ID: 1160859736

View in Genome Browser
Species Human (GRCh38)
Location 19:1232643-1232665
Sequence CAGTAGCCCTTCAATTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160859736_1160859741 16 Left 1160859736 19:1232643-1232665 CCTGCAGAATTGAAGGGCTACTG No data
Right 1160859741 19:1232682-1232704 TCTATGTGCTACAGCCCAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 110
1160859736_1160859740 15 Left 1160859736 19:1232643-1232665 CCTGCAGAATTGAAGGGCTACTG No data
Right 1160859740 19:1232681-1232703 ATCTATGTGCTACAGCCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1160859736_1160859738 -8 Left 1160859736 19:1232643-1232665 CCTGCAGAATTGAAGGGCTACTG No data
Right 1160859738 19:1232658-1232680 GGCTACTGTCAAACAGTCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 94
1160859736_1160859737 -9 Left 1160859736 19:1232643-1232665 CCTGCAGAATTGAAGGGCTACTG No data
Right 1160859737 19:1232657-1232679 GGGCTACTGTCAAACAGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160859736 Original CRISPR CAGTAGCCCTTCAATTCTGC AGG (reversed) Intronic
No off target data available for this crispr