ID: 1160859388

View in Genome Browser
Species Human (GRCh38)
Location 19:1231209-1231231
Sequence GAGAGCACGGAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 966
Summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 872}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160859388_1160859399 15 Left 1160859388 19:1231209-1231231 CCCTCCTCCTGCTCCGTGCTCTC 0: 1
1: 0
2: 4
3: 89
4: 872
Right 1160859399 19:1231247-1231269 CCGCTGGAAGTGGTGCCGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 102
1160859388_1160859394 -1 Left 1160859388 19:1231209-1231231 CCCTCCTCCTGCTCCGTGCTCTC 0: 1
1: 0
2: 4
3: 89
4: 872
Right 1160859394 19:1231231-1231253 CACTGGCTGCCCGCTGCCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 195
1160859388_1160859401 17 Left 1160859388 19:1231209-1231231 CCCTCCTCCTGCTCCGTGCTCTC 0: 1
1: 0
2: 4
3: 89
4: 872
Right 1160859401 19:1231249-1231271 GCTGGAAGTGGTGCCGCTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 137
1160859388_1160859402 18 Left 1160859388 19:1231209-1231231 CCCTCCTCCTGCTCCGTGCTCTC 0: 1
1: 0
2: 4
3: 89
4: 872
Right 1160859402 19:1231250-1231272 CTGGAAGTGGTGCCGCTTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 167
1160859388_1160859395 5 Left 1160859388 19:1231209-1231231 CCCTCCTCCTGCTCCGTGCTCTC 0: 1
1: 0
2: 4
3: 89
4: 872
Right 1160859395 19:1231237-1231259 CTGCCCGCTGCCGCTGGAAGTGG 0: 1
1: 0
2: 1
3: 19
4: 184
1160859388_1160859400 16 Left 1160859388 19:1231209-1231231 CCCTCCTCCTGCTCCGTGCTCTC 0: 1
1: 0
2: 4
3: 89
4: 872
Right 1160859400 19:1231248-1231270 CGCTGGAAGTGGTGCCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160859388 Original CRISPR GAGAGCACGGAGCAGGAGGA GGG (reversed) Exonic
900096163 1:940990-941012 TCGGGCACGGGGCAGGAGGATGG - Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900553657 1:3269218-3269240 GACAGCTGGGAGGAGGAGGACGG + Intronic
900852714 1:5156708-5156730 GGGAGCAGGGACGAGGAGGAAGG + Intergenic
900970514 1:5990101-5990123 AGGAGCAAGGAGCAGGTGGAAGG - Intronic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
901513574 1:9730581-9730603 GAGAGCAGCGAGGAGGAGGAGGG - Exonic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901807403 1:11747365-11747387 GAGACGCCGGAGCAGGAGGGAGG + Intronic
902289008 1:15424655-15424677 GAGGGCACAGAGCAGGACGGGGG - Intronic
902404764 1:16176572-16176594 GGGAGCTTGGAGGAGGAGGATGG - Intergenic
902488476 1:16763704-16763726 GGGAGCCCAGGGCAGGAGGAGGG - Intronic
902546522 1:17193849-17193871 GAGAGCAGGAGGCAGGAGGTGGG + Intergenic
902583897 1:17426317-17426339 GTGAGAAGGGAGCAGGAGGTGGG - Intronic
902608717 1:17584282-17584304 GGGAGCCTGGGGCAGGAGGATGG - Intronic
902618971 1:17639547-17639569 GAGAGAAGGGAGATGGAGGAAGG - Intronic
902784249 1:18722719-18722741 GCCAGCAGGGAGCAGGAGGGAGG + Intronic
903004772 1:20291418-20291440 GAGAAGAGGGAGCAGGAGAAGGG - Intronic
903041470 1:20533758-20533780 GAGAGCAAGGAGTAGGAACAAGG + Intergenic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903735679 1:25528695-25528717 GTGAGCCTGGAGCGGGAGGAGGG - Intergenic
903745697 1:25585278-25585300 GAGAGCACGCAGCAGGTGTGTGG + Intergenic
903989188 1:27253408-27253430 GGGAGGAGGGAGGAGGAGGAGGG - Intronic
904044610 1:27602274-27602296 GCGGGCACAGAGCGGGAGGAGGG - Intronic
904045100 1:27603958-27603980 GAGAGCAGAAGGCAGGAGGAGGG - Intronic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904428525 1:30447070-30447092 GACATCAGGGAACAGGAGGAGGG + Intergenic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906008339 1:42499578-42499600 GAGAGGCTGGAGCAGGAGGATGG - Intronic
906323300 1:44829550-44829572 GATAGGAGGGGGCAGGAGGAGGG + Intronic
906836243 1:49086016-49086038 GAGACCACGGGGCTGGAGGCTGG - Intronic
907339898 1:53727396-53727418 GAGAGCTGGGAGCCAGAGGATGG - Intronic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
908168711 1:61483955-61483977 GGGAGCCCTGGGCAGGAGGAGGG + Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
908996262 1:70159221-70159243 GAGAGGCCAAAGCAGGAGGATGG + Intronic
909553729 1:76929299-76929321 GAGAGGCCGAGGCAGGAGGATGG + Intronic
909736692 1:78970744-78970766 GAGAGGACAGAGGAGGAGAAAGG - Intronic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
909863582 1:80637788-80637810 GAGAGAACAGAGGAGGAGAAAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910373484 1:86543525-86543547 AGAAGCAGGGAGCAGGAGGAAGG + Intergenic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
911078140 1:93900064-93900086 GAGATCACCTAGCAGTAGGAAGG - Intronic
912449124 1:109758773-109758795 GAGACCAGGGAGCAGGGGGTGGG - Intronic
912500950 1:110121559-110121581 GAGAGGAGGGACCAGCAGGACGG - Intergenic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913565219 1:120066992-120067014 GAAAACAAGGAGCAAGAGGATGG + Intronic
913632911 1:120726567-120726589 GAAAACAAGGAGCAAGAGGATGG - Intergenic
914619724 1:149393570-149393592 GAAAACAAGGAGCAAGAGGATGG - Intergenic
914951604 1:152120154-152120176 GAGAGGAAGGATCAGAAGGAGGG - Intergenic
915147240 1:153802413-153802435 GGGAGCATGGAGCAGGAGGAGGG + Intergenic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916379094 1:164188721-164188743 GAGAGCAGAGGACAGGAGGAGGG - Intergenic
916924866 1:169507549-169507571 GAGTGCATTGAGGAGGAGGATGG + Intergenic
917369844 1:174280693-174280715 GAGAGCACTTAACAAGAGGATGG + Intronic
917557087 1:176101427-176101449 GAGAGGACAGAGGAGGAGAAAGG - Intronic
918034647 1:180855898-180855920 GAGAGCAGTGCACAGGAGGAAGG - Intronic
918292547 1:183122739-183122761 GAGCTCACAGAGAAGGAGGAGGG + Intronic
918346702 1:183613693-183613715 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919732453 1:200921940-200921962 GAGAGGTCAGAGCAGGAGAAAGG - Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920098096 1:203499706-203499728 GAGGGCATGTAGCAGGCGGAAGG - Exonic
920171096 1:204073059-204073081 GAGAGCGCGCAGGGGGAGGAGGG - Intergenic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920446573 1:206022851-206022873 GAGAGGTGGGAGCGGGAGGAAGG - Intronic
920528443 1:206685161-206685183 GGGGGCCCGGAGCCGGAGGAGGG + Exonic
920829067 1:209449308-209449330 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
920890433 1:209979595-209979617 GAGAGTAGGGGGCAGCAGGAGGG - Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921733404 1:218599561-218599583 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
922006016 1:221531464-221531486 GAGAGAAGAGAGCAGGGGGAGGG - Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922609423 1:226913510-226913532 GAGAGCACAGACCAGGAGCCGGG - Intronic
922722679 1:227906625-227906647 GGGAGGAGGGAGTAGGAGGAGGG - Intergenic
922724989 1:227918461-227918483 GGGACCAGGGAGGAGGAGGAAGG - Intergenic
922754652 1:228089011-228089033 GAGAACACGCAGGAGGAGGCTGG + Intronic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923042093 1:230326826-230326848 GAAAGGACGGAGCTGGGGGATGG - Intronic
923488913 1:234465359-234465381 GAGAGCAGGAAGCAGCAGTAGGG + Intronic
923531963 1:234818812-234818834 GGGAGCCCAGGGCAGGAGGAGGG + Intergenic
