ID: 1160861703

View in Genome Browser
Species Human (GRCh38)
Location 19:1239979-1240001
Sequence CCGTGTTCAGGCCAGTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160861703_1160861712 -9 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861712 19:1239993-1240015 TGAACACGGGCAGGGGGCGAGGG No data
1160861703_1160861717 19 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861717 19:1240021-1240043 CCTCCGGATGTAGGGAGCCACGG No data
1160861703_1160861715 11 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861715 19:1240013-1240035 GGGTGCAGCCTCCGGATGTAGGG No data
1160861703_1160861714 10 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861714 19:1240012-1240034 AGGGTGCAGCCTCCGGATGTAGG No data
1160861703_1160861711 -10 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861711 19:1239992-1240014 CTGAACACGGGCAGGGGGCGAGG No data
1160861703_1160861719 29 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861719 19:1240031-1240053 TAGGGAGCCACGGATCGTGTCGG No data
1160861703_1160861713 3 Left 1160861703 19:1239979-1240001 CCATTGCACTGGCCTGAACACGG No data
Right 1160861713 19:1240005-1240027 GGGGGCGAGGGTGCAGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160861703 Original CRISPR CCGTGTTCAGGCCAGTGCAA TGG (reversed) Intergenic
No off target data available for this crispr