CGCGCGGGGAGGGGCGGCGGGGG + Intronic
1145243662 17:21253594-21253616 TAGCCGGCGCGGCGCGGCGGCGG - Intergenic
1145265110 17:21376305-21376327 TGCGCGGCGCGGCGCGGCGCGGG + Exonic
1146322632 17:31858907-31858929 GCCGCGGGGCCGCGGGGCTGCGG - Intronic
1146339655 17:32007830-32007852 GGCGCGGGGCGGGCCGGCGGCGG - Intergenic
1147015797 17:37490216-37490238 GGGGCGGCGCGGCGCGGCGGGGG - Intronic
1147184271 17:38705234-38705256 GGCGCGGGGCGGCGCGGGGCGGG + Intergenic
1147684022 17:42276324-42276346 TCCGCGCGGCGGCCCGGCCGAGG - Exonic
1147705703 17:42423367-42423389 TCGACGAGGCGGGGCGGCGGAGG + Exonic
1147933061 17:43994923-43994945 GCCCCGGGGCGGCGAGGCTGGGG - Intronic
1148271790 17:46267163-46267185 CTCGCGGGGCGGCGGCGCGGCGG - Intergenic
1148323723 17:46771755-46771777 GGCGCGGCGCGGCGCGGGGGCGG - Intronic
1148323726 17:46771760-46771782 GGCGCGGCGCGGCGCGGCGCGGG - Intronic
1148493478 17:48037834-48037856 GCCGCGGGGCGGCGCGGAGGCGG - Intronic
1148615784 17:48998495-48998517 TGAGCGGGGTGGCGCGGCGGCGG + Intronic
1148852350 17:50561258-50561280 CCCGCGGGGCGCCGGGGCGCAGG - Intronic
1150562025 17:66302697-66302719 GCGGCGAGGGGGCGCGGCGGGGG - Intronic
1150764593 17:67993383-67993405 CTCGCGGGGCGGCGGGGCGGCGG + Intronic
1150764595 17:67993391-67993413 GCGGCGGGGCGGCGGCGCGGCGG + Intronic
1151565270 17:74893944-74893966 CCCTCGGGGCGGGGCGGGGGTGG - Intergenic
1151625157 17:75271520-75271542 ACCGCTGGGCTGCGCGGCGTGGG + Intergenic
1151783838 17:76265640-76265662 GCCGCGGGGCCGGGCCGCGGGGG + Intronic
1151866426 17:76806250-76806272 CCGGCGGGGCGGCGGGGCCGGGG - Intergenic
1151939024 17:77281359-77281381 TCCGGGGAGGGGCGGGGCGGGGG + Intronic
1152349773 17:79778117-79778139 TGCGCGGGGCGGGCCGGCGCCGG + Exonic
1152352518 17:79791494-79791516 TGCGCGGGGCTGCGGCGCGGCGG + Intergenic
1152406584 17:80101513-80101535 GTCGCGGGGCGGGGCCGCGGTGG - Intergenic
1152581190 17:81166241-81166263 CGCGCGGAGCGGCGCGGGGGAGG + Intergenic
1152617859 17:81346093-81346115 TCGTGGGGGCGGGGCGGCGGGGG - Intergenic
1152628619 17:81399687-81399709 TCCTCGGAGCAGCGCGGCCGGGG - Exonic
1152870637 17:82751579-82751601 GCCGGGGGGCGGGGCGGGGGCGG - Intergenic
1152889349 17:82871654-82871676 TGGGCGGGGCGGGGCGCCGGTGG + Intronic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1154451013 18:14474870-14474892 TCCGCGGAGCGGCAGGACGGGGG - Intergenic
1155654513 18:28177768-28177790 TGCGCGGGACGGAGCCGCGGCGG - Intergenic
1155910354 18:31498209-31498231 GGCGCGGAGCGGTGCGGCGGCGG + Exonic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1158601945 18:58863515-58863537 GCCGCCGGGCCGGGCGGCGGCGG - Intronic
1158718242 18:59899783-59899805 GCCGCGGGTCGGCGCCGCCGCGG + Intergenic
1159670140 18:71212509-71212531 GGGGCGGGGCGGGGCGGCGGGGG + Intergenic
1159670157 18:71212538-71212560 GCGGCGGGGCGGGGCGGCGGGGG + Intergenic
1159670169 18:71212558-71212580 GGGGCGGGGCGGGGCGGCGGGGG + Intergenic
1159670181 18:71212578-71212600 GGGGCGGGGCGGGGCGGCGGGGG + Intergenic
1159947787 18:74457032-74457054 GGCGCGGGGCAGAGCGGCGGCGG + Intronic
1160100520 18:75916306-75916328 CCCGCAGCGCGGCGCGGCGTGGG + Intergenic
1160453598 18:78980679-78980701 CCTGGGGGGCGGCGCGGCGGCGG - Intronic