923771021 1:236937420-236937442 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
924061752 1:240182235-240182257 GAGAACCTGGAGCAGGAGCAAGG + Intronic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924680341 1:246224626-246224648 GAAAGGAAGGAGGAGGAGGAAGG + Intronic
924817015 1:247451551-247451573 GAGAGCACGGTGCATGAGAACGG + Exonic
1063042492 10:2357762-2357784 GAGAGGCCGAGGCAGGAGGATGG - Intergenic
1063366414 10:5493614-5493636 GAGAGGAGGGGGCAGGAGGGAGG - Intergenic
1063731172 10:8698880-8698902 GAGAGTAGGGAGTGGGAGGAGGG - Intergenic
1064985677 10:21207648-21207670 GAGATCATGGAGCAGGGGAAGGG + Intergenic
1065425268 10:25596352-25596374 GGGAGGCTGGAGCAGGAGGATGG + Intronic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066384702 10:34932296-34932318 GGGAGCCTGAAGCAGGAGGATGG - Intergenic
1066496435 10:35946928-35946950 GAGAGAACAGATCTGGAGGAAGG + Intergenic
1066710740 10:38230877-38230899 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
1066979275 10:42396623-42396645 GAGAGGACAGAGGAGGAGAAAGG + Intergenic
1067317714 10:45184042-45184064 GAGAGGCCGAGGCAGGAGGATGG - Intergenic
1067469704 10:46527614-46527636 GGCAGCAGGGAGGAGGAGGATGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067807149 10:49400664-49400686 GAGAGCACAGCCCAGGAGGAAGG + Intergenic
1069553358 10:69380249-69380271 GAGAGGCCGAGGCAGGAGGAAGG + Intronic
1069562717 10:69442034-69442056 GAGAGCAGGGGACAGGAGGAAGG + Intergenic
1069595012 10:69664837-69664859 GAGGGCAGTGAGCTGGAGGAAGG - Intergenic
1069837683 10:71319462-71319484 GAGAGCAAGGAGAGAGAGGAGGG - Intronic
1069854375 10:71431739-71431761 GAGAGAATAGAGCAGGGGGAAGG - Intronic
1069893206 10:71664812-71664834 GAGAGAAGGGAGGAGGGGGAAGG - Intronic
1070285062 10:75076945-75076967 GAGAACACAGAGCAAGAGAAAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070439683 10:76431354-76431376 GAGAGAACTGAGCTGTAGGAGGG - Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070483610 10:76909507-76909529 GAGACAAGGGTGCAGGAGGATGG - Intronic
1070596451 10:77835928-77835950 GGGAGCAAGGGGCAGGAAGAGGG + Intronic
1070607420 10:77908599-77908621 GAGAGCACAGAGCAGGACTTGGG - Intronic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070692656 10:78539125-78539147 GAAAGCATGGAGCAGGAACAGGG - Intergenic
1070763867 10:79045181-79045203 GGCAGCTCGGACCAGGAGGAGGG + Intergenic
1070783624 10:79150913-79150935 GAGAGCACCCACCAGGAGGGAGG - Intronic
1071011157 10:80942211-80942233 GAGAGAAGGAAGCATGAGGAGGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071849950 10:89558516-89558538 GAAAGCACGGAAAAGGAGAAAGG + Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072524814 10:96262329-96262351 GGAAGCACAGACCAGGAGGAAGG + Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1073316956 10:102589025-102589047 GGGAGGCTGGAGCAGGAGGATGG - Intronic
1073444189 10:103571138-103571160 GGGAGCAGGAAGCAGGAGGCGGG - Intronic
1073547393 10:104362577-104362599 GAGATGGGGGAGCAGGAGGAGGG - Intronic
1074532158 10:114305303-114305325 GAGGGGACGGAGCTGCAGGAGGG + Intronic
1074995569 10:118754734-118754756 GAAAGCATGGAAGAGGAGGAGGG - Exonic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075257846 10:120939505-120939527 GAGAGCTCAGGGAAGGAGGAAGG - Intergenic
1075800710 10:125151905-125151927 GTGGGCACGGAGCGGGGGGAGGG + Intronic
1075918593 10:126190867-126190889 TAGAGCACGCAGCAGGTGGGAGG + Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076246030 10:128948622-128948644 GTGTGCACGGCCCAGGAGGAAGG + Intergenic
1076770010 10:132657634-132657656 GAGCTCACAGAGGAGGAGGAGGG - Intronic
1076798328 10:132809460-132809482 GGGAGCGAGGGGCAGGAGGAAGG - Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077438955 11:2559407-2559429 TAGAGCCCGGGGCAGGGGGAGGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078128137 11:8588049-8588071 GAGAGGACAGAGCAGGAAGATGG - Intronic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1079062138 11:17258425-17258447 GAGAGGCCAAAGCAGGAGGATGG - Intronic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1080824284 11:35834872-35834894 GACAGCAGTGAGCAGGGGGAAGG - Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081615625 11:44589297-44589319 GAGAGCTGTGAGCAGCAGGATGG - Intronic
1081906622 11:46674415-46674437 GAGAGGTTGGAGGAGGAGGAGGG - Intronic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083780637 11:64915636-64915658 GAGGGCAGGGAACAGGAGTAGGG + Intronic
1083979561 11:66155872-66155894 GAGAGCTCTGAGCAGGAAAAAGG + Intronic
1084299076 11:68234033-68234055 GGGAGGACGAAGCAGGAGGTTGG - Intergenic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084432855 11:69121368-69121390 GAGAGCCCTGAGCAGGAGCCTGG - Intergenic
1084565973 11:69929253-69929275 GGGAACACTGAGAAGGAGGATGG - Intergenic
1084975976 11:72798561-72798583 GAGAGCTCAGATCAGGAGAAGGG - Intergenic
1085248928 11:75128735-75128757 GAGAGCACACAGCAGGAAGCTGG - Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085516208 11:77113279-77113301 GAAGGCACGGAGCAGAAGGAGGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086125542 11:83345113-83345135 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1087014453 11:93542692-93542714 GAAAGAACGGGGGAGGAGGAAGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087236738 11:95727706-95727728 GAAAGCAGGGGGCAGGAGGCAGG + Intergenic
1088363498 11:109016141-109016163 TAGAGCAAGGAGCCAGAGGAAGG + Intergenic
1088649079 11:111941574-111941596 GAGAGGCCGAGGCAGGAGGATGG + Intronic
1089359585 11:117876865-117876887 GCGAGCACAGAGCGGGAGGACGG - Exonic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1090166067 11:124548873-124548895 GAGAACACTGAGCAGCTGGAAGG - Intergenic
1090705207 11:129329878-129329900 GAGAGGAGAGAGCAGGAAGAGGG + Intergenic
1090731509 11:129576702-129576724 AAGAGCACAGGGTAGGAGGAAGG - Intergenic
1091063888 11:132490712-132490734 GAGAGGCTGGGGCAGGAGGATGG + Intronic
1091273619 11:134334648-134334670 GGGAGCAGGGAGGAGTAGGAGGG - Intronic
1091324698 11:134677484-134677506 GAGAGGAGGGAACAGGAGGTTGG - Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091453744 12:590037-590059 GGCAGCAGGGAGCAGTAGGAAGG + Intronic
1091626162 12:2122529-2122551 GAGAGCAAGGACCGGGAGGCCGG - Intronic
1091691066 12:2597878-2597900 GAGTGTATGAAGCAGGAGGAGGG - Intronic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1091915532 12:4269985-4270007 GAGAGCACGGGGGAGCAGGGTGG - Intergenic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1091976750 12:4831559-4831581 GAGAAAGCGGAGCTGGAGGATGG - Intronic
1092233541 12:6791639-6791661 GAGAGGCCGAGGCAGGAGGATGG + Intronic
1092277799 12:7075354-7075376 GAGAGGAAGGAACAGAAGGAGGG - Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093578437 12:20763410-20763432 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094063383 12:26339107-26339129 GAGGGCAGGGAGCGGCAGGATGG - Exonic
1094327595 12:29256918-29256940 GAGACCACGGAGGAGGTGGGAGG - Intronic
1094329422 12:29275004-29275026 TGGAGCAAAGAGCAGGAGGACGG - Intronic
