ID: 1160864904

View in Genome Browser
Species Human (GRCh38)
Location 19:1252216-1252238
Sequence GCTCCTCGGTGGGGGCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160864904_1160864913 -4 Left 1160864904 19:1252216-1252238 CCCCTCCGCCCCCACCGAGGAGC 0: 1
1: 0
2: 1
3: 25
4: 246
Right 1160864913 19:1252235-1252257 GAGCCCCCCTCCAGCCGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160864904 Original CRISPR GCTCCTCGGTGGGGGCGGAG GGG (reversed) Intronic
900343412 1:2199314-2199336 GCCCCTGGGTGGGGGCTGAGTGG - Intronic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
901068630 1:6506426-6506448 TCTCCTCGGTGGGGGCTCCGAGG - Intronic
901109977 1:6785964-6785986 GGTCCACGGTGGGGGCCGCGGGG + Intronic
905182654 1:36176488-36176510 GCTCACCGGCGGGGGCGCAGCGG - Exonic
905505561 1:38476526-38476548 GCTCCTGGGTGGGGGGGGCGCGG - Intergenic
906141014 1:43533474-43533496 GGTCCTCCCTGGGGGCGGGGAGG + Intronic
911440528 1:97920844-97920866 GCTCGTCGGTGGTGGCGGGGTGG - Intronic
912272972 1:108229142-108229164 CCGCCTCGGTGGGGGCTGAAAGG + Exonic
912295247 1:108465180-108465202 CCGCCTCGGTGGGGGCTGAAAGG - Exonic
915594560 1:156888694-156888716 GCTCCTGGAAGGGGCCGGAGAGG - Intergenic
916059655 1:161089694-161089716 GGACCTGGGTGGGGGCGGTGGGG + Intergenic
916683721 1:167126402-167126424 GCTCCTCGGTGGGGAGGCGGCGG + Exonic
917654965 1:177117117-177117139 GCCACTCGGTGGGGGTGGGGAGG - Intronic
920769995 1:208875080-208875102 GCTAATGGGTGGGGGAGGAGGGG - Intergenic
922572427 1:226642019-226642041 CCTCCTCGGTGGGGGCCTCGGGG + Exonic
923030654 1:230246773-230246795 GCTCCAGGGTGGGTGCGGTGAGG - Intronic
1062834017 10:624298-624320 GCTCCTCGGTGGCTGCAGATGGG + Intronic
1064244927 10:13660625-13660647 GCTCCAAGGTGCGGGTGGAGGGG - Intronic
1066080655 10:31928325-31928347 TCTCCTCCCTGGGGGCGGGGCGG + Intronic
1067944983 10:50683603-50683625 GCTCGCCGGTGGGGCCGGGGTGG - Intergenic
1070866486 10:79710474-79710496 GCTCGCCGGTGGGGCCGGGGTGG - Exonic
1070891003 10:79942205-79942227 GCTCCTCTGTGGAGGGTGAGAGG + Intronic
1071633396 10:87232695-87232717 GCTCGCCGGTGGGGCCGGGGTGG - Exonic
1071646845 10:87364913-87364935 GCTCGCCGGTGGGGCCGGGGTGG - Exonic
1072621684 10:97083953-97083975 GCTCCTGGGTGGTGGCCCAGAGG - Intronic
1075608718 10:123834796-123834818 CCTCCTTGGTGGGGGTGCAGGGG + Intronic
1077122215 11:914819-914841 GCTCCTGGGTGGGGTCGCGGCGG + Intronic
1077149118 11:1060855-1060877 GCTTCTCGGGGGAGGGGGAGGGG + Intergenic
1077243631 11:1525076-1525098 GCACCTCTGTGAGGGCGGGGCGG - Intergenic
