ID: 1160856886

View in Genome Browser
Species Human (GRCh38)
Location 19:1221746-1221768
Sequence ACAGCCTGTGCGCGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160856886_1160856899 16 Left 1160856886 19:1221746-1221768 CCTGCCAGCCGCGCACAGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1160856899 19:1221785-1221807 GAGTGGAGTGGCCTCTGTCAGGG 0: 1
1: 0
2: 2
3: 134
4: 376
1160856886_1160856890 -6 Left 1160856886 19:1221746-1221768 CCTGCCAGCCGCGCACAGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1160856890 19:1221763-1221785 GGCTGTCCCCGGCATGTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 139
1160856886_1160856891 -1 Left 1160856886 19:1221746-1221768 CCTGCCAGCCGCGCACAGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1160856891 19:1221768-1221790 TCCCCGGCATGTCCCAGGAGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1160856886_1160856895 4 Left 1160856886 19:1221746-1221768 CCTGCCAGCCGCGCACAGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1160856895 19:1221773-1221795 GGCATGTCCCAGGAGTGGAGTGG 0: 1
1: 1
2: 1
3: 29
4: 251
1160856886_1160856898 15 Left 1160856886 19:1221746-1221768 CCTGCCAGCCGCGCACAGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1160856898 19:1221784-1221806 GGAGTGGAGTGGCCTCTGTCAGG 0: 1
1: 0
2: 2
3: 125
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160856886 Original CRISPR ACAGCCTGTGCGCGGCTGGC AGG (reversed) Intronic
900582520 1:3416070-3416092 ACAGCCTGGGTGGGGCTGGAAGG + Intronic
901017356 1:6239590-6239612 TCAGCCTGTAGGCGGATGGCAGG - Intergenic
902441704 1:16434401-16434423 TCAGCCTCTGAGTGGCTGGCTGG + Intronic
903788325 1:25875656-25875678 GCTGCTTGTGCGCGGCGGGCGGG - Intergenic
906611755 1:47208705-47208727 TCAGCCAGAGCCCGGCTGGCTGG - Intergenic
906701178 1:47859297-47859319 CCAGCCAGTGTGAGGCTGGCTGG - Intronic
907326109 1:53639479-53639501 ACAGCCTGTGCGCATCTGCTTGG - Intronic
912354331 1:109042325-109042347 AAAGCCTGGGCGGGGCGGGCGGG + Intergenic
922120555 1:222663421-222663443 ACAGCATGTAAGAGGCTGGCTGG - Intronic
922562753 1:226580923-226580945 TCAGGCTGTGCCAGGCTGGCAGG + Intronic
923694004 1:236228416-236228438 ACAGTCTGTGCCAGGCTGGATGG + Intronic
1063062186 10:2567621-2567643 ACAGCCTGTGGGTGGCTGAGTGG + Intergenic
1065105643 10:22381192-22381214 ACAGCCTGTGGGGGGCTTTCTGG - Intronic
1065785418 10:29208541-29208563 ACAGCTTGGGAGCTGCTGGCTGG + Intergenic
1067972794 10:50991679-50991701 CCAGCCTCTGCGCCGCGGGCCGG - Intronic
1072209865 10:93236572-93236594 CCTGCCTGTGCCAGGCTGGCAGG + Intergenic
1075727784 10:124619377-124619399 ACAGCCTGTGCGGGGAGGCCAGG + Exonic
1075991568 10:126843000-126843022 ACAGCCTGAGGGCGAGTGGCAGG + Intergenic
1076255598 10:129022139-129022161 ACAGGCTGGGAGCTGCTGGCAGG - Intergenic
1076531453 10:131147830-131147852 CGAACCTGTGCGAGGCTGGCGGG - Intronic
1076769118 10:132653436-132653458 ACGGCCTGTGCCCGGCAGCCAGG - Intronic
1076844128 10:133060710-133060732 ACCACCTGTGGCCGGCTGGCCGG + Intergenic
1077335710 11:2002980-2003002 ACAGCCCGAGCACGCCTGGCTGG - Intergenic
1077340508 11:2024292-2024314 ACAGCCCCTGCCCGGCTGTCTGG + Intergenic