1095261605 12:40105338-40105360 GAGGGCACTGGCCAGGAGGATGG + Exonic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1096232384 12:49903724-49903746 GGGAGCCGGGAGCCGGAGGATGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096593217 12:52676135-52676157 AAGTACACGGAGCAGGAGGAAGG - Intronic
1096633402 12:52943987-52944009 GTGAGCAGGGAGCAGAAGGCTGG + Intronic
1096683159 12:53270266-53270288 GAGCCCAGGGAGCACGAGGAAGG - Intronic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098386133 12:69920722-69920744 GAGAGCATGGAGCGTGAAGAGGG + Intronic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100921660 12:99494884-99494906 AGGAGCAGGGAGCAAGAGGAAGG + Intronic
1102286639 12:111662879-111662901 GAGAGGCCGAGGCAGGAGGATGG + Intronic
1102453219 12:113056670-113056692 GAGGGGGCGGAGGAGGAGGAAGG - Intergenic
1102598745 12:114012888-114012910 GGGAGGAGGGAGAAGGAGGAGGG + Intergenic
1102756149 12:115342534-115342556 GAGAGCAGGGAGGAGGGAGAAGG + Intergenic
1103363609 12:120368155-120368177 GCGAGCCGGGAGCAGGAGGAGGG + Intronic
1103367015 12:120390772-120390794 GAAAGGAAGGAGGAGGAGGAAGG + Intergenic
1103562792 12:121800859-121800881 GGGAGCCCGGAGCAGGAGGCGGG - Intronic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104433047 12:128732441-128732463 GGGAGCAGGGAGCATGATGAGGG - Intergenic
1105446577 13:20462200-20462222 GGGAGGAGGGGGCAGGAGGAGGG + Intronic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1105632990 13:22189736-22189758 GAGAGCACTGAGCCTGAGCAGGG + Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1105916309 13:24920009-24920031 GGGAGGCCGAAGCAGGAGGATGG - Intronic
1106041381 13:26096976-26096998 GGCAGCACGAAGGAGGAGGAGGG + Intergenic
1106153898 13:27134037-27134059 GAGAGCCTGAGGCAGGAGGATGG + Intronic
1106943183 13:34799408-34799430 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1111396211 13:87672389-87672411 GGAGGCACGGAGCGGGAGGAGGG - Intergenic
1111980295 13:95008406-95008428 GAGAGGCCGAGGCAGGAGGATGG + Intergenic
1112248198 13:97753772-97753794 GTGAGCACCTAGCAGGAAGATGG - Intergenic
1112411707 13:99170083-99170105 GAGAGCCTGAAGCAGGAGAACGG - Intergenic
1112445872 13:99463571-99463593 GTGAGCACACAGCAGCAGGAAGG + Intergenic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113179293 13:107607624-107607646 GATATCACAGAGCAGGAGGGAGG - Intronic
1113274651 13:108715197-108715219 GAGCACACGGAGCAGGAGCACGG - Intronic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113323970 13:109265571-109265593 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1113650135 13:112028593-112028615 GAGAGGACGGCACAGCAGGAGGG + Intergenic
1113802878 13:113095639-113095661 GATGGCCTGGAGCAGGAGGACGG - Intronic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114656750 14:24320517-24320539 GAGAGCAGGGAGCAGGCGGTGGG + Intronic
1115240921 14:31250598-31250620 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1115519696 14:34221127-34221149 GAGAGCAGAGAGCAAGAGGAGGG + Intronic
1116194302 14:41702702-41702724 GAGAGGCCCAAGCAGGAGGATGG - Intronic
1116268047 14:42721148-42721170 GAGAGGAGTGAGCAGGAGCATGG + Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116952614 14:50893662-50893684 TGGAGCAAAGAGCAGGAGGATGG - Intronic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117923906 14:60755514-60755536 GGGAGGACGAGGCAGGAGGATGG - Intronic
1118482435 14:66180679-66180701 GAGAGCAGGTAACAGGAGAAAGG - Intergenic
1119198306 14:72733589-72733611 GAGAGGACGCAGCAGGCTGATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119629637 14:76216744-76216766 GAGAGCACTTGGTAGGAGGAGGG + Intronic
1120112009 14:80568269-80568291 GAGAACACGGCGTGGGAGGAAGG - Intronic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1120860192 14:89248071-89248093 GAGGGGTTGGAGCAGGAGGAAGG - Intronic
1120870702 14:89334503-89334525 GAGAGGCTGGAGCAGGAGAATGG + Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121125859 14:91406387-91406409 GAGCTCACAGTGCAGGAGGAGGG + Intronic
1121192025 14:92039546-92039568 GAGGGCACGGAGGAAGTGGAAGG - Exonic
1121333073 14:93060048-93060070 GAGACCAGAGGGCAGGAGGAGGG + Intronic
1121661888 14:95641177-95641199 GAGAGCTGGGGACAGGAGGAGGG + Intergenic
1121667829 14:95686261-95686283 GGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121762549 14:96458191-96458213 GAGAGCATGGAGCAGAATGCAGG + Exonic
1121803774 14:96797150-96797172 AAGACCAGGGAGCAGAAGGACGG + Intergenic
1122122738 14:99563240-99563262 GAGTGGACGGAGAAGCAGGAGGG - Intronic
1122350588 14:101087673-101087695 GAGAGGAGGAAGCAGCAGGAGGG + Intergenic
1122532478 14:102438221-102438243 GGGAGCAGGGAGCGGGAGCAGGG - Intronic
1122625881 14:103085175-103085197 GAGAGCAGAGACCAGCAGGATGG - Intergenic
1122744252 14:103888645-103888667 GCGGGCACAGAGCAGGAGGCAGG + Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124214911 15:27798186-27798208 GAGAGCTTGGAGGAAGAGGAAGG + Intronic
1124583501 15:30983921-30983943 GATAGGATGGGGCAGGAGGAAGG + Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125405920 15:39352625-39352647 GAAAGCACAGAGCTGGAGGATGG + Intergenic
1125420714 15:39501446-39501468 GAGAGAATGGGGCTGGAGGACGG - Intergenic
1125516156 15:40322587-40322609 GAGAGCAGAGAGCGGAAGGAGGG + Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127399531 15:58572531-58572553 GAGGGCAGGGAGCAGCAGGGAGG - Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1128183089 15:65621972-65621994 GAGAGCTGGGGGCAGGAGAATGG + Exonic
1130164186 15:81436219-81436241 AGGAGCAGGGAGCAGGATGAGGG - Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130414489 15:83679719-83679741 GAGAGAAGGGAGCTGGAGAAAGG - Intronic
1130634121 15:85600056-85600078 GGGAGCTTGGAGCAGGAAGAAGG + Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132701851 16:1225352-1225374 GGGAGGACGGAGGAGGAGGCCGG + Intergenic
1133213780 16:4278315-4278337 GGGAGGCCGAAGCAGGAGGATGG - Intergenic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133520172 16:6549233-6549255 GGGAGGAGGGAGTAGGAGGAGGG + Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520246 16:6549425-6549447 GGGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133704757 16:8343189-8343211 GAGAACACGGTGTAAGAGGAAGG + Intergenic
1134235037 16:12459022-12459044 GAGGGGGCGGAGGAGGAGGAAGG - Intronic
1134948706 16:18342113-18342135 GAGAGGAGGGAGGGGGAGGAGGG + Intergenic
1135077184 16:19403634-19403656 GAGAGAACAGAGGAGGAGAAAGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135994365 16:27237252-27237274 GAGAGCAGGCATCAGGAGGGAGG + Intronic
1136291102 16:29271951-29271973 GGGAGGACGGTGCGGGAGGACGG - Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1139059549 16:63232143-63232165 GAGAGGATGAAGCAGGAAGATGG + Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139425047 16:66874020-66874042 GGGAGGAGGGAGGAGGAGGAAGG - Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141470466 16:84234879-84234901 GAGAGCAGGGAGGCTGAGGACGG - Intronic
1141775660 16:86121427-86121449 GATTGCAGGGAGAAGGAGGAGGG - Intergenic
1142186770 16:88698433-88698455 GAGGGGCCCGAGCAGGAGGAGGG + Intronic
1142251468 16:88993834-88993856 GGGAGGAGGGAGGAGGAGGAAGG - Intergenic
