ID: 1160860854

View in Genome Browser
Species Human (GRCh38)
Location 19:1236805-1236827
Sequence GCGGGTTGCCAGGGAGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160860849_1160860854 -9 Left 1160860849 19:1236791-1236813 CCGCGGCTGGGGGGGCGGGTTGC 0: 1
1: 0
2: 0
3: 17
4: 213
Right 1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 217
1160860835_1160860854 28 Left 1160860835 19:1236754-1236776 CCGGAGAAGCTGGTTCCCATGGC 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 217
1160860838_1160860854 13 Left 1160860838 19:1236769-1236791 CCCATGGCGACTGCGGAGCAGGC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 217
1160860833_1160860854 29 Left 1160860833 19:1236753-1236775 CCCGGAGAAGCTGGTTCCCATGG 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 217
1160860832_1160860854 30 Left 1160860832 19:1236752-1236774 CCCCGGAGAAGCTGGTTCCCATG 0: 1
1: 0
2: 2
3: 6
4: 146
Right 1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 217
1160860839_1160860854 12 Left 1160860839 19:1236770-1236792 CCATGGCGACTGCGGAGCAGGCC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160860854 Original CRISPR GCGGGTTGCCAGGGAGCGGC GGG Intronic
900427215 1:2586308-2586330 GGGGGGCGCCGGGGAGCGGCTGG - Intergenic
901051011 1:6425876-6425898 GCAGGTAGCCAGGCAGCGGTGGG + Intronic
902078645 1:13806217-13806239 GCGGGATGCGGGGGAGCAGCTGG - Intronic
902532464 1:17099159-17099181 GAGGGTCGCCAGAGAGTGGCAGG + Intronic
902861728 1:19251691-19251713 GCGGCTTGGCAGGGAGAGGCAGG + Exonic
903349925 1:22711213-22711235 GCGGGCGCCCGGGGAGCGGCGGG + Intronic
904171132 1:28592747-28592769 GCGGGTAGCCGGGGCGCGGGAGG + Intronic
904408644 1:30311577-30311599 GCGGGGGGCCAGGGCGTGGCTGG + Intergenic
904528965 1:31155449-31155471 GCGGGTGGCCCGGGAGAGGCCGG + Intergenic
904611375 1:31727940-31727962 TGGGGTTGCCTGGGAGGGGCAGG + Intronic
904654832 1:32036989-32037011 GTGGGGTGCCAGTGAGAGGCCGG + Exonic
905874575 1:41423819-41423841 GAGGGTGGCCTGGGAGGGGCAGG - Intergenic
906544908 1:46613859-46613881 GGGGATTCCCAGGGAGCAGCAGG + Intronic
907364393 1:53946610-53946632 GCGGGGTGTTAGGGAGGGGCGGG + Intronic
907486404 1:54781204-54781226 GCGGGGTCCCAGGGAGCCTCCGG + Exonic
908128227 1:61050771-61050793 TCGGGTTCCCAGGGAGGGGCCGG - Intronic
912727068 1:112067953-112067975 TCAGGTTGCCAGTGAGTGGCAGG + Intergenic
920074155 1:203324907-203324929 GTGGGCTGCCAGGGAGCGGGAGG - Intergenic
921706188 1:218324345-218324367 GCGGGTTCCCAAGACGCGGCCGG + Intronic
922233359 1:223704992-223705014 GGGAGTTGCCAGGAAGGGGCTGG - Intronic
923540765 1:234886418-234886440 GGGGGTCCCCAGGGAGCCGCAGG + Intergenic
1062916081 10:1242063-1242085 GGGGGCTGCCAGGGAGCAGATGG - Intronic
1062919599 10:1269924-1269946 GCTGGTGGCCAGGGTGGGGCTGG + Intronic
1066464258 10:35639573-35639595 GCGGGTGCACAGGGAGCGCCAGG + Exonic
1068869652 10:61929336-61929358 ACGGGTTGGCAGGGAGGGGATGG - Intronic
