ID: 1160858409

View in Genome Browser
Species Human (GRCh38)
Location 19:1227523-1227545
Sequence TCCGCCTCCCGCGGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160858409_1160858414 -8 Left 1160858409 19:1227523-1227545 CCCAGGGGCCCGCGGGAGGCGGA 0: 1
1: 0
2: 2
3: 18
4: 188
Right 1160858414 19:1227538-1227560 GAGGCGGAGAACCGGTGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160858409 Original CRISPR TCCGCCTCCCGCGGGCCCCT GGG (reversed) Intronic
900096682 1:942729-942751 TCCGGAGCCCGGGGGCCCCTGGG - Exonic
901567542 1:10131058-10131080 TCCTCCTCCAGCTGGCCCTTAGG + Intronic
901762234 1:11478862-11478884 TCCCCCGCCCGCGGGCGCCAGGG + Intergenic
902809481 1:18880086-18880108 TCTGCCAGCCACGGGCCCCTGGG - Intronic
902917015 1:19645185-19645207 CCTGCCTCCCGCCGGCCCCGAGG + Intronic
902998037 1:20242976-20242998 ACGGCCACCCGCGGGCCCCAGGG + Intergenic
906207516 1:43995103-43995125 TCCTCCTCCAGAAGGCCCCTGGG - Exonic
906325609 1:44843434-44843456 TCCTCCTCCCTGGGGCCCCGCGG - Intergenic
907909598 1:58814782-58814804 TGCGCCTCCTCCGGGCCCCGCGG + Intergenic
908360896 1:63367665-63367687 CCCGCCGCCCGCCGGCCGCTGGG - Exonic
911601239 1:99850161-99850183 TTCGCCTCGCGCGGGTTCCTGGG - Intronic
912115198 1:106397633-106397655 TCCACCTGCCGCGGCCTCCTGGG - Intergenic
913644615 1:120844614-120844636 TCAGCCTCCCTAGGGCCCCCAGG - Intergenic
914082121 1:144418969-144418991 TCAGCCTCCCTAGGGCCCCCAGG + Intergenic
914098984 1:144567862-144567884 TCAGCCTCCCTAGGGCCCCCAGG - Intergenic
914177024 1:145287469-145287491 TCAGCCTCCCTAGGGCCCCCAGG + Intergenic
914300001 1:146369804-146369826 TCAGCCTCCCTAGGGCCCCCAGG + Intergenic
914531752 1:148528961-148528983 TCAGCCTCCCTAGGGCCCCCAGG + Intergenic
914636638 1:149558768-149558790 TCAGCCTCCCTAGGGCCCCCAGG - Intergenic
918514062 1:185343078-185343100 TCCGTCTCCAGAGGGCTCCTGGG - Intergenic
922504792 1:226120328-226120350 TCGGCCTTCCTGGGGCCCCTTGG - Intergenic
1065502043 10:26392102-26392124 TCCGCGTCGCGCGGGCCCGCGGG + Intergenic
1069021934 10:63498882-63498904 TCCACCTCCCATGAGCCCCTGGG + Intergenic
1069615086 10:69801808-69801830 TCCACCTCCCGCGGGGCCGACGG - Intergenic
1070895802 10:79982239-79982261 GCCGCCGCCCGCGGTCCCATTGG - Intronic
1072970078 10:100009844-100009866 TCCGCCGCCCGGCGGTCCCTCGG + Exonic
1073048858 10:100655262-100655284 TCTGCCTCTCGCGGTCTCCTCGG + Intergenic
1075798579 10:125137940-125137962 TGCCCCTCCCGCGGTCCCCTGGG - Intronic
1075890032 10:125940567-125940589 TCTGTCTCCTGCGTGCCCCTGGG - Intronic