1082003886 11:47409245-47409267 ACATCCTGTGATCGGCCGGCTGG + Intronic
1090243388 11:125199396-125199418 AATGCATGTGCGGGGCTGGCAGG - Intronic
1091220891 11:133929535-133929557 TCAGTCTGTGCAGGGCTGGCAGG + Intronic
1202818694 11_KI270721v1_random:58162-58184 ACAGCCCGAGCACGCCTGGCTGG - Intergenic
1202823493 11_KI270721v1_random:79481-79503 ACAGCCCCTGCCCGGCTGTCTGG + Intergenic
1101901530 12:108794406-108794428 ACAGCCAGTGGGCGGCAGGAGGG - Intronic
1104313463 12:127675558-127675580 AGAGTCTGTGGGGGGCTGGCTGG - Intergenic
1104424571 12:128664764-128664786 ACATCATGTGCATGGCTGGCTGG - Intronic
1106553782 13:30792911-30792933 ACAGCCTGAGCCTGCCTGGCTGG - Intergenic
1107678823 13:42825966-42825988 ACTGCCTGTGGGAGGGTGGCAGG - Intergenic
1118734220 14:68690550-68690572 CCAGCCTGTGAGCTGCGGGCAGG - Intronic
1118926136 14:70191090-70191112 ACAGCATGTGCGGGGGTGGCGGG + Intergenic
1120730113 14:87992636-87992658 ACAGCCTGTGCCCCACTGCCTGG + Intronic
1121313502 14:92947624-92947646 ACAGCATGTGCCCGGCTGGGAGG + Intronic
1121535718 14:94689604-94689626 CCAGCCTGGGCGCGGCTGGCCGG + Intergenic
1122722472 14:103730107-103730129 TCAGCCTGTTCAGGGCTGGCAGG - Intronic
1123015162 14:105370021-105370043 GCAGACTGTGCGATGCTGGCGGG - Intronic
1123759289 15:23420434-23420456 ACAGCCTCAGCCTGGCTGGCAGG + Intergenic
1124641860 15:31400819-31400841 ACTGCCTGTGAGGGTCTGGCTGG + Intronic
1125770094 15:42159481-42159503 CCAGCCTGTGCACCTCTGGCAGG + Exonic
1130541064 15:84821169-84821191 CCTGCCTGTGCCCTGCTGGCTGG - Intronic
1132777600 16:1604420-1604442 ACAGCATGTGCAGGGCTGGAAGG + Intronic
1132951752 16:2566752-2566774 ACATCCTGCACGCGGGTGGCTGG - Intronic
1132962598 16:2633418-2633440 ACATCCTGCACGCGGGTGGCTGG + Intergenic
1133050067 16:3112596-3112618 ACAGCCTGCACGGGGCGGGCGGG - Exonic
1134457061 16:14402424-14402446 ACAGCCTCAGCCTGGCTGGCAGG - Intergenic
1139614426 16:68080325-68080347 TCTGCCTGTGTGAGGCTGGCTGG + Intergenic
1140487577 16:75305893-75305915 ACAGCCTGTGCTCCACTTGCTGG + Intronic
1142717635 17:1755651-1755673 GCAGCCTGCCCCCGGCTGGCGGG - Intergenic
1143747182 17:9003290-9003312 AGAGCCTGCGCGGGGATGGCGGG + Intergenic
1144738335 17:17567253-17567275 ACAGCCTGTGCCAGGATGGCTGG - Intronic
1145291599 17:21551199-21551221 GCAGCCTGTGCACGGCGGGTGGG + Exonic
1145388477 17:22435829-22435851 GCAGCCTGAGCACGGCTGGTGGG - Intergenic
1147623301 17:41882736-41882758 ACAGCCTGGGCTCAGCTGGGCGG - Intronic
1150318604 17:64190737-64190759 GCAGCCTGGGCACTGCTGGCTGG + Intronic
1152023331 17:77793281-77793303 ACAGCCTGTGAAAGGCTGCCGGG - Intergenic
1152134008 17:78493602-78493624 CCAGCCTGTGGGCCTCTGGCCGG + Intronic
1153915553 18:9741535-9741557 ACAGATGGTGCGTGGCTGGCAGG - Intronic
1157418520 18:47526144-47526166 ACGGGCTGTGGGCGCCTGGCAGG + Intergenic
1158850978 18:61495723-61495745 ACAGCCAGTGCCCCTCTGGCTGG - Intronic
1159938704 18:74389092-74389114 AGAGCCTGGGCCCTGCTGGCAGG - Intergenic
1160494674 18:79365848-79365870 ACAGCTTGTGCGTGGATGGAAGG + Intronic
1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG + Exonic