1160745441 19:709101-709123 TCCGCGGTGCCGGGCGGGGGCGG - Exonic
1160776869 19:860611-860633 ACCACGGGGCGGCGCCGCTGTGG - Exonic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160983834 19:1828396-1828418 GCCGCGGGGCGCCAGGGCGGGGG + Exonic
1160991699 19:1862905-1862927 CCTGCCGGCCGGCGCGGCGGCGG + Intronic
1161050910 19:2163805-2163827 TCCACGGGGCGGGGCGCCGAGGG + Intronic
1161153598 19:2721452-2721474 TCCCCGGGGCGGGGCGGGGCGGG - Intronic
1161265142 19:3360313-3360335 GCCGAGGGGCGGGGCGGGGGCGG - Intronic
1161400900 19:4065922-4065944 CGCGCGGCGCGGCGCGGGGGCGG - Intronic
1161589820 19:5124284-5124306 TCCCCAGGCCGGCGCGGTGGGGG + Intronic
1162032954 19:7925229-7925251 TCAGAGGGCCGGCCCGGCGGGGG - Exonic
1162895927 19:13764723-13764745 GCAGCGGGGCGGCGGGGCGGCGG + Intronic
1162895931 19:13764731-13764753 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162895935 19:13764739-13764761 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162895939 19:13764747-13764769 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162895943 19:13764755-13764777 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162895947 19:13764763-13764785 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162895951 19:13764771-13764793 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162895955 19:13764779-13764801 GCGGCGGGGCGGCGGGGCGGCGG + Intronic
1162959624 19:14118096-14118118 CCGGCGGGGCGGGGCGGCGGAGG + Intergenic
1163158148 19:15449961-15449983 CCGGGGGGGCGGGGCGGCGGGGG - Intergenic
1163158197 19:15450065-15450087 CCCCCGGGGCGGCGAGGGGGGGG - Intergenic
1163508023 19:17719687-17719709 CCGGCGGGGTGGGGCGGCGGCGG + Intronic
1163607102 19:18281494-18281516 CCCCCGGGCCGGCGCGGCGGGGG - Exonic
1163807085 19:19405932-19405954 CCCGCGGGGCCGGGCGGCGGAGG - Intronic
1164388258 19:27794843-27794865 TCCGCGGGCAGGCCAGGCGGCGG - Intergenic
1165157715 19:33797989-33798011 GCCGCGGGGCGGGGTGGCCGCGG - Intronic
1165446835 19:35861214-35861236 CCTGCGGGGCGGCGCCGCGGAGG + Exonic
1166094535 19:40530692-40530714 GGGGCGGGGCGGCGCGGGGGCGG + Intronic
1166367247 19:42284016-42284038 GGCGGGGGGAGGCGCGGCGGGGG + Intronic
1167578439 19:50328835-50328857 GCCATGGGGCGGCACGGCGGCGG - Exonic
1167990700 19:53358317-53358339 TCCCCGGGGCGGGGCGGGGCTGG - Intergenic
1168549362 19:57280410-57280432 TCTGCGGGCCAGGGCGGCGGAGG + Intronic
1168553623 19:57320434-57320456 TCTGCGGGCCAGGGCGGCGGAGG + Intergenic
1168564441 19:57411533-57411555 TCCGCGGTGCTGTGAGGCGGGGG + Intronic
925068740 2:950524-950546 TCCGCGGCGCATCGTGGCGGCGG - Intergenic
925609757 2:5693017-5693039 TCCGGGAGGCGGAGCGGCTGCGG + Exonic
925984819 2:9206988-9207010 TCCGCGGGCCGGAGCGGCGGCGG + Exonic
926155477 2:10451284-10451306 TGAGCGGGGCAGAGCGGCGGGGG - Intergenic
926202669 2:10812806-10812828 TCCGAGGGGCGGCCGCGCGGGGG + Intronic
926580888 2:14632507-14632529 TCCCCGGGGCGGCGCGCGGTCGG + Intergenic
927052970 2:19348307-19348329 TTCGCGGGGCGGGGCGGGGCGGG + Intergenic
927203411 2:20592325-20592347 TGGGCGGGGCGGGGCGGGGGAGG - Intronic
927558205 2:24050314-24050336 ACCGAGGGGAGGCCCGGCGGGGG - Intronic
929107204 2:38377000-38377022 CCGGCGGGCAGGCGCGGCGGCGG + Intronic