1076431939 10:130410174-130410196 TGAGCCTCCCCTGGGCCCCTTGG + Intergenic
1076482173 10:130792053-130792075 TCCACCTCCCCCGGCCACCTAGG - Intergenic
1076650366 10:131982667-131982689 CGCGCCTCTCCCGGGCCCCTGGG - Intergenic
1076898301 10:133325024-133325046 TCTGCCTCCCGGGGGACCCCTGG - Intronic
1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG + Exonic
1083915941 11:65743951-65743973 CCCAGCTCCCGCTGGCCCCTTGG - Intergenic
1084967455 11:72752042-72752064 TCAGCCGCCCTCGGGCGCCTTGG - Intronic
1085035383 11:73296901-73296923 TCTGCCACCCGCTGGCCCCCTGG + Exonic
1085507190 11:77067218-77067240 TGCACCTCCCGCGGGCCCGGGGG + Intronic
1085520760 11:77137781-77137803 TCCTCCTCCCGCAGCCCCCGAGG - Intronic
1089428617 11:118401806-118401828 CCCGGCACCCGCAGGCCCCTCGG - Exonic
1090780634 11:130003279-130003301 CCCGCCTCCCGCGCGCCCGAGGG + Intergenic
1091108673 11:132944763-132944785 TCCGCTTCCCTTGGGCCCCTCGG + Intronic
1093768952 12:22997910-22997932 TCTGCCTCCAGCTGGTCCCTGGG + Intergenic
1094496780 12:30993820-30993842 GCCGCCTCCCCCTGGCACCTCGG - Exonic
1096127726 12:49131643-49131665 TCCGACTCGCGCCCGCCCCTCGG - Intergenic
1097192644 12:57226812-57226834 GCCACCTCCCGCCGGCCCCGTGG - Intergenic
1098986136 12:77014602-77014624 TGAGCCTCTCCCGGGCCCCTGGG + Intergenic
1102687623 12:114736613-114736635 TCCTCCTCCCCCGCGCCCCCTGG + Intergenic
1103800440 12:123534010-123534032 TCCGCCGCCCGGGGGCGCCCCGG + Intergenic
1104030913 12:125065401-125065423 GCCGCCTCCTGCGGGCCGCTTGG - Exonic
1105426853 13:20301818-20301840 ACAGCCTCCCGCGGGCCTCTTGG + Intergenic
1106269824 13:28141707-28141729 TCCGCCTGCCTCGGCCTCCTAGG + Intronic
1110318512 13:74135309-74135331 CCCGCCGCCCCCGGGCCCCGCGG - Intergenic
1113719812 13:112546691-112546713 TCTGTGTCCAGCGGGCCCCTGGG - Intronic
1113985697 13:114314275-114314297 TCCGCTTCCCGCGCGCGCCCGGG - Intergenic
1122065821 14:99174022-99174044 GCCGCCTCCCCTGGGCCCCGGGG + Exonic
1122162227 14:99793118-99793140 TCTGCCGCCCGCTGTCCCCTTGG - Intronic
1125956219 15:43792741-43792763 CACGCCTCCAGCTGGCCCCTTGG + Intronic
1126134681 15:45378593-45378615 GCCGCCCCCCGCGGCCCCATTGG + Exonic
1127916828 15:63461472-63461494 TCTGCCGACCGCGGGCCCCTAGG - Intergenic
1129667906 15:77589809-77589831 ACCGCCCCCCGCCGACCCCTGGG - Intergenic
1130353093 15:83108075-83108097 TCCGCTCCCCACCGGCCCCTGGG - Intronic
1131275011 15:90973558-90973580 TCCGTCTCCTGCATGCCCCTGGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132741273 16:1414515-1414537 TCCGCCGCCCCCGCGCCCCCCGG - Intronic