1077390797 11:2299956-2299978 GCTCCTTGGTGGGGTAGGGGTGG + Intronic
1077493233 11:2871704-2871726 GCTCCTCACGGGGGGCGGGGGGG + Intergenic
1079460344 11:20672972-20672994 GCTACTCGGGGGGGGGGGGGGGG - Intronic
1081670152 11:44938236-44938258 GATCCTCGGCGTGGGCGGGGAGG - Exonic
1084122425 11:67077470-67077492 GCCCCTGGGTGTGGCCGGAGTGG - Intergenic
1084192780 11:67506326-67506348 GCGCCACGGCTGGGGCGGAGAGG + Intergenic
1085448136 11:76614889-76614911 GATCCTCGGTAGGGGAAGAGGGG + Intergenic
1087672682 11:101127310-101127332 GCTCCCCGGGGCGGCCGGAGAGG - Intronic
1089566797 11:119375992-119376014 GCTGCTAGGAGGAGGCGGAGGGG - Intronic
1090860852 11:130651216-130651238 GCTGCTCTGTGGGGGAGGAAGGG - Intergenic
1091754270 12:3041391-3041413 GCTCCCCGGGGGTGGAGGAGGGG + Intergenic
1091823494 12:3492749-3492771 GCGCCGAGATGGGGGCGGAGTGG + Intronic
1093662552 12:21774511-21774533 GCTGCTCCGGGGGAGCGGAGGGG - Intronic
1096178601 12:49538889-49538911 GGACCTCGGCGGGGGCGGGGAGG - Intergenic
1096435813 12:51590810-51590832 GCGGCTCGGCGGGGGCGTAGTGG + Intronic
1097175919 12:57142914-57142936 TCTCCTAGGTGGGGGTGGAGTGG + Intronic
1097221301 12:57452758-57452780 ACTCTTTGGTGGGGGTGGAGTGG - Intronic
1098321535 12:69249146-69249168 GCTACTCGGGGGGGGGGGGGGGG + Intronic
1099014121 12:77324933-77324955 GCTGCTAGGTGGCGGCGGCGCGG + Intergenic
1101548853 12:105742764-105742786 ACTCATGGGTGTGGGCGGAGGGG - Intergenic
1102252462 12:111396942-111396964 GCTACTCGATGGTGGCTGAGAGG + Intergenic
1102519753 12:113471021-113471043 GCTGCTTGGAAGGGGCGGAGAGG + Intronic
1103930901 12:124450274-124450296 GCTGGTCAGTGGGGGTGGAGTGG - Intronic
1104640836 12:130465872-130465894 GGTGCTGGGTGGGGGCAGAGGGG - Intronic
1106735807 13:32586811-32586833 GCTGCGCGGTGGGGGTGGGGAGG + Intronic
1107978653 13:45713934-45713956 GCTCCTCGAAGCGGGAGGAGAGG - Exonic
1111973908 13:94945872-94945894 GCTTATCAGTGGAGGCGGAGGGG - Intergenic
1113906315 13:113820878-113820900 GCTCCACGGGGGGGCAGGAGTGG + Exonic
1118220974 14:63853772-63853794 GCGCCTCCGCGGGGGCGGGGGGG + Intronic
1119379274 14:74218363-74218385 GCCCCAAGGTGGGGGTGGAGGGG + Intergenic
1119602026 14:75982678-75982700 GCTGCGGGGTGGGGGCTGAGGGG + Intronic
1121845510 14:97169046-97169068 GCTCCTTGGTGTGGGAGGACAGG - Intergenic
1122887576 14:104717252-104717274 CCTGCCCGGTGGGGGCGGACTGG - Intronic
1122975200 14:105168192-105168214 GCGGCTGGGTGGGGGCGGGGCGG - Intronic
1123037713 14:105478194-105478216 GCTGCCAGGTGGGGGCGGAGGGG + Intronic