929787339 2:45002112-45002134 TCAGCGGGGCGCCGGGGTGGGGG + Intergenic
930136362 2:47906545-47906567 GCCGCGGGGCGGCGGGGGGAGGG + Intergenic
932180745 2:69643819-69643841 CCCTCGGGGCGGCGCGGCGAGGG + Intronic
932345872 2:70994845-70994867 TCCGCGGGGCGGGGACGCGGCGG - Exonic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
934670463 2:96209066-96209088 TCCGCGGGGCGGGGCTGGGACGG - Intergenic
934763843 2:96869745-96869767 GGCGCGGGGAGCCGCGGCGGCGG - Intronic
935137657 2:100321830-100321852 TCCGCGGCGCCGCGCGGCTCGGG - Exonic
935595196 2:104872643-104872665 CACGCGGGCCGGCGGGGCGGAGG - Intergenic
937160935 2:119760179-119760201 GCCGCGGGCCGGCGCCGCTGGGG - Exonic
938014750 2:127858097-127858119 CGCGCGGCGCGGCGCGGCGATGG - Exonic
938018203 2:127885416-127885438 GCGGCGGGGCGGCGGGACGGTGG + Intronic
938035098 2:128028415-128028437 CCCGCGGGGAGGCGCGGCGCGGG + Intergenic
938100239 2:128493377-128493399 TCTGCAGGGCGGCCCGGCCGCGG - Intergenic
939173910 2:138727654-138727676 TGCGGGGGGCGGTGAGGCGGGGG + Intronic
940009520 2:149038948-149038970 GCCGCGGGGCCGCGGGGCCGCGG + Intronic
940009524 2:149038956-149038978 GCCGCGGGGCCGCGGGGCCGCGG + Intronic
940774939 2:157875871-157875893 GGCGCGGGGCGGCGCGGGGCGGG + Intergenic
945241560 2:207681470-207681492 TCCGCGCGGCTCCGCGGCGAGGG - Intergenic
945274256 2:207972343-207972365 GCCGGGGGGCGGGGGGGCGGTGG + Intronic
946386643 2:219387912-219387934 GGGGCGGGGCGGCGCGGCCGGGG - Exonic
946748242 2:222866765-222866787 TCCCCGGGGCGGGGGGGGGGGGG - Intronic
947593077 2:231395963-231395985 TGGGCGGGCGGGCGCGGCGGCGG + Intronic
947641644 2:231710476-231710498 TCCGCGGAGCGGAGCGGGGCGGG + Intronic
947800948 2:232928237-232928259 GCCGGGCGGCGGCGGGGCGGGGG + Intronic
947992338 2:234497256-234497278 TGCGCGGCGCGGCGCGGGAGGGG - Intergenic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948207048 2:236168010-236168032 TCCCGGCGGCGGCGCGGCGCGGG - Exonic
1169164028 20:3407434-3407456 GCCGAGGGGCGGCCGGGCGGGGG - Intronic
1170204692 20:13785296-13785318 CCCGCGGGGCGGCGGGGCGGCGG + Intronic
1170578772 20:17682521-17682543 TGCGCGGGGCGGGGCGGAGCAGG + Intergenic
1171123709 20:22584900-22584922 AGTGCGGGGCGCCGCGGCGGTGG - Intronic
1172474396 20:35226537-35226559 GCCGCGGAGCGGCGCTGGGGAGG - Intergenic
1172596615 20:36154804-36154826 GCCGCGGGGCGGGGCGGCGCGGG - Exonic
1174607034 20:51768453-51768475 CCCCCGGGGCGGCGCGGCGCCGG - Exonic
1175267073 20:57709585-57709607 ACGGCGCGGCGGCGCGGCGCGGG + Exonic
1175521232 20:59604053-59604075 GCCGGGGGGCGGGGGGGCGGGGG - Intronic
1176062692 20:63179156-63179178 GCCGCGGGGCGGGGCGGAGGCGG + Intergenic
1176081055 20:63273148-63273170 GGCGGGGGGCGGCACGGCGGAGG - Intronic
1176120907 20:63454221-63454243 TCTGCGGGCCGGCGAGGCGGGGG - Intronic
1176178634 20:63739777-63739799 GCCTCCGGGCGGCGCGGCGCGGG + Intronic
1176201550 20:63863043-63863065 GACGCGGGGCGGGGCGGGGGGGG + Exonic
1176298397 21:5086552-5086574 TCCGCGAGGCAGAGAGGCGGGGG + Intergenic
1176418924 21:6499024-6499046 CAGGCGGGCCGGCGCGGCGGTGG - Intergenic
1176445224 21:6815703-6815725 TCCGCGGAGCGGCAGGACGGGGG + Intergenic
