ID: 1160860380

View in Genome Browser
Species Human (GRCh38)
Location 19:1235047-1235069
Sequence CCTCATTGAAGGAGACCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160860375_1160860380 10 Left 1160860375 19:1235014-1235036 CCTGCGTCTTGCGGCTCTGCTCA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 93
1160860373_1160860380 17 Left 1160860373 19:1235007-1235029 CCCTTGTCCTGCGTCTTGCGGCT 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 93
1160860371_1160860380 24 Left 1160860371 19:1235000-1235022 CCGGCGACCCTTGTCCTGCGTCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 93
1160860374_1160860380 16 Left 1160860374 19:1235008-1235030 CCTTGTCCTGCGTCTTGCGGCTC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160860380 Original CRISPR CCTCATTGAAGGAGACCCGG CGG Exonic
900024667 1:260690-260712 CCTCATTTAATGAGACACTGGGG + Intergenic
900028276 1:350095-350117 CCTCATTTAATGAGACACTGGGG + Intergenic
900897647 1:5494899-5494921 CCACATTGGAGGGGAGCCGGGGG + Intergenic
901219581 1:7575786-7575808 CCTTATTGGATGAGACCCTGGGG + Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
909573078 1:77139649-77139671 CCACATTGAAGCAGAGCTGGTGG - Intronic
912734849 1:112141641-112141663 CCACAGTGCAGGAGACCCAGAGG - Intergenic
913059324 1:115190369-115190391 CCTAATTGACGGAGACAAGGAGG + Intergenic
919097851 1:193059212-193059234 CCTCATGGAAAGCGACCCCGGGG - Exonic
920116792 1:203627153-203627175 CCTCATCCATGGAAACCCGGAGG + Exonic
1072742439 10:97917572-97917594 CCTCATTGAAATGGACCCTGAGG - Exonic
1073208845 10:101782617-101782639 CCTCACTTGAGGAGACCCTGAGG - Intronic
1074977014 10:118589174-118589196 CCTCAGTGAAGGGGAACTGGTGG - Intergenic
1078451070 11:11441396-11441418 CCTCTGTGGAGGAGACCCAGAGG - Intronic
1080527113 11:33133837-33133859 CCACATTGAAGGAGACTAAGAGG + Intronic
1091582304 12:1797231-1797253 CCTCAGTGGAGGAGACACGCAGG - Intronic
1102549939 12:113684256-113684278 CCTCACAGATGGAGAGCCGGAGG - Intergenic
1103617953 12:122166992-122167014 ATTCATTAAAGGAGACCAGGTGG + Intergenic
1104182383 12:126395109-126395131 CCTTATTAAAGGAGGCCCTGAGG + Intergenic
1109771677 13:66982567-66982589 CCTCATTCCAGGAGAACCCGGGG - Intronic
1115447617 14:33509602-33509624 GCTCAGTTAAGGAGACCTGGAGG + Intronic
1117515057 14:56492465-56492487 CCTCCTTGAAGGAGGCCAGAGGG - Intronic
1119714940 14:76852531-76852553 CCTCATTGATGGTGACCATGAGG - Intronic
1121588389 14:95079681-95079703 CCTCATTGGAGGAGAACTGAAGG - Intergenic
1121988338 14:98529672-98529694 CCTCATTGAAACAGACCTGTGGG + Intergenic
1122397336 14:101442580-101442602 CCTCCCTGAAGGAGATCCGGGGG - Intergenic
1132009631 15:98265086-98265108 CTTCAATGCAGGAGACACGGAGG - Intergenic
1136478059 16:30525539-30525561 CCTGAGTGAAGGAGTCCAGGGGG + Exonic
1137280528 16:46973199-46973221 CCTCCTTGAACGAGCGCCGGGGG - Intronic
1141710504 16:85696138-85696160 TCTCATTATAGGAGACCCTGGGG + Intronic
1142338635 16:89506855-89506877 CCTGATTGAAAGACACCAGGTGG - Intronic
1144579665 17:16451244-16451266 CCTCCTTGTTGGAGACCCAGTGG - Intronic
1144584438 17:16479582-16479604 CCTCAGTGAAGGAAACCAAGGGG + Intronic
1148334334 17:46831685-46831707 CTTCACTGGAGGGGACCCGGAGG - Intronic
1148894644 17:50832767-50832789 CCTGAGTGGAGGAGGCCCGGTGG + Intergenic
1152092496 17:78254718-78254740 GCTCATTGAAGGAGAAACCGAGG + Intergenic
1159338923 18:67109406-67109428 TCTCATTGAAGTAGAAACGGAGG - Intergenic
1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG + Exonic
1167103511 19:47418214-47418236 CCTCAGTGATGAAGACACGGAGG + Intronic
928259624 2:29755137-29755159 CCTTATTGTAGGAAACCCAGAGG - Intronic
930055330 2:47247608-47247630 CCTCAATGAAGTAGAACTGGAGG + Intergenic
932371015 2:71187963-71187985 GTTCATTGCAGGAGACCCCGGGG + Exonic
932666979 2:73705874-73705896 CCCCACTGAAGGAGACTCTGTGG + Intergenic