1142337874 16:89502016-89502038 GTGGACATGGAGCAGGAGGAGGG - Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142850841 17:2704056-2704078 GAGGGCACAGAGCAAGAGGCTGG + Intronic
1142882841 17:2894880-2894902 GAGAGAACGGAGCGGCTGGAAGG - Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143552950 17:7642477-7642499 GAGAGAACGGAGGAGGGGGGAGG - Intergenic
1143681292 17:8477777-8477799 GAGGGCAGGGAGCGGGAGGGAGG + Intronic
1143923564 17:10349994-10350016 TAGAGCACAGGGCAGCAGGAAGG - Intronic
1144104331 17:11972239-11972261 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1144124977 17:12194864-12194886 GACAGCATGGAGAAGGTGGATGG - Intergenic
1144387801 17:14766055-14766077 TAGAGCACTGAGTATGAGGAAGG - Intergenic
1144491911 17:15720252-15720274 GAGAGCACCAAGCAGGAGTGGGG - Exonic
1144908567 17:18658942-18658964 GAGAGCACCAAGCAGGAGTGGGG + Exonic
1145875991 17:28318694-28318716 GGGAGCCCGAGGCAGGAGGATGG - Intergenic
1145876425 17:28321664-28321686 GGGAGCCCGAGGCAGGAGGATGG - Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146635384 17:34500340-34500362 GAGAAAACAGAGCAGGATGAGGG - Intergenic
1146793091 17:35764054-35764076 GAGGACGCGGAGCAAGAGGAAGG + Exonic
1147143099 17:38470014-38470036 GGGTGCAGGGAGGAGGAGGAAGG - Intronic
1147184343 17:38705463-38705485 GAGGACGCGGAGGAGGAGGAAGG + Intergenic
1147326419 17:39671869-39671891 GAGAGGTTGGAGCAGGATGAGGG - Exonic
1148191427 17:45681331-45681353 GAGAGGGTGGAGCAGGATGAGGG - Intergenic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148546957 17:48526463-48526485 GAAAGCAGGGAGGAGGAGGAAGG - Intergenic
1148617555 17:49012641-49012663 GGGAGGAGGGAGGAGGAGGAGGG - Intronic
1148698185 17:49573588-49573610 GGGAGCACAGAGCGGGAGGAGGG - Intergenic
1148783961 17:50136172-50136194 CAGAGCCTGGAGCAGGAGAAGGG - Exonic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149216379 17:54358988-54359010 GAGAGCACAGAGCAGTAAAAAGG - Intergenic
1149430633 17:56593769-56593791 CGGAGCCCGGAGCAGGCGGAGGG + Exonic
1150146638 17:62774668-62774690 GAGAGGACGTTACAGGAGGAAGG - Intronic
1150245383 17:63670820-63670842 GAGAGCTGGGAGCAAGGGGAAGG + Intronic
1151316440 17:73325374-73325396 GGGAGCAGGGAGGAAGAGGAGGG + Intergenic
1151680959 17:75622480-75622502 GGGAGAACGGAGGATGAGGATGG + Intergenic
1151815693 17:76470380-76470402 GAGAGTGGGGAGCAGCAGGATGG + Intergenic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152100558 17:78299412-78299434 AAGAGCACGGACCAGGAGGTAGG - Intergenic
1152278175 17:79370076-79370098 CAGAGCAGGGAGCATCAGGAAGG - Intronic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1152550991 17:81030140-81030162 GAGAGCACAGAGTGGGAGGTAGG - Intergenic
1152617892 17:81346179-81346201 GGGAGCACGGCGCTGGGGGAGGG - Intergenic
1152753418 17:82077124-82077146 GAGAGCCGGGAGAAGCAGGAGGG + Intergenic
1152837526 17:82543584-82543606 GAGAAACCGGAGCAGTAGGAAGG + Intronic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1152970647 18:158425-158447 GAGAGGAGGGAGGAGGGGGAAGG - Intronic
1153022798 18:646708-646730 GAGAGGACAGAGTGGGAGGAGGG - Intronic
1153624588 18:7012035-7012057 GACAGCCCGGAGCAGAAGCACGG + Exonic
1153957250 18:10108218-10108240 GAGACCACGGACCATGAGTAAGG + Intergenic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1154166112 18:12015581-12015603 GAGAGCCCAGAGCAGGGGAAGGG + Intronic
1154980676 18:21500088-21500110 GGCAGCAGGGAGGAGGAGGATGG - Exonic
1155650383 18:28133917-28133939 GGGAGGCCGAAGCAGGAGGATGG + Intronic
1156445262 18:37231875-37231897 GAGATGAGGGAGCTGGAGGAGGG + Intronic
1156575545 18:38311246-38311268 GAGAGCTGTAAGCAGGAGGAAGG + Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157366203 18:47066563-47066585 GAGATCAAGGAGCAAGAGCAAGG + Intronic
1157660980 18:49443671-49443693 GAGAGCAATGAGCAGGAAAATGG + Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158624036 18:59056572-59056594 GAGAGGATCGAGAAGGAGGATGG - Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1160251226 18:77204953-77204975 GGGAGCACGGAGCAGCGGGAAGG - Intergenic
1160251230 18:77204973-77204995 GGGAGCACGGGGCAGCGGGAGGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1160965609 19:1745856-1745878 GGGAGCAGGGAGAAGGAAGAAGG + Intergenic
1161266341 19:3366467-3366489 GAGAGCAGGAGGGAGGAGGAGGG + Intronic
1161415806 19:4145686-4145708 GGGAGCAGGGAGGAGGAGGAAGG + Intergenic
1161478957 19:4501244-4501266 GAGGACAAGGAGCACGAGGAGGG + Exonic
1161776282 19:6263927-6263949 GGGAGCACGGTGGGGGAGGAGGG + Intronic
1162030585 19:7915631-7915653 GAGAGGCTGAAGCAGGAGGATGG + Intergenic
1162100018 19:8333847-8333869 GACAGCGCCGACCAGGAGGAGGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162237784 19:9321872-9321894 GAGCCCACGGAGGAGGAGGCGGG - Intergenic
1162363949 19:10236581-10236603 GAGAGAACAGTGGAGGAGGAAGG + Intergenic
1162834752 19:13308916-13308938 GAGAGACCAAAGCAGGAGGATGG - Intronic
1162931361 19:13959458-13959480 GAGGGGACGGAGCCGGAGGATGG + Exonic
1163468345 19:17482682-17482704 GAGAGAATGGAGCGGGAGGAGGG + Intronic
1163479776 19:17548248-17548270 AAGGGCACGGAGCGGGAGGCTGG + Intronic
1163756253 19:19108051-19108073 GAGAGCTGGGAGCATGAGGAGGG + Intronic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592602 19:29514470-29514492 GAGAGGGGGGATCAGGAGGAAGG + Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1164914300 19:32038068-32038090 GACAGAACGGGGCAGGAGGGGGG + Intergenic
1164949790 19:32327468-32327490 GAGAAAACGGAGCTGAAGGAAGG + Intergenic
1165095593 19:33408102-33408124 GTAAGGACGGAGCAGTAGGAGGG + Intronic
1165378722 19:35462510-35462532 GAGTGAAGGGAGCTGGAGGAGGG - Intergenic
1165476355 19:36032922-36032944 GGGAGGAGGGACCAGGAGGAGGG + Intronic
1165494301 19:36142617-36142639 GAGAGCTCAGAGCAGGGGGAGGG - Intronic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165694034 19:37886730-37886752 GAAAGGAAGGAGGAGGAGGAAGG - Exonic
1165827282 19:38712618-38712640 GAGGGCACGGGCCAGGAGGGTGG + Intronic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1166342018 19:42143759-42143781 GACTGCACTGGGCAGGAGGAAGG - Intronic
1166672423 19:44718931-44718953 AAGAGAAGGGAGTAGGAGGAGGG + Intergenic
1166745634 19:45140673-45140695 GAGAGGACACTGCAGGAGGAGGG + Intronic
1166797777 19:45438305-45438327 GGGAGGCCGAAGCAGGAGGATGG - Intronic
1166858539 19:45795888-45795910 GAGGGCGAGGAGGAGGAGGAGGG - Exonic
1166948271 19:46410464-46410486 CAGAGCCCGGGGCATGAGGATGG + Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167163800 19:47784482-47784504 GAAACCACGGGACAGGAGGAGGG - Exonic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167686513 19:50960052-50960074 GAGAGGAGGGGGGAGGAGGAGGG + Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1202702722 1_KI270713v1_random:536-558 GGGAGCCCAGGGCAGGAGGAGGG + Intergenic
925317051 2:2934451-2934473 GAGAGGCCTGAGCAGGAGCAGGG - Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925663045 2:6223011-6223033 GATAGCAGGCAGCAGCAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926037414 2:9646400-9646422 GAGAGCAAGGGGCAGGGCGAGGG - Intergenic
926109218 2:10171413-10171435 GGAAGCACGGCTCAGGAGGAAGG - Intronic