1069834345 10:71299291-71299313 GCGGGCTGGCAGGGACTGGCAGG + Exonic
1070835623 10:79445456-79445478 GCGGGCGGCCGGGGAGGGGCCGG - Exonic
1077024630 11:433714-433736 GCGGGTGCCCAGCGAGGGGCAGG - Intronic
1077024645 11:433751-433773 GCGGGTGTCCAGCGAGGGGCAGG - Intronic
1077024662 11:433788-433810 GCGGGTGCCCAGCGAGGGGCAGG - Intronic
1078771875 11:14358955-14358977 GCGGGCTGCGGGCGAGCGGCCGG + Exonic
1079128430 11:17734581-17734603 GCGGGTCCCCCGGGAGCAGCAGG + Intergenic
1080012437 11:27472369-27472391 GCCGGCTGCCCGGGGGCGGCGGG - Exonic
1080973017 11:37301849-37301871 GCAGGGTGCCAGAGAGTGGCTGG - Intergenic
1081451531 11:43175304-43175326 GCGGGGAGCCAGGGAGAGGAAGG - Intergenic
1083029285 11:59577209-59577231 GAGTGATGCCAGGGAGCGGATGG - Intronic
1083281821 11:61631494-61631516 GCTGGTTGCCAGGGGCTGGCTGG - Intergenic
1083465369 11:62842154-62842176 TCGGCTTTCCAGGGGGCGGCGGG + Intergenic
1084636831 11:70398544-70398566 GCCTGGTGCCTGGGAGCGGCTGG + Exonic
1084641478 11:70429148-70429170 GCGGATGGCCAAGGAGCGGCAGG + Exonic
1084890659 11:72235408-72235430 GCGGGTGCCCACGGAGCGCCTGG + Exonic
1085397536 11:76214356-76214378 GCGGGTTGGCTGGGGGCAGCTGG + Intergenic
1087451936 11:98334719-98334741 GATGGTTGCCAGGGACTGGCAGG - Intergenic
1089453282 11:118611037-118611059 CCGGGTTGCTGGGGAGCCGCGGG + Intronic
1090395754 11:126416877-126416899 GCCGCTTGCCAGGGAGGGGCCGG - Intronic
1091658491 12:2363257-2363279 GTGGGTTTCCAGGGAGAAGCAGG - Intronic
1092155380 12:6278750-6278772 GCCGGCGGCCAGGGCGCGGCCGG + Intergenic
1092527036 12:9315628-9315650 GCAGGTGGACAGGGAGCGGGAGG - Intergenic
1094190070 12:27689146-27689168 GCGAGATGCCATGGAGCTGCCGG + Exonic
1099955082 12:89345719-89345741 GCAGGTTTCCTGGGAGCTGCAGG - Intergenic
1100963133 12:99984930-99984952 GCGGGCTGGCGGGGAGGGGCCGG + Intergenic
1101466955 12:104958453-104958475 GCTGTCTGCCAGGGCGCGGCCGG - Intronic
1104568138 12:129903429-129903451 GCCGGTGGCGAGGGAGCGCCCGG + Exonic
1106304012 13:28494727-28494749 GCGGGCTGCGATGGGGCGGCCGG - Intronic
1108805527 13:54150977-54150999 GCGGGATGCTAGGGAGCTTCTGG - Intergenic
1110024979 13:70525623-70525645 GGGGGTTACCAGGGGACGGCAGG + Intergenic
1111991766 13:95123847-95123869 GCGGGTTACCAGGGTGAGGCGGG + Intronic
1112498875 13:99926882-99926904 GCAGGTGTTCAGGGAGCGGCAGG + Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1118312546 14:64704484-64704506 GCGGCTTGCCAGCGCCCGGCAGG - Exonic
1119322768 14:73741517-73741539 GCTGGTTTCCTGGGAGCGGCTGG - Intronic
1119492784 14:75051194-75051216 GGGGCTGGCCAGGGAGGGGCTGG - Intronic
1119667129 14:76492905-76492927 GCTGGGTGCCAGGGGGCTGCAGG + Intronic
1119835777 14:77747757-77747779 GCGGCTGGCCAGGCAGGGGCTGG - Intronic
1121814755 14:96920683-96920705 GAGGGTGGCCTGGGAGCTGCTGG - Intronic
1122636407 14:103131800-103131822 GGGGGTTCCCAGGGAGGGACTGG + Intronic