1160856886 19:1221746-1221768 ACAGCCTGTGCGCGGCTGGCAGG - Intronic
1161014912 19:1978744-1978766 CCAGCTGGTGCGCGGCGGGCGGG + Exonic
1162356108 19:10185988-10186010 ACAGCGTGTGTGCCTCTGGCTGG - Intronic
1162743109 19:12784110-12784132 ACATCCTGTGGACTGCTGGCTGG + Intronic
1163458013 19:17420154-17420176 ACAGACTCGGCGCCGCTGGCTGG + Exonic
1163758628 19:19121162-19121184 ACAGCCTGTGCGGAGAGGGCCGG + Exonic
1164775601 19:30851157-30851179 GCAGCCTGTGTACGGGTGGCTGG - Intergenic
1166678980 19:44756262-44756284 CCAGCCGGTGCACAGCTGGCAGG - Exonic
1168242799 19:55095785-55095807 ACAGCCTGTGAACCTCTGGCAGG - Intronic
1168414953 19:56161776-56161798 ACAGCCTGTGCCGGGCTGCGAGG + Intergenic
925118809 2:1401973-1401995 ACAGCCTGCGTGGGTCTGGCTGG - Intronic
925927651 2:8681807-8681829 ACAGTAAGTGCGGGGCTGGCGGG - Intronic
930740344 2:54826028-54826050 TCAGACTGTGCCCGGGTGGCAGG - Intronic
931651738 2:64474571-64474593 ACAGCCTGTGCCCTCCTGACAGG + Intergenic
941095721 2:161238070-161238092 ACAGGCTGGGCGCGCCCGGCCGG - Intergenic
941251891 2:163175540-163175562 AAACCCTGAGAGCGGCTGGCAGG + Intergenic
945093193 2:206195484-206195506 ACAGCCTGGATGCTGCTGGCTGG + Intronic
947525796 2:230876018-230876040 ACAGCCAGCGTGCAGCTGGCAGG - Intronic
948189349 2:236046007-236046029 ACAGCCTGGGAGCTGCTGGGGGG + Intronic
1171350648 20:24500064-24500086 ACAGTCTGGACACGGCTGGCTGG - Intronic
1172930224 20:38581205-38581227 CCAGCCTGGGCTGGGCTGGCAGG - Exonic
1172944109 20:38674590-38674612 ACTGCGCGTGCGCGGCTAGCGGG - Intergenic
1175698960 20:61123629-61123651 GCAGCCTCTGCGGGACTGGCTGG - Intergenic
1175943761 20:62549574-62549596 ACAGGCTGTGTGACGCTGGCTGG - Intergenic
1176374742 21:6081431-6081453 ACAGCGTGTGCTCGGCGGGTGGG + Intergenic
1176423859 21:6535779-6535801 ACAGCCTGTTCTGGGATGGCAGG + Intergenic
1178491631 21:33056254-33056276 ACAGCCTTTGTGCAGCAGGCTGG + Intergenic
1178624645 21:34204616-34204638 GCAGCATGTGCGCGGCTGCCAGG - Intergenic
1178639742 21:34336341-34336363 ACAGCCTGTGCCAGGCTTGGTGG - Intergenic
1179260246 21:39751397-39751419 ACGGCCTGTGCGGGGCTTGAGGG - Intronic
1179272924 21:39865635-39865657 TCAGCCTGTGCTCTGCTGGCTGG - Intergenic
1179427851 21:41295917-41295939 ACAGGCTGTGCCCTGCAGGCTGG + Intergenic
1179571661 21:42282176-42282198 GCAGGCTGAGGGCGGCTGGCAGG + Intronic
1179699352 21:43144094-43144116 ACAGCCTGTTCTGGGATGGCAGG + Intergenic
1179748733 21:43456814-43456836 ACAGCGTGTGCTCGGCGGGTGGG - Intergenic
1180012390 21:45059377-45059399 AGAGCCTGTGCCCAGCGGGCAGG - Intergenic
1180137039 21:45868609-45868631 TCAGCCTGGGCGGGTCTGGCGGG + Intronic
1181586953 22:23857904-23857926 GCAGCCTGTGCGCGGAGGGAAGG - Intronic
1182830389 22:33300296-33300318 ACAGACTGAGTGCAGCTGGCAGG + Intronic
1183717597 22:39542861-39542883 ACTGCCTGTGTGAGCCTGGCGGG - Intergenic
1183932064 22:41240925-41240947 ACAGGCTGTCCCCGCCTGGCAGG + Exonic
1184582052 22:45424572-45424594 ACAGCCTGTCCATGGCGGGCAGG - Intronic
953912489 3:46900000-46900022 AGAGCCTGTGGGGGGCTGGGAGG - Intronic
954166721 3:48765523-48765545 ACAGCATGTGGGCATCTGGCTGG - Intronic
954409705 3:50365097-50365119 GCAGCCAGTGCGAGGCTGGCCGG - Exonic
