ID: 1160862203

View in Genome Browser
Species Human (GRCh38)
Location 19:1242126-1242148
Sequence GGCAGCAGAGGCAGGGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 589}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160862203_1160862210 3 Left 1160862203 19:1242126-1242148 CCCTCGGCCCTGCCTCTGCTGCC 0: 1
1: 0
2: 5
3: 68
4: 589
Right 1160862210 19:1242152-1242174 GCCCTGCGCTGCCCTCGTCCCGG 0: 1
1: 0
2: 2
3: 17
4: 326
1160862203_1160862212 4 Left 1160862203 19:1242126-1242148 CCCTCGGCCCTGCCTCTGCTGCC 0: 1
1: 0
2: 5
3: 68
4: 589
Right 1160862212 19:1242153-1242175 CCCTGCGCTGCCCTCGTCCCGGG 0: 1
1: 0
2: 1
3: 40
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160862203 Original CRISPR GGCAGCAGAGGCAGGGCCGA GGG (reversed) Intronic