1124095950 15:26648890-26648912 GTGGGGTTCCAGGGAGGGGCTGG + Intronic
1124214712 15:27796895-27796917 GAGGGTTGCCAGAGAGCTCCAGG - Intronic
1125834449 15:42737148-42737170 GCGGGCGGCCAGGGAGGGGCGGG + Intergenic
1127142791 15:55993926-55993948 CCGGGGAGCCAGGGAGCGCCGGG + Intergenic
1127292332 15:57581729-57581751 GTGGGCTACCAGGGAGCTGCGGG - Intergenic
1127305458 15:57701226-57701248 GTGGGGTGTCAGGGAGAGGCTGG - Intronic
1128474774 15:67987885-67987907 GTGTGTTGCCAGGGAGCAGGGGG + Intergenic
1129348251 15:74938067-74938089 GCGGGTTGCTCCGGAGCGGGCGG + Exonic
1129356609 15:74996007-74996029 GCCGGTTTCCAGGGAACGCCAGG - Intronic
1129476258 15:75786258-75786280 GCGGGAGGCCAGGGCACGGCAGG + Intergenic
1129746350 15:78024173-78024195 GCCTGTTGCCAGGGACCAGCTGG - Exonic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1131188590 15:90295045-90295067 GCGGGAGGCCAGGGCACGGCAGG + Intronic
1132483878 16:180451-180473 GCGGGGTCGCAGGGCGCGGCGGG + Exonic
1132497527 16:270889-270911 GGGGGTTCCCAGGGAGCTGGTGG + Intronic
1132589869 16:721946-721968 GCGGGTGGCCAGGGATCCCCAGG - Intronic
1132865638 16:2091486-2091508 GAGGGCGGCCAGGGCGCGGCCGG + Exonic
1133234205 16:4380271-4380293 GCGGGCCGCCAGGAAGTGGCCGG - Intronic
1133751084 16:8725986-8726008 GCAGGCTCCCAGGGAGGGGCAGG - Intronic
1134041875 16:11075305-11075327 GAGGGCTTCCAGGGAGGGGCAGG + Intronic
1135548431 16:23380705-23380727 GCGGGGTGCCTGGGATGGGCAGG - Exonic
1135607443 16:23836439-23836461 GCGGGGTCCCAGGGTGCGGAGGG - Intronic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1136592327 16:31224842-31224864 GCGGGTTGCCAGGGCCCAGGGGG + Exonic
1138142701 16:54582528-54582550 GCCAGTTGCCAGGGGGTGGCGGG - Intergenic
1138265224 16:55655814-55655836 GCGGGTTCCCAGGGATCTGGGGG - Intronic
1139268595 16:65661831-65661853 GCGGGTTGGCAGCTAGTGGCTGG + Intergenic
1141509688 16:84504480-84504502 GTGGGAGGCCAGGGAGGGGCAGG + Intronic
1141698834 16:85633222-85633244 GCAGGCTGACAGGGAGCGGTGGG - Intronic
1142359314 16:89619171-89619193 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359355 16:89619262-89619284 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359383 16:89619322-89619344 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142364355 16:89642065-89642087 GAGGCGTGCCAGGGAGCGACGGG + Intergenic
1142815725 17:2423632-2423654 GCGGGCTGGCAGGGAGGGCCAGG - Intronic
1143487242 17:7261706-7261728 CTGGGTTGCCGGGGAGCTGCAGG - Intronic
1146263616 17:31437235-31437257 GCGTGTTGGCAGGGAGAGGAAGG + Intronic
1147260998 17:39209838-39209860 GCGGGGCGCCAAGGAGAGGCGGG - Intergenic
1147314411 17:39612685-39612707 GCAGTATGCCGGGGAGCGGCGGG + Intergenic
1148060020 17:44829995-44830017 GCGGGGTCCCAGGGGGAGGCGGG - Intronic
1148126925 17:45241956-45241978 CCGGGCTGCCAGGGAGAGGCGGG - Exonic
1148617709 17:49013514-49013536 CCGGGAAGCCAGGGAGAGGCTGG - Intronic
1148852546 17:50561831-50561853 GGGGGCTGCCAGGGAGGGGAGGG + Intronic