1176548482 21:8211936-8211958 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176549391 21:8214723-8214745 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176550162 21:8217354-8217376 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176556376 21:8256144-8256166 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176557284 21:8258946-8258968 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176567413 21:8394971-8394993 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176568319 21:8397757-8397779 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176569090 21:8400389-8400411 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176575315 21:8439186-8439208 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176576226 21:8441981-8442003 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176577004 21:8444624-8444646 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1176823391 21:13680736-13680758 TCCGCGGAGCGGCAGGACGGGGG + Intergenic
1178417111 21:32412829-32412851 TGCGCTGCGCGGCGGGGCGGAGG - Exonic
1179209245 21:39312611-39312633 GGCGCGGGGCGGAGCGGTGGGGG - Intronic
1179411989 21:41168829-41168851 TCCGCGGGGCTGGGCGGGAGAGG + Intronic
1179522468 21:41954020-41954042 GCCGCGGGGCGGGGCGGGGCGGG + Intergenic
1179694417 21:43107346-43107368 CAGGCGGGCCGGCGCGGCGGTGG - Intronic
1179858629 21:44175397-44175419 TCCGCGAGGCAGAGAGGCGGGGG - Intergenic
1181006640 22:20016686-20016708 GGCGCGGTGCGGCGCGGCGCGGG + Exonic
1181272266 22:21666084-21666106 TCCCCATGGCGGAGCGGCGGCGG - Exonic
1182355495 22:29720699-29720721 ACCCCGGGGCGCCGCGGTGGGGG + Intronic
1182355560 22:29720911-29720933 GCCGCGGGCGGGCGCCGCGGAGG - Intronic
1182567653 22:31212197-31212219 GCGGCGGGGCGGGGCGTCGGCGG + Intergenic
1183427120 22:37746054-37746076 GCGGCGGGGCGGCGGGACGGCGG - Intronic
1183452754 22:37905907-37905929 CCCGGTGGGTGGCGCGGCGGCGG + Intronic
1183683770 22:39350209-39350231 CCCCGGCGGCGGCGCGGCGGCGG + Intronic
1183702164 22:39457104-39457126 CCCCCGGCCCGGCGCGGCGGCGG + Intergenic
1185055328 22:48576046-48576068 ACGGCCGGGCGGCGCGGGGGGGG - Intronic
1185336206 22:50271870-50271892 TCCACGGGGAGGCGCAGGGGCGG - Intergenic
1185395219 22:50583192-50583214 CCGGCGGGGCGGCGGGGCGGCGG + Intronic
1185398504 22:50604422-50604444 TCCCCGGGCGGGCGCGGCGCAGG - Exonic
1185413435 22:50697581-50697603 GCCCCGGGGCGGCGGTGCGGGGG - Intergenic
1203253366 22_KI270733v1_random:128241-128263 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203254276 22_KI270733v1_random:131039-131061 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203255055 22_KI270733v1_random:133686-133708 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203261420 22_KI270733v1_random:173319-173341 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203262332 22_KI270733v1_random:176118-176140 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203263111 22_KI270733v1_random:178765-178787 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
950583547 3:13878374-13878396 TGCGCGGGGCGGCGGGGCGCGGG + Intronic
952430450 3:33218656-33218678 TGCGGGAGGCGGCGGGGCGGGGG - Intronic
953314544 3:41913961-41913983 TCCGGGAGGGGGTGCGGCGGTGG + Intronic
953485062 3:43286884-43286906 CCCGCGGCGCGGCCTGGCGGCGG + Intronic