961795090 3:129403507-129403529 ACACCCAGTGGGCAGCTGGCAGG + Intronic
965610182 3:170535549-170535571 ACAGCCAGTGGGCTGCTGGGTGG - Intronic
968405631 4:337212-337234 ACAGCCGGTGCGAGGCCCGCAGG + Intergenic
968463022 4:735209-735231 ACAGCCTGGGCAGGCCTGGCAGG - Intronic
974556174 4:63451561-63451583 ACAGTCTGTGTGCTGCTGGTAGG + Intergenic
982255555 4:153448029-153448051 GCAGGCTGTGCCCGGATGGCAGG + Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
985654207 5:1121616-1121638 ACAGCCAGTGAGTGGCAGGCAGG + Intergenic
985788104 5:1910489-1910511 GGAGCCTGTGCGTGGCTGGCTGG - Intergenic
985805692 5:2041258-2041280 ACAGCCCGTCCGTGGGTGGCTGG + Intergenic
992497662 5:77309335-77309357 ACAGCCTGTGCCCTTCTTGCAGG + Intronic
997614598 5:135237687-135237709 CCAGCCTGTGCCTGGCTGTCAGG + Intronic
998232117 5:140367425-140367447 ACTCCCTGGGCGTGGCTGGCTGG + Exonic
999270170 5:150292119-150292141 ACAGCCAGTGGGCAGCAGGCAGG + Intergenic
999439298 5:151589231-151589253 ACAGCCTGTGTGTGTCTGGGGGG - Intergenic
1002467245 5:179413764-179413786 ACAGCCTGTGGCCGGCTCCCGGG - Intergenic
1003567260 6:7231493-7231515 GCAGCCTCTGGGCTGCTGGCTGG - Exonic
1004395741 6:15245426-15245448 ACAGGCTTTGCGGGGCAGGCTGG + Intergenic
1007918686 6:45586533-45586555 AGAGCGTGTGCGAGGCTGGGGGG + Intronic
1010043921 6:71419848-71419870 AGGGCCTGTGCGCGGCTGGGTGG - Intergenic
1018230401 6:161669895-161669917 AGAGCCTGTGCGCTGCAGGCTGG - Intronic
1019165208 6:170094025-170094047 ACAGCCTGGGAGGGCCTGGCTGG + Intergenic
1019384416 7:746548-746570 AGAGCCTGGGCACGGCGGGCGGG - Intronic
1020120523 7:5500713-5500735 ACACTCTGTGCGCGGCTGCAGGG + Exonic
1022505104 7:30904848-30904870 CCACCCTGTGTGCTGCTGGCTGG + Intergenic
1025082388 7:55995113-55995135 ACAGTCTGTACGGGGCTGTCTGG + Intronic
1026936961 7:74263029-74263051 ACCTCCTGTGTGCGGCTGGCAGG - Intergenic
1028857566 7:95608863-95608885 ACAGCCTGGGCGGGACTGCCTGG + Intergenic
1033239920 7:139669641-139669663 ACAGCCAGTGGGCGGGTGGGGGG + Intronic
1033717684 7:144019769-144019791 ACAGCCTGTGGGCGGCTATGTGG - Intergenic
1034646201 7:152650004-152650026 GCAGGCTGTGCGTGGCTGGTGGG - Intronic
1034737639 7:153443897-153443919 GCAGACTGTGCCCTGCTGGCTGG + Intergenic
1035203995 7:157282685-157282707 ACAGCCGGGGCGGGGCTGGGGGG + Intergenic
1037717268 8:21411076-21411098 CCAGCCTCTGCGGGTCTGGCTGG - Intergenic
1037748176 8:21662839-21662861 ACAGCCTGGGCAAGGGTGGCAGG - Intergenic
1040026547 8:42786901-42786923 ACACCCTCTGCGCCACTGGCTGG - Intronic
1041712996 8:60910230-60910252 TGAGCCTGTGCTCTGCTGGCTGG + Intergenic
1045159595 8:99523514-99523536 ACAGCCTGTGCTGAGCTGTCTGG - Intronic
1049419098 8:142509090-142509112 ACATGCTGTGAGCCGCTGGCTGG - Intronic
1049694032 8:143974987-143975009 ACCGCCTGGGCGCGGCCGGCAGG + Intronic
1055576399 9:77664006-77664028 AGAGCTTGTGCCCGCCTGGCCGG - Intergenic
1058130056 9:101241512-101241534 GCAGCCTATGGGCTGCTGGCTGG + Intronic
1061843927 9:133376257-133376279 AGGGCCTGCGCGCGGCGGGCGGG - Intergenic
1062119698 9:134827682-134827704 GCAGCCTGTGGACGCCTGGCTGG - Intronic
1062179020 9:135180697-135180719 TCAGCCTGTGTGCTGCTGACCGG - Intergenic