926266792 2:11330740-11330762 GGGAGGAGGGAGGAGGAGGAGGG + Intronic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926691277 2:15735716-15735738 GAGAGCATGGAGAATGAAGAAGG - Intronic
926756997 2:16244377-16244399 GAGGGCAAGGAGGAGGAGAAGGG + Intergenic
927150345 2:20191986-20192008 GGGAGCACCTATCAGGAGGATGG + Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927870998 2:26623706-26623728 GGAAGCCCGGAGCAGGAGGAGGG + Intronic
927907620 2:26872179-26872201 GAGAGCAGGGAGCATGAGTCTGG + Intronic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
928077751 2:28280644-28280666 ACCAGCACGGATCAGGAGGAGGG - Intronic
929951370 2:46412082-46412104 GAGAGCCCTGAGAAGGAGGTTGG - Intergenic
930035735 2:47083996-47084018 GAGATCAGCGAGAAGGAGGAGGG + Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932359161 2:71090473-71090495 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
932496749 2:72149385-72149407 GACTGCTCGGAGCTGGAGGAGGG - Intergenic
932699811 2:73984969-73984991 GAGGGGACGGCGCAGGAGGAAGG - Intergenic
932729135 2:74205581-74205603 GGGAGGCCGGGGCAGGAGGATGG - Intronic
933012767 2:77088726-77088748 AGGAGCAAAGAGCAGGAGGACGG - Intronic
933329825 2:80879722-80879744 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933759040 2:85661838-85661860 GAGAGCATGGAAAAGGGGGATGG - Intronic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
935673544 2:105575478-105575500 GGGAGGAGGTAGCAGGAGGAGGG + Intergenic
935679617 2:105624691-105624713 GAGAGGTGGCAGCAGGAGGAGGG - Intergenic
935945134 2:108279270-108279292 GAGGGCTGGGAGCAGGAGGCTGG + Intergenic
935977768 2:108595994-108596016 GAGAGCAAAGATCAGGAGTAAGG + Intronic
936135382 2:109888523-109888545 GAGAGCAAAGATCAGGAGTAAGG + Intergenic
936209315 2:110482962-110482984 GAGAGCAAAGATCAGGAGTAAGG - Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936428501 2:112438201-112438223 GAGAGCAGAGATCAGGAGTAAGG - Intergenic
936607991 2:113976713-113976735 AAGTGCATGGTGCAGGAGGAAGG - Intergenic
936924619 2:117723600-117723622 GAGAGAAGGGAGCAGGAGAAAGG + Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937953718 2:127407903-127407925 GAGAGACAGGAGCAGAAGGAGGG - Intergenic
938227119 2:129625776-129625798 GAGAGGACAGAGCAGGAGTGTGG + Intergenic
938373933 2:130791890-130791912 GAGAGCATGGGGCAGGTGCAGGG - Intergenic
941203986 2:162548540-162548562 GAGACCACAGAGAAGGATGAAGG + Intronic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941340105 2:164296310-164296332 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
941510157 2:166397447-166397469 GAGATCATGGAGCATCAGGAAGG + Intergenic
941686977 2:168456868-168456890 GAGAGCAGGGCCCAGGAGGAGGG - Intronic
942839334 2:180340588-180340610 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
943258640 2:185629716-185629738 GAGAGAACAGAGGAGGAGAAAGG + Intergenic
943420054 2:187658658-187658680 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
943563117 2:189487002-189487024 GAGAGGCTGAAGCAGGAGGATGG - Intergenic
943662144 2:190570578-190570600 GACAGGATGAAGCAGGAGGATGG + Intergenic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
943768405 2:191688423-191688445 GAGAGCACTAGGAAGGAGGAAGG - Intronic
944490625 2:200254657-200254679 GAGACCAGGGAGCAGGCAGATGG - Intergenic
944634107 2:201657841-201657863 GAGAGTAAGGAGCATGAGCAGGG - Intronic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946179965 2:217943083-217943105 GAGAGGGAGGAGCAGGGGGAAGG + Intronic
946200454 2:218068195-218068217 GAGGGCAGGGGGCTGGAGGATGG + Intronic
946236501 2:218327517-218327539 GAGAGCAGAGAGCAGCAGGGAGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946467112 2:219921693-219921715 GAGAGGACGGAGTGGGAAGATGG + Intergenic
946492935 2:220167649-220167671 GAGAGGCTGGGGCAGGAGGATGG - Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947407154 2:229790521-229790543 GGGGGCAGGGAGCAGGGGGAGGG + Intronic
947629716 2:231644269-231644291 GAGAACATGAAGCAGGATGAGGG - Intergenic
947793984 2:232882945-232882967 GGCAGCAGGGAGCAGGAGGATGG + Intronic
948014116 2:234673858-234673880 GAGAGAAAGAACCAGGAGGAAGG + Intergenic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948388768 2:237597704-237597726 GGGGGCAGGGAGCAAGAGGAGGG - Intronic
948781190 2:240322896-240322918 GAGGGCCCGGAGCGCGAGGATGG + Intergenic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948916829 2:241038779-241038801 GAGAGCACTGAGCAAGAGGAAGG - Intronic
1168829993 20:840681-840703 GACAGCATGGAGCACCAGGAGGG + Intronic
1169340962 20:4795839-4795861 GAGTGCCAGGAGGAGGAGGATGG + Exonic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169523726 20:6400734-6400756 GAAAGCAAGGAGCATGAGGCAGG - Intergenic
1169566794 20:6863421-6863443 GAGAGCACAGAACAGGAAGGTGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170140717 20:13122984-13123006 GGGAGCATGGGGCGGGAGGAAGG - Intronic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170429555 20:16263820-16263842 GAGAGCGCAGGGCTGGAGGAGGG + Intergenic
1170930175 20:20762549-20762571 GAGGGCACAGAGCAAGAGAAGGG - Intergenic
1171484275 20:25476326-25476348 GCGAGCACGAAGCTGGAGCAGGG - Exonic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172597629 20:36161069-36161091 GAGAGGAGGGAACAGGAGAAGGG - Intronic
1173140921 20:40482124-40482146 AAGAGCACAGTCCAGGAGGATGG - Intergenic
1173402878 20:42740438-42740460 GGCTGCACAGAGCAGGAGGATGG - Intronic
1173465313 20:43276263-43276285 GACAGCATGGAGGAGGAAGATGG - Intergenic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173880004 20:46405445-46405467 GAGAGCACTGAGCAAGCGGACGG + Intronic
1175273272 20:57749545-57749567 GAGAGATGGGAGGAGGAGGAGGG + Intergenic
1175561207 20:59932884-59932906 GAAGGCGCCGAGCAGGAGGAAGG + Intronic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175661498 20:60816835-60816857 GGGAGCAGGGAGCCGGAGGGGGG + Intergenic
1175723877 20:61303703-61303725 GGGAGCAGGGAGGAGGAGGTAGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175756624 20:61534329-61534351 GACCACACGGGGCAGGAGGATGG + Intronic
1175834523 20:61984997-61985019 GGGAGGGCGCAGCAGGAGGACGG + Intronic
1176057166 20:63154903-63154925 GGGAGGAGGGAGGAGGAGGAAGG - Intergenic
1177543052 21:22520562-22520584 GAGAGGACAAAGGAGGAGGAAGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1179026534 21:37683453-37683475 GAGAAGACAGAGGAGGAGGAGGG - Intronic
1179425818 21:41277377-41277399 GACGGCACGGAACGGGAGGAGGG + Intronic
1179474978 21:41637280-41637302 GAGGGCACAGAGCAGGGGGCTGG - Intergenic
1179489800 21:41734006-41734028 GGGTGCATGGAGGAGGAGGAAGG - Intergenic
1179523681 21:41961749-41961771 GAGAGCCCGGAGGAGGAGCTGGG - Intergenic
1179536377 21:42055400-42055422 AATAGCAGGGAGGAGGAGGAAGG + Intergenic
1179561667 21:42219520-42219542 GAGAGCACGGACTAGGTGGAGGG + Intronic
1179891725 21:44338891-44338913 GAGAGGGCGGAGCCGGAGGGAGG - Intronic
1179891774 21:44339005-44339027 GAGAGGGCGGAGCCGGAGGGAGG - Intronic
1179894488 21:44353725-44353747 GCTGGCTCGGAGCAGGAGGAGGG + Exonic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1181085768 22:20438670-20438692 AACAGCACAGAGCAGAAGGAAGG + Intronic