1124226815 15:27901973-27901995 GGTCCTGGCAGGGGGCGGAGGGG + Intronic
1125832628 15:42727682-42727704 GCTGCCCGGGGGGAGCGGAGGGG - Exonic
1129521971 15:76191868-76191890 GCTCCTGCATGGGGGCGGGGTGG - Intronic
1131793109 15:95986489-95986511 GCTTCTCAGTGGTGGCAGAGAGG - Intergenic
1132072972 15:98796109-98796131 GCTTCTCCGTGGGAGCGAAGTGG + Intronic
1132497839 16:272246-272268 GCACCTCGCTGGGGCCAGAGCGG + Intronic
1132585914 16:705694-705716 GCTCCCCGGTGGGAGAGGATCGG + Exonic
1132604476 16:788064-788086 GCCCGACGGTGGGGGCGGGGAGG + Intronic
1132754168 16:1474670-1474692 GCTCCTCGGCGGGGCCGGGCTGG - Intronic
1132833960 16:1943239-1943261 GGTCCTCGGGAGGGGCGGGGAGG - Exonic
1132885534 16:2180512-2180534 GCGCTTGGGTGGGGGCGGCGGGG + Exonic
1133342249 16:5044354-5044376 GCTGCTTGGTGGTGGCGGTGTGG + Exonic
1134235975 16:12466792-12466814 GGTCCTCGGTGGGCTCCGAGGGG + Intronic
1134463991 16:14456816-14456838 GCTCCTCCGTGGGGATGGTGCGG - Intronic
1135549763 16:23389081-23389103 GATAGTCTGTGGGGGCGGAGAGG + Exonic
1135852559 16:25977795-25977817 GCTCCTGTGTGGGGACGAAGTGG + Intronic
1136626354 16:31464553-31464575 GCTCCTCGATGGCGGCGGCGGGG - Exonic
1136993326 16:35170384-35170406 GCCGCGCGGTGGGCGCGGAGAGG - Intergenic
1137257689 16:46790283-46790305 GCTGCACAGTGGGGGCGGCGGGG + Intronic
1137750660 16:50858962-50858984 GCTCCTTGGCGGGGGGGGGGGGG - Intergenic
1138562102 16:57807410-57807432 GCTCCTCAGTGGGCATGGAGAGG + Intronic
1141132330 16:81444891-81444913 GCGCCGGGGTGGGGGCGGCGGGG - Intergenic
1141831089 16:86510343-86510365 GCTCCTCGGGGAGGGCGGGCGGG + Intergenic
1142120466 16:88384022-88384044 GGTCCCCGGCGGGGGCGGGGGGG + Intergenic
1142707799 17:1707734-1707756 GCCCCTCGCTGGGGGAGGTGGGG - Exonic
1142740699 17:1930330-1930352 GCGCCTGGGTGAGGGAGGAGGGG + Intergenic
1143448497 17:7022388-7022410 GCCCCGAGGTGGGGGTGGAGGGG - Intergenic
1145205538 17:20983255-20983277 AGTCCTGGGTGGGGGCGGGGTGG + Intergenic
1146439016 17:32877221-32877243 GCTCCTCAGTGGGCCGGGAGGGG - Intergenic
1147723658 17:42553686-42553708 GTTCCGCGGGGGGGGTGGAGTGG + Intronic
1148446339 17:47739985-47740007 GGTCCTCGGTGGGAGAGCAGAGG - Intronic
1148912002 17:50947800-50947822 GCTCCTCTGTGGGGCTGGAGGGG + Intergenic
1149430578 17:56593553-56593575 GCTCCTCGGGGGTGGAGAAGTGG + Intergenic
1150284287 17:63946583-63946605 GCTCATCAGTGGGGGGTGAGGGG + Intronic
1151758821 17:76089367-76089389 ACTCCTGGCTGGGGGCGGCGTGG + Intronic
1151992131 17:77582129-77582151 GCTTCTGGGTGGGGGTGGGGGGG + Intergenic