953908924 3:46882295-46882317 TCCGAGCGGCGGCCGGGCGGGGG + Intronic
953925339 3:46979796-46979818 ACCGGCGGGCGGCGCGGAGGAGG + Exonic
954076852 3:48187997-48188019 TCGGCGGGGCGGGGCGGTCGCGG - Exonic
954093269 3:48301722-48301744 TCAGGGTGGCGGCCCGGCGGGGG + Intergenic
954138876 3:48594954-48594976 TCCGCGGGGCGTCGTGGAGTTGG + Intronic
954147144 3:48640094-48640116 TCCCGGGTGCGGCGGGGCGGAGG + Exonic
954200877 3:49022339-49022361 TCCGCAGGGCCCCGCGGCGAGGG + Exonic
954632914 3:52056604-52056626 TCCGGGGGGCGGGGCCGCGGGGG + Intergenic
954694051 3:52410803-52410825 ACCGCGAGGAGGAGCGGCGGAGG + Exonic
954838896 3:53494524-53494546 GCCGGGGCGCGGCGCGGCGCGGG + Intergenic
954864688 3:53718577-53718599 GCCGGGGGGCGGGGGGGCGGGGG - Intronic
955182084 3:56682463-56682485 TCCGCGGGGAGGGGCAGCAGGGG + Intronic
955356585 3:58237460-58237482 TCCGGGGCGGGGCGGGGCGGGGG + Intergenic
956604991 3:71065025-71065047 GGCGCGGCGCGGCGCGGCGCGGG - Intronic
956813597 3:72888216-72888238 TTCATGGTGCGGCGCGGCGGCGG - Exonic
957350615 3:79018839-79018861 TGCGAGGGCAGGCGCGGCGGCGG + Intronic
960110312 3:113838873-113838895 CGCGCGGGGCGGTGCCGCGGCGG + Exonic
960822541 3:121749716-121749738 TCCCTGGCGGGGCGCGGCGGTGG - Exonic
960948549 3:122983442-122983464 TCCGCGGGGCGGGGACGGGGCGG + Intronic
961013427 3:123449879-123449901 CCCGCGGGGCGCCGAGGCTGGGG - Intergenic
961551565 3:127672882-127672904 GCCGCGGGGCGGGGAGGCCGGGG + Intergenic
961574447 3:127823214-127823236 TCCCTGGGCCGGCTCGGCGGCGG + Intronic
961855897 3:129870706-129870728 TCCGCGGGTTGGCGGGGGGGGGG + Intronic
962259974 3:133895913-133895935 CCCGCGGGGCTGCGGGGCTGGGG + Intergenic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
964118818 3:153162098-153162120 TCCGCGGGGCCGGGAGGGGGCGG - Intergenic
966808765 3:183825643-183825665 GCCGGGGGGCGGTGCTGCGGCGG - Intergenic
968613896 4:1568803-1568825 GCCGCGGGGCTGCGGGTCGGAGG - Intergenic
968661800 4:1801750-1801772 GCCCTGGGGCGGCGCGGGGGTGG + Intronic
968701332 4:2059485-2059507 CCGGCCGGGCGGCGCGGCAGCGG - Intergenic
968729144 4:2261600-2261622 GCCGCCGGGGCGCGCGGCGGCGG + Intronic
968775476 4:2537086-2537108 CCTGGTGGGCGGCGCGGCGGCGG + Intronic
969330600 4:6471902-6471924 CCCGGAGGGCGGCGCGGAGGAGG + Intronic
969436587 4:7192598-7192620 GCGGCGGGGCGGCGCGGACGAGG - Exonic
972396612 4:38663969-38663991 TGGGCGGGGCGGGGCGGAGGCGG + Intergenic
973993702 4:56436048-56436070 AGCGCGGGGCGGCCCGGAGGCGG + Intronic
976221324 4:82758980-82759002 TCAGCGGGGCGCTGGGGCGGAGG - Intronic
976257046 4:83109988-83110010 TCGCCGGGGCGGCGCGCCGCTGG + Intronic
976398530 4:84582971-84582993 TCCGGGGGGCGGGGCGGGAGGGG + Exonic
978777050 4:112515268-112515290 GGCGCGGGGCGGCGTGGCTGCGG - Exonic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
980930174 4:139177143-139177165 TCGGTGGGGCGGCGCGGGCGGGG - Exonic
981550536 4:145937550-145937572 GGCGCGGGGCGGCCGGGCGGGGG - Intronic
985784468 5:1886712-1886734 TGCGCGGGCCGGCGCGGGGCGGG - Intronic
985896264 5:2751488-2751510 GCCGGGGCGCGGCGCGGCGGCGG + Exonic
985896294 5:2751562-2751584 CCCGCGGGCCGGGGCGGCGGCGG + Exonic
986152437 5:5140132-5140154 TCAGCGGGGCGCTGAGGCGGAGG - Intergenic
987084641 5:14457380-14457402 ACCGGGGGGCGGGGCGGGGGGGG - Intronic