1181350044 22:22248424-22248446 GACTGCATGCAGCAGGAGGATGG - Intergenic
1181387686 22:22557822-22557844 AGGAGAAGGGAGCAGGAGGAGGG + Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182353322 22:29710929-29710951 GAGTGCAGGGAGCTGGAGGTGGG - Intergenic
1182662741 22:31936499-31936521 GGGAGCTCAGAGGAGGAGGAGGG - Intronic
1182692443 22:32173518-32173540 GAGAGAATGGAGCAGCTGGAAGG - Intergenic
1182866184 22:33606577-33606599 GAGAGCACGGGGTAGGGGGCGGG - Intronic
1183177180 22:36232822-36232844 AAGAGCAGGGTCCAGGAGGAGGG - Intronic
1183279012 22:36922380-36922402 GAGGGAGGGGAGCAGGAGGAGGG - Intronic
1183306463 22:37085684-37085706 GAGGTCCCGAAGCAGGAGGAGGG + Intronic
1183411694 22:37658745-37658767 GAGAGCGCGGCGCGGGAGGCCGG + Exonic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183929435 22:41227645-41227667 GAGAGGGCGGGGCTGGAGGAGGG - Intronic
1183956480 22:41383019-41383041 GGGTGCAGGGAGCAGCAGGAGGG + Intronic
1184172764 22:42769388-42769410 GAGACCCCGTGGCAGGAGGAAGG + Intergenic
1184665572 22:45987209-45987231 GAGCCCAGGGAGCAGAAGGAGGG + Intergenic
1184785990 22:46672274-46672296 GAGAAAACGGAGCTGGTGGAGGG + Intronic
1184794516 22:46724047-46724069 GAGAAGACGGAGGAGGTGGAAGG - Intronic
1184832775 22:47000261-47000283 GCGAGCAGAGAGCTGGAGGAGGG + Intronic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1184977934 22:48076320-48076342 GAGAGCAAGGCCCAGAAGGAGGG + Intergenic
1185295087 22:50049172-50049194 GTGGGCACGGAGCAGGGCGACGG + Intronic
1185384468 22:50525518-50525540 GAGCGCAGGGAGCTGGAGGTCGG - Intronic
949107002 3:211368-211390 GAGAGCACAGAGTAGGATGCAGG + Intronic
950168814 3:10822227-10822249 GCCAGCACGGAGCAGGAGCCCGG - Intronic
950185032 3:10939596-10939618 GAGAGAACTGAGAGGGAGGATGG - Exonic
950457247 3:13100044-13100066 GAGAGTTCCGAGTAGGAGGATGG + Intergenic
950642729 3:14358965-14358987 GAGAGCACTGGGCAGGAGCTTGG + Intergenic
950662937 3:14477823-14477845 GTGAGCAGGGGCCAGGAGGAGGG + Intronic
950667344 3:14505583-14505605 GGGAGCACCGTGAAGGAGGAGGG - Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951641805 3:24844816-24844838 GGGAGCAGGGAGAAAGAGGAGGG - Intergenic
952258531 3:31716430-31716452 GGGAGCAGGGAGGAGGAGCAAGG - Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953329797 3:42043420-42043442 GAGGGCAGGGGTCAGGAGGAGGG - Intronic
953405837 3:42659382-42659404 GAGAGCTCTGAGGAGGAGGAGGG + Exonic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954432433 3:50477981-50478003 GGGAACTCGGAGCAGGAGGCAGG + Intronic
954435505 3:50493800-50493822 AAGGGCAGGGAGCCGGAGGAGGG + Intronic
954812804 3:53258238-53258260 GAGAGAAAGGAGCAGGTGAAAGG - Intergenic
955284380 3:57624657-57624679 GAGAGGCCGAGGCAGGAGGACGG + Intergenic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
956875851 3:73462438-73462460 GGGAGCCCGAAGCAGGAGAATGG + Intronic
957376767 3:79368684-79368706 GAGAGGAAGGAGCAGCAGCAGGG - Intronic
957671967 3:83317087-83317109 GGGAGGACGAAGCAGGAGAATGG - Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
958536608 3:95412012-95412034 GAGAGGACAGAGGAGGAAGAAGG - Intergenic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959002529 3:100981404-100981426 GAGAGAAGGGAGAAAGAGGAGGG + Intronic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959321898 3:104887170-104887192 CAGAGCCCATAGCAGGAGGAGGG + Intergenic
959435851 3:106314385-106314407 GAGGTCAGGGAGCAGGAGAAGGG - Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
960992489 3:123321082-123321104 GAGCCCAGGGTGCAGGAGGATGG - Intronic
961053361 3:123766421-123766443 GGGAGCACGGAGGAGGGTGAGGG + Intronic
961491752 3:127261271-127261293 AAGAGCAGGGAGGAGCAGGAGGG - Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962251664 3:133839687-133839709 GTGAGCCAGGAGCAGGAGGGAGG + Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
963001770 3:140688195-140688217 GAGTGCACGGGGTAGGGGGAGGG - Exonic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
964304346 3:155324994-155325016 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
965823081 3:172704398-172704420 GAGAGCTCGGAGCATGAGCCTGG - Intronic
966226096 3:177599700-177599722 GAAAGAATGGAGCAAGAGGAAGG + Intergenic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966523712 3:180899321-180899343 GAGAGAACAGAGGAGGAGAAAGG - Intronic
966882939 3:184360183-184360205 GCAAGCACGGTGTAGGAGGAGGG + Intronic
966954355 3:184858607-184858629 GAGAGCAATGAGCAGGAACATGG + Intronic
967112273 3:186304365-186304387 GAGAGAATGAAGCAGGAAGAAGG - Intronic
967575302 3:191082907-191082929 GAGAGCAGGGGGTGGGAGGAGGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968451519 4:678267-678289 GAGAGTCCGGAGCAGGATGAGGG + Intronic
968544103 4:1187710-1187732 GATAGCACAGAGGAGGAGGAGGG - Intronic
969274101 4:6123579-6123601 GAGAGCCCAAGGCAGGAGGATGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969431054 4:7154538-7154560 GAGAGCACAGAGCAGAGGGTGGG + Intergenic
969444331 4:7235520-7235542 GAGAACACAGAGCGGGTGGATGG + Intronic
969512203 4:7624899-7624921 GTGATCATGGAGGAGGAGGACGG + Intronic
969533382 4:7741493-7741515 GGGAGGAGGGAGGAGGAGGAAGG - Exonic
969561505 4:7950953-7950975 GGGAGCAGGGAGGAAGAGGAAGG + Intergenic
969927413 4:10597827-10597849 GAGACCAAGGTGCAGGAGAAGGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971143314 4:23948334-23948356 GAAAGGAGGGAGCAGGAGGGAGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
972053023 4:34764479-34764501 GAAAGGATGGAGCAGGAAGATGG - Intergenic
972406509 4:38751578-38751600 GGGAGGACGGAGTAGGAAGATGG - Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
974590738 4:63944687-63944709 GAGAGTAGGGAGTGGGAGGAGGG - Intergenic
974675127 4:65079181-65079203 GAGAGGACTGAGGAGGAGAAAGG - Intergenic
974703086 4:65476578-65476600 CAGAGCACGGAGTGAGAGGAGGG + Intronic
975055436 4:69924167-69924189 GAGCCCACGGAGCAGGTGGGAGG - Intergenic
975418530 4:74135012-74135034 GAGAGAGCAGAGCAGGAGCAAGG + Intronic
976512757 4:85930157-85930179 GGGGAGACGGAGCAGGAGGAGGG + Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977060995 4:92256669-92256691 AAGTGCAAGGAGCAGGAGAAGGG + Intergenic
977286667 4:95116391-95116413 GAAAGCATGGAGGAGGAGAAAGG - Intronic
977611231 4:99034184-99034206 GAGAGGAAGGAGGAGAAGGAGGG - Intronic
978370946 4:108029172-108029194 GAGAGGAGGGAGCAGGTGGTGGG - Intronic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
979500774 4:121437204-121437226 GAGAGAACTGAGAAGGAGAAAGG - Intergenic
979621540 4:122804070-122804092 GAGAGCAGGCAGCAGAAGGGTGG + Intergenic
980388620 4:132118642-132118664 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980612083 4:135172615-135172637 GGGAGCAAAGAGCAGGAGGATGG + Intergenic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
983055200 4:163093654-163093676 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
983527564 4:168774800-168774822 GGGAGCAGGTGGCAGGAGGAAGG - Intronic
983639783 4:169934359-169934381 GAGAGGCCGAGGCAGGAGGATGG - Intergenic