1132821640 16:1875505-1875527 TCAGCCTCCCGTGGGACCGTAGG + Intronic
1132853152 16:2033714-2033736 GCCGCCTCCCGCCAGGCCCTCGG - Intronic
1133271908 16:4614494-4614516 TCCGCCCGCCGCGAGCCCTTGGG + Intronic
1135775990 16:25257885-25257907 GACGCCTCGCGCGGGCCCCGCGG - Exonic
1136419505 16:30123124-30123146 TCCACCTCCCCCGGGACCCCCGG + Exonic
1141075960 16:81006892-81006914 CCCGCCGCCCGCGGGCCCCAAGG + Exonic
1141739865 16:85884000-85884022 TGTGCCTCCCGCTGTCCCCTGGG + Intergenic
1142150130 16:88509021-88509043 TCTGCCTCCCGTGTGACCCTGGG + Intronic
1142426945 16:90006492-90006514 TCCCCTTCCCGCATGCCCCTAGG - Exonic
1142671250 17:1488310-1488332 TCCGCCGCTCGCGGGCCCCAGGG + Intronic
1144574398 17:16419925-16419947 TCCTCCTCCCGGGGTCCCCTAGG + Intronic
1145271721 17:21408391-21408413 TCCACCTCCTGTGGGGCCCTGGG + Intronic
1145280566 17:21464236-21464258 CCAGCCGCCCGCCGGCCCCTGGG - Intergenic
1146703323 17:34980823-34980845 CCCGCCTCACGCGGCCCCGTGGG - Intronic
1147943419 17:44066286-44066308 TCCCCCTCCCGCGGGCCCTTCGG - Intronic
1150002697 17:61451753-61451775 TCCAGCGCCCGCGGCCCCCTGGG + Intergenic
1150291451 17:63984846-63984868 TCGGCCTCCCTCCAGCCCCTTGG + Intergenic
1151625027 17:75271097-75271119 TCTCCCGCCCGCGGGACCCTGGG - Exonic
1151681258 17:75624060-75624082 TCCCCTTCCCACGGGCACCTTGG - Intergenic
1152199123 17:78934994-78935016 TCAGCCCCCAGAGGGCCCCTAGG + Intergenic
1153615235 18:6928147-6928169 CCCACCTCCCGCTGGCCCCGTGG + Intergenic
1156008579 18:32470972-32470994 TCCGCCTCCCGCAGCTCCCGCGG + Intergenic
1160668348 19:344270-344292 TCCGCCGCCCGCGAGCCCCCCGG - Intronic
1160858409 19:1227523-1227545 TCCGCCTCCCGCGGGCCCCTGGG - Intronic
1160860488 19:1235430-1235452 TCGGCCACCCGCCGCCCCCTCGG - Intronic
1161148760 19:2695570-2695592 TCCACCTCCCCGGTGCCCCTGGG - Intronic
1161482661 19:4518558-4518580 GCCACCTCCCCCGGGCCCATTGG - Intergenic
1162396475 19:10420501-10420523 TCCGCGTTCCGCGGCCCGCTCGG - Intronic
1162572130 19:11479970-11479992 GCAGCCTCGCGCGGGCGCCTCGG - Intronic
1163034837 19:14564478-14564500 CCCGCCCCCGTCGGGCCCCTAGG + Intronic
1163443791 19:17334746-17334768 TCCTCCTCCCGCGCGCTCCGCGG - Exonic
1163507994 19:17719631-17719653 CCGGGCTCCCGCGGGCCCCCAGG - Intronic
1163687437 19:18719748-18719770 TCAGCCGCCCGCAGGCCTCTGGG - Intronic
1165010675 19:32844036-32844058 TGAGCCTCCCGAGGGCTCCTTGG - Intronic
1165939857 19:39409698-39409720 CCCGCCTCCCGCGGCCCCGTGGG - Intergenic
1165993053 19:39826905-39826927 TCCCCCGCCCGCCGGCCCCCGGG + Exonic