987108734 5:14664983-14665005 TCCGCGGGGGCGCGGGGCGCGGG + Intronic
991371499 5:65925350-65925372 TCCATCGGCCGGCGCGGCGGAGG + Intergenic
992473186 5:77077511-77077533 GCAGCGGGGCCGGGCGGCGGCGG + Exonic
993727358 5:91383424-91383446 AGCGCGGCGCGGCGCGGCGCGGG - Intergenic
995047792 5:107670635-107670657 TCCCCGGAGTGGCGCGTCGGGGG - Exonic
995787239 5:115842417-115842439 TCCGCGGCGCGGCTGGGCTGCGG - Intronic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
996900482 5:128537821-128537843 TGAGCGGCGAGGCGCGGCGGAGG + Exonic
997266293 5:132496991-132497013 TCCGCGGGGCCGCGCCGAAGGGG + Intergenic
998156108 5:139788169-139788191 TTCGGGGGGGGGCGCGGGGGGGG - Intergenic
1000205190 5:159051440-159051462 GCCGCCGGGCGGCGGGGTGGGGG - Intronic
1002006482 5:176238609-176238631 CCGGCGGGGCAGCGCGCCGGAGG - Exonic
1002021227 5:176365596-176365618 GGCGCTGGGCGGCGCCGCGGCGG + Exonic
1002170318 5:177371044-177371066 GCCGCGGGGCGGGGCGGGGCGGG + Intronic
1002219896 5:177672027-177672049 CCGGCGGGGCAGCGCGCCGGAGG + Intergenic
1002532822 5:179858848-179858870 TGCGTGGGGCGGGGCCGCGGCGG - Exonic
1002559574 5:180072133-180072155 GCGGGGGGGCGGGGCGGCGGCGG - Intergenic
1002559575 5:180072136-180072158 CCAGCGGGGGGGCGGGGCGGCGG - Intergenic
1002896388 6:1382712-1382734 GCCTCGGGGCTGCGCGGCGGGGG - Intergenic
1003062830 6:2876088-2876110 CCCGCGGGGCAGCGCGGGCGCGG + Intergenic
1003212314 6:4079049-4079071 CCCGCGGGCCGGCGCAGGGGTGG + Exonic
1003871181 6:10404469-10404491 GCCGCGGGGCGGGGCGGGCGGGG + Intronic
1005076135 6:21909868-21909890 CCCGGGGGGTGGGGCGGCGGAGG - Intergenic
1005267377 6:24126237-24126259 TCTACGAGGCGGAGCGGCGGCGG + Exonic
1006263378 6:32895164-32895186 TCCACGGGCCGGCCCGGAGGAGG - Intergenic
1006599698 6:35217236-35217258 GCGGGGGGGAGGCGCGGCGGGGG + Intronic
1007430007 6:41771137-41771159 GCAGCAGGGCGGCCCGGCGGTGG + Exonic
1007431510 6:41779898-41779920 GCCGCGGGGCGGGGCGGGGCGGG - Exonic
1007739708 6:44003085-44003107 TCCGCGGCGCTCCGCGGCGCTGG + Exonic
1007902062 6:45422091-45422113 CGCGCGGCGCGGCGCGGCGGTGG + Intronic
1008598454 6:53065727-53065749 TCCGGGGGGCGGTGCAGAGGGGG + Intronic
1009905607 6:69867240-69867262 TCTGGGGGGCGGCGCGGGCGCGG + Intronic
1010781173 6:79947421-79947443 TCCTCAAGGCGCCGCGGCGGCGG + Exonic
1011640442 6:89412197-89412219 TCCGCCGGCGGGCGGGGCGGGGG - Exonic
1013230563 6:108158011-108158033 GCGGGGGGGCGGCGCGGCCGCGG - Intronic
1013619381 6:111873155-111873177 GCCGCCGGGCGGTGCGGCGCGGG + Exonic
1014724989 6:124962683-124962705 TCCGCGGAGCCGAGCGGCGGTGG + Exonic
1015328460 6:131950922-131950944 CCCGCCGGGCAGCGCGGCGCCGG + Exonic
1015626352 6:135183122-135183144 CCCGCGGGGCGGGGCCGCGCAGG + Intronic
1016714140 6:147204237-147204259 GCCGCGGAGCGAGGCGGCGGCGG + Intergenic
1016937256 6:149456618-149456640 CCTGGGGGGCGGCGGGGCGGGGG - Intronic
1017446616 6:154511779-154511801 TGGGCGGGGCGGGGCGGGGGTGG - Intergenic
1017672095 6:156778153-156778175 CTGGTGGGGCGGCGCGGCGGGGG - Exonic
1017793640 6:157823074-157823096 GCGGCGGCGCGGCGCGGGGGCGG + Intronic
1019202849 6:170333157-170333179 TGCGGGGGGCGGGGGGGCGGTGG - Intronic
1019298220 7:290102-290124 GCCGGCGGGCGGCGCGGAGGAGG + Intergenic