983710075 4:170704040-170704062 GAGAGCAGAGGGTAGGAGGAAGG - Intergenic
984189579 4:176589354-176589376 AAGAGTACAGAGCAGAAGGAAGG + Intergenic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985121280 4:186645036-186645058 GAAAACAGGAAGCAGGAGGAAGG + Intronic
985121436 4:186646783-186646805 GAGAACGGGGAGCAGGAGCATGG - Intronic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG + Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986502369 5:8414542-8414564 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986523660 5:8649352-8649374 GGGAGGCCGAAGCAGGAGGATGG - Intergenic
986720243 5:10555944-10555966 GGGAGGACACAGCAGGAGGATGG + Intergenic
986905490 5:12490372-12490394 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
989151317 5:38302387-38302409 AAGGTCATGGAGCAGGAGGATGG - Intronic
989172556 5:38487145-38487167 GAGAGCAGGGAGCTCCAGGAGGG - Intronic
989682674 5:44047104-44047126 GAGAGCAAGGAAAAGCAGGATGG - Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
990626265 5:57614949-57614971 GAGAGAACAGAGCAGATGGATGG + Intergenic
991014350 5:61915355-61915377 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
993407522 5:87529865-87529887 GGGAGGAAGGAACAGGAGGAAGG - Intergenic
993547939 5:89235978-89236000 GAGAGCATGGACTAGGTGGATGG - Intergenic
993836359 5:92824225-92824247 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
994131074 5:96228163-96228185 GAGAGAGCAGAGTAGGAGGATGG + Intergenic
994532897 5:100989721-100989743 TGGAGCAAAGAGCAGGAGGAGGG + Intergenic
994710364 5:103258605-103258627 GAGAGCTGGGCGCAGGAGGCGGG + Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
996529156 5:124509692-124509714 GAGAGCCCAGAGCAAGAGTAAGG + Intergenic
996993608 5:129667596-129667618 GGGAGCAAGGGGCAGGAGGGTGG - Intronic
997626302 5:135333292-135333314 GAGAGAACGGTGGAGGAGGTGGG - Intronic
998099468 5:139419972-139419994 GAGAGGAGGGATCAGGAGGCTGG + Intronic
998229250 5:140349230-140349252 GGGAGACCTGAGCAGGAGGAGGG - Intergenic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
998971109 5:147593452-147593474 GAGAGCAGGGAGGAAGAAGAGGG - Intronic
999116982 5:149173080-149173102 GAGAGAGAGGAGCAAGAGGAAGG + Intronic
999322580 5:150624653-150624675 GGGAGCAGGCAGCAGGAGCACGG + Intronic
999433064 5:151540475-151540497 GAGAGTGAGGAGCAGGAGAAGGG - Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001537155 5:172506091-172506113 GAGAGCAGGGAGCGTGGGGAGGG - Intergenic
1001665936 5:173433819-173433841 CAAAGCACGGAGCAGGAAAACGG - Intergenic
1002000113 5:176192595-176192617 GAGAGCCCGGGGCAGGGAGACGG - Intergenic
1002107269 5:176886260-176886282 GAGAGGTCAGAGCAGGAGCAGGG + Intronic
1002377554 5:178799060-178799082 GAGAGCCTGGAGCAGCATGAGGG + Intergenic
1003485932 6:6579699-6579721 GAGAGAACGGAAGAGAAGGAAGG + Intergenic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003872797 6:10415170-10415192 GAGGGCGAGGAGGAGGAGGAGGG + Exonic
1004280756 6:14277670-14277692 GAGAGCAGGGAAGAGTAGGAGGG - Intergenic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1004853643 6:19726645-19726667 GAGAGCACAGAGCAATGGGATGG - Intergenic
1005083154 6:21977631-21977653 GAGAGCCCGGAGCAAGTGGTAGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005781855 6:29201247-29201269 CAGAGCACGCACCAGGAGCAGGG - Intergenic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006440918 6:34053265-34053287 GAGAGCTGGGAGCAGGGGCAGGG - Intronic
1006513274 6:34532955-34532977 GAGAGCAGGGTGGTGGAGGAAGG - Exonic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1007066595 6:38997016-38997038 GAGAGAACAGAGGAGGACGAAGG - Intronic
1007468243 6:42070385-42070407 GGGAGCCCGGGGCAGGAGAATGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1008768378 6:54948074-54948096 AAGAGCATGGAGCAGGTGAAAGG + Intergenic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010252882 6:73726880-73726902 GAGGGCACAGGGCTGGAGGAAGG - Intronic
1010453650 6:76030480-76030502 GAGAGAACAGAGGAGGAGAAAGG - Intronic
1010613869 6:77989835-77989857 GATGGCAGGGAGCAGTAGGAAGG + Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011215969 6:85005867-85005889 GAGAGCACAGAGGTGAAGGAGGG - Intergenic
1012262092 6:97099558-97099580 GAGAGGACTGTGGAGGAGGAAGG - Intronic
1012977531 6:105796059-105796081 GAGAGCAGGGAGCCAGGGGAAGG + Intergenic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013604940 6:111738929-111738951 GGGAGAACAGAGCAGGAGGAGGG - Intronic
1013816402 6:114103793-114103815 GGGAGGCCGAAGCAGGAGGATGG - Intronic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015217337 6:130765519-130765541 GAATGCACTGAGGAGGAGGAGGG - Intergenic
1016378733 6:143450923-143450945 GAGAGCACAGAACGGGACGACGG + Intronic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017103306 6:150866425-150866447 GGGGGCGAGGAGCAGGAGGAGGG + Intronic
1017993061 6:159506737-159506759 GAAAGCAGGGAGCAAGAGGCAGG - Intergenic
1019020706 6:168915301-168915323 GACAGCAGAGAGCAGCAGGAGGG + Intergenic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1019139734 6:169935870-169935892 GAGAGCACGGGGCAGTAAGAGGG - Intergenic
1019265700 7:116405-116427 CAGAGCCCGGAGCAGAATGATGG - Intergenic
1019610226 7:1932961-1932983 GAAAGCAGTGAGCAGGGGGAAGG - Intronic
1019625235 7:2012577-2012599 GAAAGCCAGGAGCGGGAGGAAGG + Intronic
1019666053 7:2252787-2252809 GTGAGGAGGGAGCAGGAGAACGG - Exonic
1019722629 7:2582457-2582479 GAGAGCACAGCGCTGGAGGGAGG + Intronic
1019756492 7:2774499-2774521 GTGTGCAGGGAGCAGCAGGAAGG + Intronic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022285273 7:28950799-28950821 GAGAGAACGGAATAAGAGGATGG + Intergenic
1022372596 7:29785441-29785463 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1022597061 7:31722771-31722793 GAGTGCAGGAAGCAGGGGGATGG + Intergenic
1023015626 7:35967424-35967446 GCGGGCCCGGAGCAGGGGGAAGG + Intergenic
1023641384 7:42262497-42262519 GGGAGGCCGGGGCAGGAGGATGG - Intergenic
1023811697 7:43916970-43916992 GAGAGGACAGAGGAGGAGAAAGG - Intronic
1023878675 7:44306707-44306729 GAAACCAGTGAGCAGGAGGAGGG + Intronic
1024002493 7:45199882-45199904 GAGAGCCCTGAGAAGAAGGAGGG - Intergenic
1024377341 7:48654699-48654721 AAGTGCACTGAGCTGGAGGATGG - Intergenic
1025120172 7:56295173-56295195 GAGAGCCTGAAGCAGGAGAATGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1029459962 7:100688725-100688747 GAGAGCAGGGGGGAGGAGGGAGG + Exonic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030240573 7:107318646-107318668 GAGAGCACTTAGCAAGAGGGAGG - Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030820371 7:114085796-114085818 GAGAAGGCGGAGCAGGAGGTGGG + Intergenic
1031728221 7:125264117-125264139 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031777029 7:125918022-125918044 TGGAGCAAAGAGCAGGAGGAAGG - Intergenic
1031839163 7:126716598-126716620 GAGAGCATGCATCAGGATGATGG - Intronic
1032301337 7:130690099-130690121 AGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033465324 7:141583971-141583993 TGGAGCAAAGAGCAGGAGGACGG + Intronic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034491992 7:151397763-151397785 AAGAGGGCGTAGCAGGAGGAAGG + Intronic