1166771726 19:45287485-45287507 TCCGCCTCCCCCGTGCTCGTCGG - Exonic
1166808333 19:45499980-45500002 TCTGCTTCCCTGGGGCCCCTAGG + Exonic
1167240656 19:48341275-48341297 TCAGCCTCCACCTGGCCCCTGGG + Intronic
1167378594 19:49125642-49125664 TCCTCCTCCCCCAGGCCCCTGGG - Intronic
1167591089 19:50404838-50404860 TCCGCCTCCCAGGGGGCGCTGGG + Intronic
1167641964 19:50687117-50687139 CCCGCCTCCCTCGGGGCCCCGGG + Intronic
1167645309 19:50702572-50702594 TCCGCCTCCCGCGGCTGCCCAGG + Exonic
1167660175 19:50791745-50791767 TCGGCCTCCAGCGGGCCTCGGGG - Exonic
1168322098 19:55516960-55516982 CCCGCAACCCGCGTGCCCCTCGG + Intronic
925068915 2:951024-951046 GCCGCCTCCCGCGGACGCCAGGG + Exonic
925392445 2:3505724-3505746 TCCCCCTCCCCCGGGTCCATGGG + Intronic
926901161 2:17753557-17753579 TCCTCCGCCCGCTGCCCCCTTGG - Intronic
928904818 2:36356976-36356998 TCTGCCGCGCGCGAGCCCCTCGG + Intronic
929484242 2:42340283-42340305 TCTGCCTTCCTCGCGCCCCTGGG + Intronic
929776902 2:44935668-44935690 TCGGCCTCTCCCGGCCCCCTCGG + Intergenic
930035855 2:47084587-47084609 TCCGCCTCTCTCAGGCCTCTTGG - Intronic
934862908 2:97779396-97779418 TCTGCCTCCCGCTTGCCCCTGGG + Intronic
935133294 2:100277526-100277548 TCATCCTCCCGCAGACCCCTTGG + Exonic
935171228 2:100612714-100612736 TCCGCCTCCTGCAGGCCCAGGGG + Intergenic
935406611 2:102716908-102716930 TCTGCCTCTCGTGGCCCCCTCGG + Exonic
947602751 2:231464639-231464661 TCCCCCTCCCGTGGCCGCCTCGG - Intronic
948116022 2:235494612-235494634 TCGGCGGCCCGCGGGCCCCGGGG + Exonic
948207151 2:236168313-236168335 GTCGCCTCCCGCGGGCCGCTGGG + Exonic
948645285 2:239400596-239400618 TCCACCTGCCGCGGGCTCCAAGG + Exonic
1171159146 20:22905924-22905946 GCTTCCTGCCGCGGGCCCCTGGG + Intergenic
1172759732 20:37313740-37313762 TCCTCCCTCCTCGGGCCCCTAGG - Intronic
1175844962 20:62053314-62053336 TCCGGCTCCCGCGGCCTCATGGG - Intronic
1175856044 20:62121838-62121860 CCCGCCCCCCGCCGGCACCTGGG + Intergenic
1175991009 20:62789122-62789144 TCCCCTTCCCGTGGCCCCCTGGG - Intergenic
1176156907 20:63626680-63626702 TCGGCCTCCAGCGGCCTCCTCGG - Intronic
1179910177 21:44443280-44443302 CCCGCCACCTGCGAGCCCCTTGG - Intergenic
1180109666 21:45642250-45642272 CCCGCCTCCCGCGAGCGCCAGGG - Intergenic
1181486903 22:23237321-23237343 ACCTCCTCCCACGGCCCCCTGGG + Intronic
1183386359 22:37517809-37517831 TCAGCCTACCGTGGGGCCCTGGG + Intronic
1183484697 22:38082616-38082638 TCCGCCTCCCCGGGACCCCTGGG - Intronic
1183546286 22:38456042-38456064 GCCCCCTCCCGCGGGGCCCGCGG + Intergenic