1148906741 17:50917233-50917255 GCGGGGGGCCAGGGCGGGGCGGG - Intergenic
1149914969 17:60600375-60600397 GCGGGCTGCGTGGGACCGGCGGG + Exonic
1150287474 17:63962189-63962211 CCGAGTTCCCAGGGAGAGGCGGG + Intronic
1152710426 17:81868403-81868425 GGGGCTGGCCAGGGAGCAGCGGG + Exonic
1152739268 17:82011924-82011946 GTGGGTGGACAGGGAGTGGCTGG + Intronic
1157618075 18:48999300-48999322 GGTGGTTGCCAGGGACCGGGGGG - Intergenic
1160793945 19:935240-935262 GTGGGTGGCCAGGCCGCGGCGGG + Intronic
1160860854 19:1236805-1236827 GCGGGTTGCCAGGGAGCGGCGGG + Intronic
1160966617 19:1749562-1749584 GCGGCTGGCCGGGGAGCGGAGGG - Intergenic
1161074889 19:2280798-2280820 GCGGGGGTGCAGGGAGCGGCAGG - Intronic
1161077167 19:2291437-2291459 GCTGGTTGCCACGGAGACGCAGG + Exonic
1161279017 19:3435036-3435058 GCTGGTTACCAGGGAGACGCGGG - Intronic
1161279525 19:3438229-3438251 AGGGGTTGCCAGTGAGCAGCCGG - Intronic
1161682436 19:5686957-5686979 GCGAGTTGCCTGGGGGCTGCGGG - Exonic
1162033873 19:7928854-7928876 TCGCTTTGCCAGGGAGCTGCTGG - Intronic
1162664926 19:12202356-12202378 GCAGGGTGCCAGGGTGCAGCGGG + Intergenic
1163597119 19:18226533-18226555 GGGGGTCGTCAGGGAGCCGCCGG - Intronic
1165079989 19:33301658-33301680 GCGCGCTGCCAGGGCCCGGCAGG + Exonic
1165830864 19:38729552-38729574 GTGGGTGGGCAGGGAGGGGCTGG + Exonic
1166200033 19:41231361-41231383 GTGGGTTCCCAGGGAGAGGATGG - Intronic
1166792599 19:45406727-45406749 GCGGGTTGACGGGGTGCGGAGGG + Intronic
926669407 2:15561975-15561997 GTTCGTTGCCAGGGAGCAGCGGG + Intergenic
927643434 2:24860208-24860230 GCCTGTTGCCAGGTGGCGGCTGG + Intronic
927658524 2:24972033-24972055 GCCTGCTGCCAGGCAGCGGCGGG - Exonic
929242378 2:39665965-39665987 GCGGGAAGCCATGGAGCCGCGGG + Exonic
934768426 2:96893576-96893598 GCTGGATGCCAGGGAGGGGATGG - Intronic
935271076 2:101435036-101435058 GCGGGTTCACAGGGAGCCGGCGG - Intronic
935361700 2:102251101-102251123 GCCGACTGCCAGGGAGCTGCGGG + Intergenic
937238049 2:120442397-120442419 GCTGCTTGGCAGGGAGCGCCGGG + Intergenic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
938262046 2:129903317-129903339 TCGGGTTGCCAGGGAGCAGGTGG - Intergenic
938480517 2:131658334-131658356 GCAGGTGTCCAGGGTGCGGCGGG + Intergenic
940145676 2:150542499-150542521 GCGGGGGGCCGGGGAGAGGCGGG + Intergenic
945281559 2:208040299-208040321 GGGGGTTGGCAGGGGGCAGCGGG - Intergenic
946902360 2:224384553-224384575 GCGGGTAGCCTGGGAGAGGCCGG - Intronic
947716416 2:232341274-232341296 GCGGGTTGCCAGGCACCACCTGG - Intronic
948796002 2:240402348-240402370 GCAAGTTGCCAGGGCCCGGCTGG - Intergenic
1168770008 20:408677-408699 CCGGGTCGCCTGGGAGAGGCGGG - Exonic
1168956593 20:1838626-1838648 GCTGGCTGCCTGGGAGCTGCTGG - Intergenic
1171256196 20:23690651-23690673 GGGGGCTGCCAGGGTGGGGCGGG - Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1175191120 20:57212797-57212819 GCTGGCTGCCAGGGTGGGGCCGG - Intronic