932668907 2:73719878-73719900 ACCCATTGAAGGAGACTCTGTGG + Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
941775481 2:169388632-169388654 TCTCAGTGAAGGACACCTGGAGG + Intergenic
948244266 2:236465065-236465087 CATCATTCAAGGAGACCTGGTGG + Intronic
949087978 2:242173482-242173504 CCTCATTTAATGAGACACTGGGG - Intergenic
1170195129 20:13681588-13681610 CCTCATTCCAGGGGACCCAGTGG - Intergenic
1170567942 20:17617181-17617203 CATCCTTGAAGGAGAAACGGGGG - Intronic
1177135357 21:17301198-17301220 ACTCAATCAAGGAGACCCAGAGG + Intergenic
1178551751 21:33546252-33546274 ACCCATTGAAGGAAACCAGGCGG + Exonic
1178842113 21:36146164-36146186 ACTCACAGAAGGAGACCTGGTGG + Exonic
1180166711 21:46034291-46034313 CCACACCGCAGGAGACCCGGCGG - Intergenic
1181052252 22:20243474-20243496 CCGCATTGCAGGAGTCCCCGGGG + Intronic
954403461 3:50331749-50331771 CCTCCTTGCAGGATGCCCGGCGG - Exonic
955262326 3:57405832-57405854 ACTCATTGAAAGAGACGCCGTGG - Intronic
956577148 3:70764556-70764578 CCTCATTGAAAGAGACCCACGGG - Intergenic
960096728 3:113696599-113696621 CCTCAAGGCCGGAGACCCGGCGG + Exonic
969583414 4:8078442-8078464 GCTCATTTATGGAGACTCGGAGG - Intronic
970018319 4:11537947-11537969 CCTCATTGAATGAGTCCCATTGG + Intergenic
972010502 4:34174548-34174570 CCTCATAGAATGAGACAGGGAGG - Intergenic
975390134 4:73806504-73806526 CCTCATAGAATGAGACGGGGAGG - Intergenic
975571561 4:75823146-75823168 CATTATTGAAGGAAACCTGGTGG + Intergenic
982206950 4:153004046-153004068 CCACATTGAAGGGGACTAGGGGG - Intergenic
984481402 4:180307528-180307550 CTTCATTGAAGGAGATCCATTGG - Intergenic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
985335969 4:188895054-188895076 CCTCATTCTAAGAGACCCTGAGG - Intergenic
986330450 5:6713399-6713421 CCTCATTGGAGCGGACGCGGCGG + Intergenic
1000555562 5:162721493-162721515 CTTGATTGAAGGAGATCAGGTGG - Intergenic
1002573716 5:180159804-180159826 CCTCAATGAAGTACACCCGTGGG - Intronic
1002697253 5:181099224-181099246 CCTCATGGATGGAGACACGCTGG - Intergenic
1002745714 5:181470276-181470298 CCTCATTTAATGAGACACTGGGG - Intergenic
1006453691 6:34120213-34120235 CATCTTTGAAGGAGACCCTCAGG + Intronic
1009507687 6:64505482-64505504 CATCATTGAGGGTGAGCCGGTGG - Intronic
1012593456 6:101011729-101011751 ACTCATTGGAGAAGACCCTGGGG - Intergenic
1017909295 6:158779315-158779337 CCACATCGAAGGAGACAGGGAGG + Intronic
1019250631 6:170743831-170743853 CCTCATTTAATGAGACACTGGGG - Intergenic
1019762500 7:2824193-2824215 CCTCACTGAGGGAGACCAGGTGG - Intronic
1022093779 7:27125303-27125325 CCAAAGTGAAGGAGACCTGGAGG - Intronic
1025194114 7:56919209-56919231 TCTCTTTGAAGGAGACCCTTTGG + Intergenic
1025677834 7:63657735-63657757 TCTCTTTGAAGGAGACCCTTTGG - Intergenic
1027596764 7:80184057-80184079 CCTCCTTAAAGGAGACCAGTGGG + Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1035163138 7:156966068-156966090 CCACATTGTAGGAGAACCTGAGG + Intronic
1036089029 8:5644992-5645014 ACTCCTTGAAGGAAACACGGAGG - Intergenic
1036418410 8:8572377-8572399 CCTCATTTAAGGTCACCCAGAGG + Intergenic
1036788468 8:11702997-11703019 CCTGAGTGAAGGCAACCCGGGGG - Intronic
1037778797 8:21853515-21853537 CCTCATTGATGGACACCAAGGGG + Intergenic
1049786377 8:144452853-144452875 CCTCACTGCAGGAGACTTGGTGG + Intronic
1051498253 9:17749025-17749047 CCTCACTGATGGATACCCAGTGG + Intronic
1051513140 9:17902420-17902442 AATCATTGAAGGAGATCCAGAGG + Intergenic
1057903452 9:98966668-98966690 TCTCAGTGAAGGAGAGCCGAGGG + Intronic
1061075367 9:128338137-128338159 CCTGACTGAAGGAGAGCAGGTGG + Intergenic
1062378018 9:136273343-136273365 ACCCGTTGAAGGAGAGCCGGAGG + Intergenic
1203788326 EBV:140492-140514 CCTCATGGCAGGAGAGGCGGGGG - Intergenic
1203580186 Un_KI270745v1:36428-36450 CCTCATTTAATGAGACACTGGGG - Intergenic
1189364732 X:40379917-40379939 GCTCACTGAAGGAGCCCTGGGGG - Intergenic