ID: 1160859766

View in Genome Browser
Species Human (GRCh38)
Location 19:1232843-1232865
Sequence GCCCCGGATGGTGGTGTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160859766_1160859773 5 Left 1160859766 19:1232843-1232865 CCACGAACACCACCATCCGGGGC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1160859773 19:1232871-1232893 GGGAAAAGTCTGCTGACCCCTGG 0: 1
1: 0
2: 11
3: 62
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160859766 Original CRISPR GCCCCGGATGGTGGTGTTCG TGG (reversed) Intronic
901452105 1:9342148-9342170 GCCTCAGATGGTGGAGTTCTCGG + Intronic
905408745 1:37754061-37754083 GCCCCGGAAGGCGGCGTACGGGG - Intronic
912117009 1:106419203-106419225 GCCTGTGATGGTGGTGTTCATGG + Intergenic
914909196 1:151770450-151770472 GCCCCTGCAGGTGGTGTTAGGGG + Intronic
922603004 1:226870973-226870995 GCCCCGGCTGGGGGTGGGCGCGG + Intronic
1070651165 10:78237582-78237604 GTTCAGGATGGTGGTGTTTGTGG + Intergenic
1071858004 10:89645150-89645172 GCCCCGGCTGGGGGTGCGCGGGG - Exonic
1073149113 10:101299636-101299658 ACCCCAGATGGTGGAGGTCGGGG - Intergenic
1075077266 10:119359729-119359751 ACCCTGGATGCAGGTGTTCGGGG + Intronic
1083415460 11:62522643-62522665 GCCCCAGATGTGGATGTTCGAGG - Exonic
1083416058 11:62526525-62526547 GCCCCAGATGTGGGTGTTCAAGG - Exonic
1084470527 11:69356675-69356697 GCCCAGCATGGAGGTCTTCGGGG - Intronic
1084562314 11:69911810-69911832 GCCCAGGGTGGGGGTGTTGGGGG + Intergenic
1089557350 11:119321609-119321631 TCCCTGGATGGTGGTATTCTGGG - Intergenic
1089949280 11:122510235-122510257 GCCCAGGATGGTGGCGTGGGAGG + Intergenic
1092900808 12:13057878-13057900 GACCCTGATGGTGGTGGTGGTGG + Intronic
1095325361 12:40885174-40885196 GCCCAGGATTGTGGTGTTTCTGG - Intronic
1097153452 12:56995865-56995887 GCCCAGGATGGTGGTGGACAGGG - Exonic
1101373422 12:104150938-104150960 TCCACGGATGGTGGTGGTTGGGG - Intergenic
1104904397 12:132205577-132205599 CCCCGGGATGGTGGAGTCCGCGG + Exonic
1104974791 12:132547654-132547676 GCCCAGGATGGGGGTCTTCATGG + Intronic
1112412733 13:99178110-99178132 TCCGCGGATGGTGGTGGTGGTGG - Intergenic
1115851402 14:37592738-37592760 GCCCCGGAGGGCGGGGTTAGTGG + Intronic
1125429349 15:39580472-39580494 GCCCCGGAGGGAGGTGAGCGCGG - Intergenic
1127397439 15:58553839-58553861 GCCCAGGATGGTGTTGTCCAGGG - Intronic
1129224635 15:74161604-74161626 GCCCCTGGTGGTGGTGGTGGTGG + Intergenic
1129614866 15:77090410-77090432 GCCACTGATGGTGGTGTTGATGG + Intergenic
1133190560 16:4130685-4130707 GCCCAGGATGGTGGACTTCAAGG + Intergenic
1134536054 16:15027819-15027841 GCCCAGGATGGTGGTGTGGTGGG + Intronic
1134717563 16:16364457-16364479 CCCCCGCATGGTCGTGTTGGAGG - Intergenic
1134957189 16:18387702-18387724 CCCCCGCATGGTCGTGTTGGAGG + Intergenic
1139489831 16:67280186-67280208 GCCCCGGCTGGTGGTCTTGGAGG - Exonic
1140358499 16:74325506-74325528 GCCCCAGATGTTACTGTTCGGGG - Intergenic
1140403259 16:74689031-74689053 GCTCAGGATGGTGGTGATAGGGG + Intronic
1144826446 17:18108152-18108174 GCCCAGGGGGTTGGTGTTCGGGG + Intergenic
1145882260 17:28360875-28360897 GCCCCTGGTGGGGGTGTTAGTGG + Intronic
1146734236 17:35223866-35223888 GCCCTTGATGTTGGTGTTTGGGG - Intergenic
1149486441 17:57046339-57046361 GCCCGGGGCGGGGGTGTTCGTGG - Intergenic
1151489919 17:74426837-74426859 GCCCCGGATGGGGGTTTGCAGGG + Intronic
1152127238 17:78454577-78454599 GCCCAGGATGGTGGCATTCTCGG + Exonic
1155054585 18:22172128-22172150 GGCTCGGATGGTGGTGGTGGTGG - Exonic