1175847121 20:62065035-62065057 GCGGGGGGCGAGGGCGCGGCGGG + Exonic
1175980210 20:62735019-62735041 GCGGGGTGCCAGGCACCAGCCGG + Intronic
1179375425 21:40846665-40846687 GCGGGAGGCCGGGGAGCGGCAGG - Exonic
1179879845 21:44288877-44288899 GCGGCTGGCCAGGGAATGGCGGG - Intronic
1181356182 22:22297634-22297656 GCGGGTGGCCTGGGACCGGTTGG - Intergenic
1181695894 22:24592701-24592723 GCGGGTTCCGAGGGCGCGACAGG - Intronic
1183919536 22:41153857-41153879 GGGGGTTGCCATGGAGTGGGGGG - Intronic
1184036216 22:41919577-41919599 TGAGGTCGCCAGGGAGCGGCGGG + Intergenic
1184296593 22:43529032-43529054 GCAGGCTGCCAGGAAGGGGCTGG + Intronic
1184754214 22:46507335-46507357 GGGGGTAGCCAGGGAGCTACTGG + Intronic
1185349462 22:50326999-50327021 GCGGGTTGCCGGGGAAACGCGGG + Exonic
1185408742 22:50672159-50672181 GTGGGTTGGCAGGAGGCGGCTGG + Intergenic
949895233 3:8763386-8763408 GCGTTTTACCAGGGAGAGGCTGG + Intronic
950456497 3:13095772-13095794 GCTGATTGGCAGGGAGCGGGCGG + Intergenic
954378039 3:50205187-50205209 GCGGGCCGCCAGGGATTGGCGGG + Intergenic
954422471 3:50425952-50425974 GGGGGTTGCTGGGGAGCAGCTGG - Intronic
955277035 3:57556455-57556477 GCGGGGAGCCAGACAGCGGCGGG + Exonic
961754474 3:129119967-129119989 GCAGGTAGCCAGGGAAGGGCTGG - Intronic
961827304 3:129605902-129605924 GCGCGTGTCCAGGGAGCGGATGG + Exonic
968010438 3:195270850-195270872 GCGGGCGGCGAGGGCGCGGCGGG + Exonic
968663454 4:1808472-1808494 GACGGTTTCCAGGGAGGGGCCGG + Exonic
968815056 4:2817852-2817874 GCTGGTTGCAAGGGCCCGGCGGG + Intronic
968871381 4:3244444-3244466 GGGGGTTACCTGGGAGCAGCTGG - Intronic
969212821 4:5700770-5700792 GAGGGATGACAGGGAGGGGCAGG - Intronic
969569910 4:8002198-8002220 GGGGGTTGCCAGGGGGCAGACGG - Intronic
972754764 4:42034436-42034458 GGTGGTTGCCAGGGACCGGGGGG - Intronic
981765050 4:148239599-148239621 GCGAGTTGCCAGGAAGTGCCTGG + Intronic
982556841 4:156877798-156877820 GCAGGTTGCCGGGGAGAGGTTGG - Intronic
983077526 4:163344010-163344032 AGGGGTTGGCAGGGAGGGGCGGG - Intronic
985647355 5:1091177-1091199 TAGGGTTGCCAGGGAGGGCCAGG + Intronic
986338885 5:6773898-6773920 GGGGGGTGTGAGGGAGCGGCGGG - Intergenic
986338893 5:6773918-6773940 GGGGGGTGTGAGGGAGCGGCGGG - Intergenic
986338907 5:6773960-6773982 GGGGGCTGTGAGGGAGCGGCGGG - Intergenic
986338914 5:6773980-6774002 GGGGGGTGTGAGGGAGCGGCGGG - Intergenic
986338922 5:6774000-6774022 GGGGGCTGTGAGGGAGCGGCGGG - Intergenic
986338935 5:6774042-6774064 GGGGGCTGTGAGGGAGCGGCGGG - Intergenic
986338954 5:6774084-6774106 GGGGGATGTGAGGGAGCGGCGGG - Intergenic
986338961 5:6774104-6774126 GGGGGGTGTGAGGGAGCGGCGGG - Intergenic
986338969 5:6774124-6774146 GGGGGGTGTGAGGGAGCGGCGGG - Intergenic
986339040 5:6774317-6774339 GGGGGGTGTGAGGGAGCGGCGGG - Intergenic
990382658 5:55232284-55232306 ACGGGCGGCCAGGGAGTGGCGGG + Intronic
996495310 5:124148702-124148724 ACAGGTTGCCAGGGAACGGGGGG + Intergenic