1183698343 22:39435890-39435912 CCCACCTCCCGGGTGCCCCTGGG + Intronic
1184236265 22:43184738-43184760 TCAGCCTCACGCTGTCCCCTAGG - Intronic
1185297201 22:50060289-50060311 TCCTCGTCCCGAGGGCGCCTGGG - Exonic
1185324264 22:50217989-50218011 TCTGCACCCCGCGGGCCCCCAGG + Exonic
950198041 3:11023186-11023208 TCCACCTCCCGGGTGTCCCTGGG - Intronic
950404526 3:12796563-12796585 CCCGCCTCCCGCGGCCGCCACGG + Intronic
951721984 3:25710051-25710073 TCCGCCTGCCTCAGTCCCCTAGG - Intergenic
954378031 3:50205177-50205199 CCCTCCTCCCGCGGGCCGCCAGG + Intergenic
956229604 3:66998590-66998612 GCCGCCTCCCGCTGCCTCCTGGG - Intronic
961364398 3:126390077-126390099 GCCTCTTCCCGCGGCCCCCTCGG - Intergenic
963028455 3:140942388-140942410 TCCGCCTCACCCCGGCCCCGCGG - Intronic
963063326 3:141242311-141242333 CCAGCCTCCAGCGGGCCCCATGG - Intronic
966596117 3:181726035-181726057 TCCCCCAGCTGCGGGCCCCTTGG - Intergenic
966808691 3:183825373-183825395 CCAGCCTCCCGCGGGCGCCCGGG - Exonic
966866120 3:184260041-184260063 GCCCCCGCCCGCGGGCGCCTGGG + Exonic
967316269 3:188154282-188154304 CCCTCCACCCGCGGGCGCCTCGG + Intronic
968428209 4:536845-536867 TCCGTCTCCAGCTGGCCACTGGG - Intronic
968671755 4:1855885-1855907 CCCGCCTCCCGCCGCCGCCTCGG - Exonic
968809477 4:2793417-2793439 GCAGCCTCCCCCGGGCCCCGGGG + Intronic
969877967 4:10149923-10149945 TGCGCCTCCTGGGGACCCCTGGG + Intergenic
977693926 4:99946765-99946787 CCCGCCCCCCGCGGGCCCCTAGG + Intergenic
977809697 4:101346055-101346077 CCCGCCTCCCGCGCCCCCCGCGG + Intronic
982200210 4:152953014-152953036 TCAGCCTCCCGAGGGCAGCTGGG - Intronic
984778387 4:183504209-183504231 CCCGCCTCCTGCCGGGCCCTCGG - Intergenic
985806945 5:2052858-2052880 TCCGCCTCCTCCGGTCCTCTGGG + Intergenic
986317652 5:6601405-6601427 TCCGCCTCCAGCAGGTCCCCAGG + Intronic
986402888 5:7396343-7396365 TCCGCCGCCCGCCGCCTCCTCGG - Exonic
988722442 5:33892151-33892173 TCCGCCTCCCGCATGCCCCGCGG + Exonic
992342339 5:75837637-75837659 TTCCCCTCCCCCGAGCCCCTGGG + Intergenic
995804763 5:116038961-116038983 TCCGCCACCCCTGGGCCCCAGGG - Intronic
1002784995 6:393455-393477 TCCGCCCCGCGCGGTCCCCTGGG - Intronic
1004650117 6:17600414-17600436 TCGGGCTTCCTCGGGCCCCTCGG - Exonic
1007630473 6:43270377-43270399 TTGGCCTCCCGCCAGCCCCTCGG - Intronic
1010211120 6:73363465-73363487 TCCTACTCCCGCAGGCCGCTTGG + Intronic
1013575970 6:111483510-111483532 CCCCCCTCCCGCAAGCCCCTCGG - Intronic
1017103083 6:150865681-150865703 TCCTCGTCCCAGGGGCCCCTAGG - Exonic