1019303694 7:322386-322408 TCTGCGGGGCGGCGGGGGCGGGG - Intergenic
1019891649 7:3951852-3951874 TCTGCGAGGCGGCGCTGCCGGGG + Exonic
1021740347 7:23680236-23680258 GCCTCTCGGCGGCGCGGCGGCGG + Exonic
1022098755 7:27156927-27156949 TCGGCGGGGGGGCGGGGTGGGGG - Intronic
1022363342 7:29684965-29684987 TCCTCGGGGGGGCGTGGCGTCGG - Intergenic
1022734423 7:33062804-33062826 TGCGCGGGGCGGGGCGTCGCGGG - Intergenic
1023875826 7:44285810-44285832 GCGGGGGGGAGGCGCGGCGGAGG + Intronic
1023875854 7:44285867-44285889 GCGGCGGGGGGGCGCGGCGGGGG + Intronic
1023902249 7:44490688-44490710 TCCGCCGGACGGCGCGGCTGCGG + Exonic
1025639452 7:63353347-63353369 TCCGCGGGCAGGTGAGGCGGCGG + Intergenic
1025643247 7:63394745-63394767 TCCGCGGGCAGGTGAGGCGGCGG - Intergenic
1026458885 7:70596162-70596184 TCCGCGGGCCGGGGCGGGGCTGG + Intronic
1029570193 7:101363605-101363627 GCCGCGGGGCTGCGGGGCTGCGG + Intronic
1030033309 7:105388474-105388496 CCCGGGGGGAGGGGCGGCGGCGG - Intronic
1030121231 7:106112353-106112375 GGGGCGGGGCGGAGCGGCGGCGG + Intronic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1031317292 7:120273416-120273438 GCTGCGGGGCGGCGGGGCTGCGG - Intergenic
1031966682 7:128032232-128032254 GGCGCGGGGCTGCGCGGCGCCGG - Intronic
1032013514 7:128361494-128361516 GCAGCGGGGCGGCGAGGCTGCGG - Intronic
1032125232 7:129188732-129188754 GCCGCGGGCTGGCGCGGGGGCGG + Intergenic
1033299824 7:140176354-140176376 GGGGCGGGGCGGGGCGGCGGCGG + Intronic
1034441158 7:151086692-151086714 GGCCCGGGGCGGCGCGGCGGAGG - Intronic
1034483503 7:151341616-151341638 ACCGCGGGGCGGAGCCGCGACGG - Intergenic
1034997489 7:155587293-155587315 CCCGCAGGGCGACGCGGCTGCGG - Intergenic
1035266548 7:157692848-157692870 GCTCGGGGGCGGCGCGGCGGCGG + Intronic
1035486641 7:159231306-159231328 CCCGCGGGGCGGCGGGGAGGTGG + Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039476562 8:37841947-37841969 CCTGCGCGGGGGCGCGGCGGGGG + Exonic
1040981736 8:53251647-53251669 TCTGCGGGGCGGGGCGGGGCGGG + Exonic
1041109294 8:54470112-54470134 TCCGGGAGGCGGCGCAGCGCGGG + Intergenic
1041673648 8:60516948-60516970 TCGGCGCGGAGGCGGGGCGGAGG + Exonic
1044719875 8:95134343-95134365 TCCACGGGTCTGCGGGGCGGGGG + Intronic
1045663965 8:104466625-104466647 ACCGCGGGGCGGGGGCGCGGCGG + Intronic
1045701704 8:104873789-104873811 TCCGGGGGGCGGTGGGGGGGCGG + Intronic
1045737918 8:105318449-105318471 TGCGCGGCCCGGAGCGGCGGCGG + Intronic
1046871293 8:119208373-119208395 CCCGCGGAGCTGAGCGGCGGCGG + Exonic
1048981154 8:139703875-139703897 GCCGGGGGACGGCGCGGTGGCGG + Intergenic
1049406046 8:142452285-142452307 TCCGCGGGTGGGCGCTGCGCTGG + Intronic
1049419545 8:142510757-142510779 GCCGCGGGGCCTGGCGGCGGCGG + Intronic
1049552720 8:143267835-143267857 TCCGCCCGGCGGTGCGGCGCTGG - Intronic
1049574895 8:143385437-143385459 GCCGCGGTGTGGCGCTGCGGGGG - Intergenic
1049801017 8:144517576-144517598 AGCGCGCGGCGGGGCGGCGGGGG - Intronic
1049801124 8:144517960-144517982 ATCGCGGGGCGCCGCGGCGCCGG + Intergenic
1052048549 9:23821756-23821778 GGCGCGGCGCGGCGCGGCGCGGG - Intronic
1053066316 9:35071989-35072011 GCCCCGGGGCGCCGCGCCGGCGG + Intronic
1053149169 9:35732101-35732123 GCGGCGGGGCGGCGGGCCGGCGG - Exonic
