ID: 1160858409

View in Genome Browser
Species Human (GRCh38)
Location 19:1227523-1227545
Sequence TCCGCCTCCCGCGGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160858409_1160858414 -8 Left 1160858409 19:1227523-1227545 CCCAGGGGCCCGCGGGAGGCGGA 0: 1
1: 0
2: 2
3: 18
4: 188
Right 1160858414 19:1227538-1227560 GAGGCGGAGAACCGGTGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160858409 Original CRISPR TCCGCCTCCCGCGGGCCCCT GGG (reversed) Intronic