1034900581 7:154905830-154905852 GGGAGCAGGGATCAGGAGGGAGG + Intergenic
1035267997 7:157702791-157702813 GGCAGCGCGGAGCAGCAGGACGG - Intronic
1035585549 8:770305-770327 GAGGACACGGAGGAGGAGCAAGG - Intergenic
1036561774 8:9904843-9904865 AAGAGCACTGAGGAGGAGAAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037529514 8:19758963-19758985 GATATCACTGAGCAGAAGGACGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037897725 8:22669200-22669222 GCGAGCACGCAGCAGCAGAAGGG - Intergenic
1038150951 8:24942121-24942143 GAAAGGAGGGAGGAGGAGGAGGG - Intergenic
1038311600 8:26449643-26449665 GAGAGGGGTGAGCAGGAGGAGGG + Intronic
1038398204 8:27262492-27262514 GCGATCAGGGAGCAGGTGGAGGG + Intergenic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1040498206 8:47984962-47984984 GGGAGCAGGAAGGAGGAGGAGGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041794196 8:61729106-61729128 AAGGGCAGGGAGCAGGAGTAGGG + Intergenic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043075256 8:75690744-75690766 GAGAGTACAGAGATGGAGGAGGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1043831309 8:84992355-84992377 GAAAGCAGGGAGGAGGAGAAAGG - Intergenic
1044148786 8:88747350-88747372 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044632534 8:94293189-94293211 GGGAGCAGGGAGCAGGGGCAAGG + Intergenic
1045174916 8:99712318-99712340 AAGACCAGGGAGCAAGAGGAAGG + Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045680427 8:104653747-104653769 GAGAAAACGGGGCAGGAGGTGGG + Intronic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1046788564 8:118294785-118294807 GAGAGCACATAACAGGAGAAAGG - Intronic
1046946480 8:119978941-119978963 GGGAGCAGGGAGCAGGGAGAGGG - Intronic
1047360264 8:124162642-124162664 GAGAGTAGGGAGCAGAAAGACGG - Intergenic
1047381135 8:124364354-124364376 GAGAGCACTGAGGAGGAGGGAGG + Intronic
1047538163 8:125738194-125738216 GAGATCACACAGCAGGAGTATGG - Intergenic
1047741066 8:127807560-127807582 GGGAGAACTGGGCAGGAGGATGG - Intergenic
1047829823 8:128617106-128617128 GGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1048297282 8:133223616-133223638 GAGAGAAAGAAACAGGAGGAAGG - Intronic
1048463346 8:134641076-134641098 GAAAGCCCAGAGCAGGAGGCTGG - Intronic
1048468921 8:134689825-134689847 GAAAGCACGGGGCAAGAGGCTGG + Intronic
1048585748 8:135772508-135772530 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049306466 8:141906830-141906852 GACCTCATGGAGCAGGAGGAAGG - Intergenic
1049306477 8:141906872-141906894 GACCTCATGGAGCAGGAGGAAGG - Intergenic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051975556 9:22943190-22943212 GAGAGCACGGAAAAGCAGGGCGG - Intergenic
1052341479 9:27368284-27368306 GAGAGCAGGAGGCAGGAGAATGG - Intronic
1052617078 9:30854926-30854948 GAGAGAACCGAGGAGGAGAAAGG - Intergenic
1053153159 9:35755734-35755756 GGGAGCACAAAGCAGGAGGTGGG - Exonic
1053560343 9:39186329-39186351 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1053824446 9:42006572-42006594 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1054136775 9:61432626-61432648 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054606125 9:67180791-67180813 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055604119 9:77949993-77950015 GAGGGAATGGAGCTGGAGGAGGG - Intronic
1056091086 9:83206908-83206930 GAGAGATGGGAGCAGGAGTAAGG - Intergenic
1056098164 9:83275150-83275172 GAAAGCACAGAGCAGTAGCATGG + Intronic
1056134766 9:83621218-83621240 GAGATCACAGGGCAAGAGGAGGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056917536 9:90758253-90758275 GAGGGCCCGGAGAAGGAGGAAGG - Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058740212 9:107935329-107935351 GACAGCAGGGAGCAGGAGGATGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059944778 9:119398392-119398414 AAGAGCCCTGAGCAGGAGGCAGG + Intergenic
1059975501 9:119712544-119712566 GAAAGGAAGGAGCAGAAGGAAGG - Intergenic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060604068 9:124898705-124898727 GGGAGCATGGACCAGGAAGAAGG + Intronic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061275789 9:129568879-129568901 GAGAGGCCGGAGCAGGGGGAGGG + Intergenic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062209118 9:135353683-135353705 GGGAGCAGTGAGCAGGAGGGAGG + Intergenic
1062346823 9:136118813-136118835 GCGGGCCCGGAGCAGGGGGAAGG - Exonic
1062359084 9:136178931-136178953 GGGAGGACTGAGCAGGAGCAGGG + Intergenic
1062394534 9:136347443-136347465 GTGAGCAGGGAGGAGGATGAGGG + Intronic
1062469637 9:136696878-136696900 GAGGGCAGGGAGGAGGGGGAGGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1185449518 X:275089-275111 GGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185662142 X:1736001-1736023 GAGAAAGCGGAGGAGGAGGAGGG - Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185961015 X:4545799-4545821 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186161234 X:6779103-6779125 GAAAGCAAAGAGCAGGGGGAGGG + Intergenic
1186445170 X:9621010-9621032 GTGAGCACGGAGTGGGAGGGAGG + Intronic
1186496246 X:10014919-10014941 GAGCGCGCGGAGAGGGAGGACGG + Intergenic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1188627155 X:32298809-32298831 GAAGGCACCCAGCAGGAGGAGGG + Intronic
1188862423 X:35272855-35272877 GAGAGGACAGAGGAGGAGAAAGG + Intergenic
1189323801 X:40101246-40101268 GAGAGGAGGGGGCAGGAGAAGGG - Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190246069 X:48691213-48691235 GTGGGCACAGAGCAGGTGGAGGG - Exonic
1190608444 X:52169623-52169645 GAAAGCCAGGAGCAGGAAGAAGG - Intergenic
1190917037 X:54818491-54818513 GAGTGTTCGGAGCAGGGGGAAGG + Intergenic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191148170 X:57190651-57190673 GAGTGCAAGGAGCGGGTGGAGGG - Intergenic
1192235831 X:69295402-69295424 GAAAGAACGGAGCAGGTAGAGGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193941161 X:87682181-87682203 TGGAGCAGAGAGCAGGAGGATGG - Intergenic
1194177145 X:90664990-90665012 GAGAGCAAGGAAAAGCAGGATGG + Intergenic
1194402709 X:93458379-93458401 GAGAGGACTGAGGAGGAGAAAGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194847721 X:98832478-98832500 GAGAGAAAGAAGCAGGAGAAGGG - Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1196393863 X:115238653-115238675 AAGAGAACCAAGCAGGAGGAGGG - Intergenic
1196533833 X:116817702-116817724 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197222642 X:123928560-123928582 GAGAGGCCAAAGCAGGAGGATGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198029889 X:132744718-132744740 GAGAGCCCTCAGTAGGAGGAGGG - Intronic
1198162316 X:134019820-134019842 GAGAGCACAGAGTAGGAGGTTGG - Intergenic
1199576160 X:149316084-149316106 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
1199743444 X:150757075-150757097 GGGATGAGGGAGCAGGAGGATGG - Intronic
1199941052 X:152628219-152628241 GACAGGAAGGAGGAGGAGGAAGG + Intergenic
1200074874 X:153545966-153545988 GAGAGGACGGGGCATGAAGAAGG + Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1201146471 Y:11067687-11067709 GACAGGAGGGAGCAAGAGGAAGG + Intergenic