1160859766 19:1232843-1232865 GCCCCGGATGGTGGTGTTCGTGG - Intronic
1160956973 19:1698352-1698374 GCCCCGGCTGGTGGTGCACGTGG + Intergenic
1161101898 19:2425560-2425582 CTCCCGGATGGTGGGCTTCGTGG - Intronic
1162872896 19:13599537-13599559 GAGCCGGATGGGGGTGTCCGGGG + Intronic
1163152214 19:15422350-15422372 GCCCTGGAGGGTGGGGTTGGGGG - Exonic
1163491442 19:17619249-17619271 GCCTCAGACGGTGGTGTTTGTGG + Intronic
1163602928 19:18259514-18259536 GCCTCGGATGGTGGAGCCCGGGG + Intronic
928448023 2:31350113-31350135 GCCCCGGAAGGCCGTGTTGGAGG + Exonic
937069632 2:119053450-119053472 GCCCAGTCTGGTGGTGTTCTGGG - Intergenic
937527775 2:122791870-122791892 GCCCAGGATGCTAATGTTCGGGG - Intergenic
945005673 2:205402950-205402972 GCCACGGATGGTGGAGGTGGAGG + Intronic
947868811 2:233420785-233420807 GCCCACGATGCTGGTTTTCGTGG + Intronic
948393219 2:237627280-237627302 GCCCCGGAGGGTGGACTTTGCGG - Intergenic
1170609096 20:17897099-17897121 GCCCCTGTTGGTGGTGATGGTGG - Intergenic
1170799036 20:19575294-19575316 CCCAAGGAGGGTGGTGTTCGTGG - Intronic
1173177652 20:40776862-40776884 GCCCCAGATGTTGGTGCTGGTGG + Intergenic
1177200478 21:17949086-17949108 GCCCCTGAGTGTGGTGTTAGTGG + Intronic
1184937309 22:47734632-47734654 GCCCAGGATGTTGGTGATGGTGG + Intergenic
950655642 3:14434699-14434721 GCCCCAGATGAAGGTGTTTGAGG - Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952580205 3:34824295-34824317 GCCCAGGATGGGGGTGTGGGAGG - Intergenic
973565025 4:52176844-52176866 GCCCAGCATAGTGGTGTTGGAGG - Intergenic
974752019 4:66154106-66154128 GCCCAGGATGGGGGTGTGGGGGG - Intergenic
975734467 4:77367684-77367706 GCCCTGGATGGAGGTGTGGGTGG + Intronic
977683113 4:99816758-99816780 GGCCAGGGTGGTGGTGTTGGTGG + Intergenic
980299202 4:130965609-130965631 GCCAGCGATGGTGGTGTTGGGGG + Intergenic
986072123 5:4295847-4295869 GCCCCGGCTGGCGGTCTCCGTGG - Intergenic
986721132 5:10562774-10562796 GCCCCGGAGGGTGGGGCGCGCGG - Intergenic
987994726 5:25262069-25262091 TCCCCGGCTGGGGGTGTTGGGGG + Intergenic
993732621 5:91440442-91440464 GCCCTGGTTGGTGGTGGTGGTGG + Intergenic
997511520 5:134458006-134458028 GGCCTGGATGGTGGTGGTGGAGG + Intergenic
1005396090 6:25383240-25383262 GGCTCGGATGGTGGTTTTTGAGG + Intronic
1005671359 6:28109242-28109264 GGCCCTCATGGTGGTGTTAGTGG + Intergenic
1007595031 6:43046024-43046046 GGCCCGAGTGGTGGTGTGCGGGG - Exonic
1008532905 6:52481100-52481122 GCCCAGGATGGTGGTATCAGTGG + Intronic
1019989979 7:4683641-4683663 GCCCTGGCTGGTGGGGGTCGGGG - Intronic
1023670693 7:42573108-42573130 GCCCAGGATGGTGGGCTTCAGGG + Intergenic
1024241993 7:47442849-47442871 GCCTCTGATGGTGGTGTCTGTGG - Intronic
1024613307 7:51085402-51085424 GCACCGGAAGGTGGTGCTCCAGG + Intronic
1024883425 7:54115224-54115246 GCCACGGTTGGTGGTGTTCGGGG - Intergenic
1029494170 7:100888307-100888329 GCCCCGTATGGTGCTGGTCGAGG + Exonic
1029989089 7:104946609-104946631 GCCCAGGAGGGTGGTGGTGGTGG - Intergenic
1049753464 8:144296911-144296933 GCCCCGGATGGTGTGGTGGGGGG + Intronic
1050091197 9:2017195-2017217 GCTGCGGATGGTGGTGAGCGCGG + Intronic
1052882407 9:33611158-33611180 GCAGGGGATGGTGGTGTTTGTGG + Intergenic
1054695539 9:68356711-68356733 GCCCCGGAGGGCGGCGATCGCGG + Intronic
1055090912 9:72364568-72364590 GCCGCGGATGGCGGCGTCCGGGG - Exonic
1060404327 9:123365785-123365807 GAGCCGGATGGTGGTGGTGGTGG - Intronic
1061873342 9:133532085-133532107 GCCCGGGAGGGTGGGGTTCCAGG - Intergenic
1186977385 X:14922836-14922858 GCCCAGGATGGTGATGTTAGAGG + Intergenic