998352923 5:141512715-141512737 GCGGGTGGGCAGCGGGCGGCGGG + Exonic
999247638 5:150163697-150163719 GCGGGGCGCCAGAGAGCAGCAGG - Intergenic
1001400326 5:171442541-171442563 GCTGGGAGCCAGGGAGGGGCTGG - Intronic
1002059003 5:176615302-176615324 GAGGGCTGCCAAGGAGCAGCTGG - Intergenic
1003026884 6:2562922-2562944 GCTGGTTGCCAGGCAGCCTCTGG + Intergenic
1003645682 6:7911124-7911146 GCGGGAAGCCACGGAGGGGCAGG + Intronic
1004176791 6:13347148-13347170 CCAGGTTGCCACGGAGAGGCAGG - Intergenic
1004690164 6:17987026-17987048 GCGGGTTCCGAGAGGGCGGCTGG - Intronic
1005740821 6:28788982-28789004 GCAGGTTGACAGGGAGAGACTGG + Intergenic
1005987582 6:30884267-30884289 GCGGGTTACCTGGGGGAGGCCGG + Intronic
1006891537 6:37433341-37433363 GCGAGCTGCCGGGGAGCGGAGGG - Exonic
1006898256 6:37484307-37484329 GCGGGGCGCCAGAGGGCGGCTGG - Intronic
1018747894 6:166776576-166776598 GCTGGTTGCCAGGGACTGGGAGG - Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019687847 7:2391635-2391657 GCGGGCTGACAGGGACCTGCTGG + Intergenic
1022013712 7:26330452-26330474 GAGAGTTACCAGGGAGGGGCGGG + Intronic
1022700395 7:32754125-32754147 GCGGCTGGCCAGGCAGGGGCTGG - Intergenic
1024048617 7:45602068-45602090 GGGGTTTGCCAGGTAGAGGCAGG + Intronic
1026858600 7:73770448-73770470 GGGGGTTGCCAAGGAAGGGCGGG + Intergenic
1029350459 7:100009723-100009745 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029350476 7:100009784-100009806 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029439228 7:100578060-100578082 GCAGGGTGCCAGGCAGAGGCTGG - Intronic
1029444562 7:100604921-100604943 GCAGGTTAACAGAGAGCGGCCGG - Intronic
1035051055 7:155999260-155999282 GTGGGTTCCCAGGGCGGGGCGGG + Intergenic
1035578950 8:727970-727992 GCAGGGAGACAGGGAGCGGCCGG + Intronic
1049207034 8:141368350-141368372 GGGGGTTGTCGGGGAGCGGTTGG + Intergenic
1049210113 8:141382145-141382167 GTTGGTTGCCAGGGCTCGGCGGG - Intergenic
1057584752 9:96319319-96319341 GGGGGTTGCCAGGGGCCGGAGGG + Intergenic
1057909140 9:99004653-99004675 CGGGGTTGGCAGGGAGTGGCTGG + Intronic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1059852989 9:118364361-118364383 GCTGGTTGCCATGGAGGGGTGGG - Intergenic
1060823796 9:126676144-126676166 GAGGGTTGCGAGGGAAGGGCGGG - Intronic
1061043019 9:128150602-128150624 GAGGGGTGCCTGGGAGCGGGAGG + Intronic
1062185384 9:135215532-135215554 GAGGCAGGCCAGGGAGCGGCAGG + Intergenic
1062591786 9:137277733-137277755 GTGGGTCCCCAGGGAGCGGCCGG - Exonic
1062707135 9:137951998-137952020 GAGTGTTGCCAGGCAGTGGCTGG + Intronic
1203773026 EBV:58994-59016 GCGGGAGGTCAGGGGGCGGCCGG + Intergenic
1197184378 X:123570365-123570387 GCAGGTTGCCAGGGAACTGGGGG - Intergenic
1200045017 X:153396681-153396703 GCTGGGTGCAAGGGAGCGGGGGG + Intergenic
1200093608 X:153647218-153647240 TCCGGCTGCCAGGAAGCGGCCGG + Exonic
1200163206 X:154019644-154019666 GCGGGCTGCCGGGGGGCGGGAGG - Intronic