1019172543 6:170141770-170141792 TCCTCATCCCGCTGGCCCCCTGG + Intergenic
1019332077 7:465160-465182 TCCGCCTCCCCAGGGCCGCCGGG + Intergenic
1019497455 7:1347093-1347115 TCCCCCTCCTGCCGGCTCCTGGG + Intergenic
1019828230 7:3301299-3301321 TCCGCGCCCGGCGGACCCCTCGG + Intergenic
1022427921 7:30285449-30285471 GCCGCCGCCCGCGGTCCCATTGG - Exonic
1023623640 7:42096006-42096028 GCCTCCTCCCTCTGGCCCCTTGG - Intronic
1031447518 7:121873019-121873041 TCCGCCCCCCGCGCGACCCCGGG + Intergenic
1032151784 7:129435050-129435072 GCTGCCTGCGGCGGGCCCCTGGG + Intronic
1032674539 7:134116756-134116778 ACCTCCTCTCTCGGGCCCCTGGG - Intergenic
1034618125 7:152436152-152436174 TCCTCCTGCCGCGGGCGGCTCGG - Intergenic
1036748708 8:11429456-11429478 CCCGCCTCCAGGGGGCCCCTTGG - Intronic
1037928755 8:22865214-22865236 TCCCCCTCCCGCCGCCCCCCAGG - Intronic
1042246369 8:66712683-66712705 TCGGCCTCCCGCGCGCTCCGCGG + Intronic
1045115417 8:98974572-98974594 TCCTCCTCCCGCAGGGCCCCTGG - Intergenic
1046962346 8:120124879-120124901 TCCGGCTGCCGCGCGCACCTGGG + Intronic
1049372233 8:142273401-142273423 TCTGCCTCCTGGAGGCCCCTGGG + Intronic
1049777558 8:144413634-144413656 TCCGCCTCCCGCGGTGATCTGGG - Intronic
1057772946 9:97983788-97983810 TTTGCCGCCCGCGGGCCCCTGGG + Intronic
1060309714 9:122448417-122448439 TCCGTCTCCTGCCTGCCCCTGGG - Intergenic
1060979896 9:127785932-127785954 TCCGGCTCCCCCTGGCCTCTCGG + Intronic
1061478420 9:130884442-130884464 TCCGCCTCCTGCGTTCCCCATGG + Exonic
1061991948 9:134163938-134163960 CCCGTCTCCCGAGGGCGCCTCGG - Intergenic
1062117833 9:134818699-134818721 TCGGCCCCCAGGGGGCCCCTGGG + Exonic
1062123431 9:134846644-134846666 TCCTCCTCCCACTGGCCCCAAGG + Intergenic
1062417682 9:136461085-136461107 TCCGCCTGCCGCCTGCCCCCAGG + Intronic
1185593316 X:1292767-1292789 TCCGTCTCCTGCCTGCCCCTGGG - Intronic
1186739148 X:12498704-12498726 GCCGCCTCCCTCGGGAACCTGGG + Exonic
1187403891 X:18984902-18984924 GCCGCCTACCGCGGCCGCCTGGG + Intergenic
1189974401 X:46447238-46447260 TCCGCTTCCCACCGCCCCCTGGG - Exonic
1189984947 X:46545456-46545478 TCCGCTTCCCACAGCCCCCTGGG + Intronic
1192154444 X:68733320-68733342 TCCTCCTCCCACTGGTCCCTTGG + Intergenic
1198371172 X:135990686-135990708 TCCGCCTCCCGAGTGCCCACTGG - Intronic
1200068209 X:153515032-153515054 GCCTCCTCCCCCGGGCCCCCAGG - Intergenic
1200100759 X:153688307-153688329 GCCGCCGCCCGCGCGCCCCCGGG + Exonic
1200216841 X:154371793-154371815 TCCCCCTTCCCCGGGCCCCCAGG + Intronic
1200238810 X:154483022-154483044 TCTTCCTCCCGTGGGCCCTTGGG + Intergenic