1053312374 9:37027729-37027751 TCCGGGCGGGGGCGGGGCGGGGG + Intronic
1054496270 9:65825485-65825507 GCGGCGGGGCGGCGGGGCGGCGG + Intergenic
1055466506 9:76571791-76571813 ACGGCGGGGCGGCCCGCCGGCGG - Intergenic
1056992582 9:91424508-91424530 TGCGCAGGGCTGCGCGGCGGAGG + Intergenic
1057466385 9:95317774-95317796 TCCGTGGGGCGGGGCGGGCGCGG + Intergenic
1057623324 9:96655403-96655425 TCCGCGGCGCGGCGCGGGCCTGG + Intergenic
1059123372 9:111661828-111661850 TCGGCGGGGCGCGGGGGCGGTGG + Intronic
1060811204 9:126612505-126612527 TCCGCGGGGCCCCGCGGCGCAGG + Intergenic
1060811553 9:126613710-126613732 CCCGCGGGGCGGCCGGGCCGGGG + Intergenic
1060979808 9:127785667-127785689 TGCGCGGGGCGGCGGGCGGGGGG - Intronic
1061084919 9:128393114-128393136 TGCGCGGGGCTGGGCGGGGGCGG - Intergenic
1061208513 9:129177632-129177654 GCCCAGGGGCTGCGCGGCGGCGG - Exonic
1061328126 9:129876245-129876267 GCGGCGAGGCGGCGCGGGGGCGG + Intronic
1061453421 9:130681222-130681244 GCCGCGGGGCGGGGCGGGGCGGG - Intronic
1062162600 9:135088287-135088309 GTCGCGGGCCGGCGCAGCGGTGG + Intronic
1062332252 9:136049912-136049934 GCCCCGGGACGGCGTGGCGGTGG - Exonic
1062364732 9:136203224-136203246 GCCGCGGGGCGGGGCGGGGCCGG + Intronic
1062556209 9:137114411-137114433 GCCGGGGGGCGGCGGGACGGCGG + Intronic
1062574637 9:137200494-137200516 GCCGAGCGGCGGCGCGGCGGGGG - Exonic
1062651246 9:137578842-137578864 TGCGCGGGGCGGCGAGGCCGGGG + Exonic
1062659093 9:137619065-137619087 GGCGGGGGGCGGCGCGGGGGCGG + Intronic
1203523971 Un_GL000213v1:68822-68844 TCCGCGGAGCGGCAGGACGGGGG - Intergenic
1203469766 Un_GL000220v1:111388-111410 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203470677 Un_GL000220v1:114183-114205 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203471455 Un_GL000220v1:116826-116848 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1203477587 Un_GL000220v1:155360-155382 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203478498 Un_GL000220v1:158155-158177 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203479276 Un_GL000220v1:160798-160820 TCCTCGGCGCGCGGCGGCGGCGG + Intergenic
1185877632 X:3713326-3713348 CTCGGAGGGCGGCGCGGCGGCGG + Exonic
1186496449 X:10015540-10015562 CGCGCGGGGCGGCCGGGCGGCGG + Exonic
1186670242 X:11759338-11759360 TCCTCGGGGCGGAGGGGGGGGGG + Intronic
1187403649 X:18984129-18984151 TCCGCGCGGCGGGGAGGCGCGGG + Exonic
1187403653 X:18984134-18984156 GCGGCGGGGAGGCGCGGGGGCGG + Exonic
1190024584 X:46912255-46912277 TGGGCGGGGCGTCGAGGCGGCGG + Intronic
1190265723 X:48826463-48826485 TCCCCGGGGCACCCCGGCGGCGG - Intergenic
1190285301 X:48957467-48957489 CCGGCGCCGCGGCGCGGCGGAGG - Exonic
1190885788 X:54530150-54530172 TCCGCGGGGGGGGGGGGGGGGGG - Intergenic
1195072148 X:101291401-101291423 TCCGCTGGGCAGCGCGGCCGCGG - Intronic
1195269480 X:103215592-103215614 GCCTCGGGGCGGGGCGGGGGAGG + Intronic
1195716948 X:107826684-107826706 TCCGGGGTGCGGGGCGGGGGCGG + Intronic
1196124332 X:112082936-112082958 GCGGCGGGGCGGGGCGGGGGAGG + Intergenic
1199760014 X:150898370-150898392 TGTGCGAGGCGGAGCGGCGGGGG - Intronic
1200173761 X:154097630-154097652 TCCTCCGCTCGGCGCGGCGGCGG + Exonic
1200173763 X:154097633-154097655 TCCGCTCGGCGCGGCGGCGGCGG + Exonic