ID: 1160861593

View in Genome Browser
Species Human (GRCh38)
Location 19:1239530-1239552
Sequence AGCCTCCCCCCGTTTAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160861593_1160861601 9 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861601 19:1239562-1239584 TAGGCAAGAGATGGTAGCCGCGG No data
1160861593_1160861602 12 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861602 19:1239565-1239587 GCAAGAGATGGTAGCCGCGGTGG No data
1160861593_1160861603 21 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861603 19:1239574-1239596 GGTAGCCGCGGTGGCCATGCTGG No data
1160861593_1160861597 -10 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861597 19:1239543-1239565 GGGGGAGGCTGGGGCCTCCTAGG No data
1160861593_1160861604 22 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861604 19:1239575-1239597 GTAGCCGCGGTGGCCATGCTGGG No data
1160861593_1160861598 0 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861598 19:1239553-1239575 GGGGCCTCCTAGGCAAGAGATGG No data
1160861593_1160861606 30 Left 1160861593 19:1239530-1239552 CCTGTACTAAACGGGGGGAGGCT No data
Right 1160861606 19:1239583-1239605 GGTGGCCATGCTGGGTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160861593 Original CRISPR AGCCTCCCCCCGTTTAGTAC AGG (reversed) Intergenic
No off target data available for this crispr