1152064865 17:78105326-78105348 GCTCCGCGGCGGGAGCTGAGCGG + Exonic
1152229351 17:79106725-79106747 GCTTCTCTGTAGGGTCGGAGGGG + Exonic
1152335484 17:79698237-79698259 GCTTCTGCGTGGGGGCGGGGAGG - Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152505343 17:80746195-80746217 GCACCGCTGTGGGGGCGGTGGGG - Intronic
1152505354 17:80746232-80746254 GCACCGCTGTGGGGGCGGTGGGG - Intronic
1152505365 17:80746269-80746291 GCACCGCTGTGGGGGCGGTGGGG - Intronic
1152505376 17:80746306-80746328 GCACCGCTGTGGGGGCGGTGGGG - Intronic
1152505387 17:80746343-80746365 GCACCGCTGTGGGGGCGGTGGGG - Intronic
1155093738 18:22536111-22536133 GCTACTCGGTGTGGGGGCAGGGG - Intergenic
1156508690 18:37616698-37616720 GCTACTTGGTGGTGGGGGAGGGG + Intergenic
1156726200 18:40130460-40130482 GTACCTGGGTTGGGGCGGAGGGG + Intergenic
1157579395 18:48764659-48764681 CCTCCACTGTGGGGGAGGAGAGG - Intronic
1158546810 18:58404264-58404286 GCCCCTCGGTGGAGGTGGTGGGG - Intergenic
1159511261 18:69400841-69400863 GCTCCCCGGCGCGGGGGGAGGGG - Intergenic
1160432826 18:78823625-78823647 GCCCTTCAGTGGGGTCGGAGAGG + Intergenic
1160789957 19:918722-918744 GCTCCGCAGTGGGAGGGGAGGGG + Intronic
1160789972 19:918771-918793 GCTCCGCAGTGGGAGGGGAGGGG + Intronic
1160864904 19:1252216-1252238 GCTCCTCGGTGGGGGCGGAGGGG - Intronic
1161284701 19:3463302-3463324 CGTCCTCGGTGGGGGCTGAGGGG - Intronic
1161398732 19:4058518-4058540 GCTCCCAGGAGAGGGCGGAGGGG - Intronic
1162035262 19:7934966-7934988 GCTCCTGGGTGGGGGTGGCTTGG - Intronic
1162521510 19:11182900-11182922 GCTTTTCTGTTGGGGCGGAGTGG - Intronic
1162958535 19:14113080-14113102 GCTCCTATGCGGGGGTGGAGAGG + Intronic
1163034781 19:14564338-14564360 GGGGCTCGGTGGGGGCGGGGCGG - Intronic
1163758506 19:19120667-19120689 GGACCGCGGTGGGGGGGGAGAGG - Intronic
1164575151 19:29401555-29401577 GCTGCCCGGTAGGGGCGGTGGGG - Intergenic
1164930400 19:32170777-32170799 GCTCACCCGTGGGGGTGGAGGGG + Intergenic
1165146677 19:33735244-33735266 GCTCCTCCATGGGGAGGGAGGGG + Intronic
1165163394 19:33832097-33832119 CCCCCTTGGTGGGGGAGGAGAGG - Intergenic
1166333624 19:42092308-42092330 GTTCCTCAGTGGGGGACGAGTGG - Intronic
1166746833 19:45145700-45145722 GCTGCTCGGTGGGTGTGGAGGGG - Exonic
1167091771 19:47349251-47349273 GCTCTTCTGTGGTGGCGGGGCGG + Intergenic
1167260344 19:48454528-48454550 GCTCCTCGGCTAGGGCTGAGGGG - Exonic
1167269383 19:48498927-48498949 ACTCCTCGCTGCGGGCAGAGCGG - Exonic
1167471270 19:49677590-49677612 GCTGCGCGGTGGGTGGGGAGGGG + Intronic
1168651732 19:58096486-58096508 GCTCCACGGTGGGTGAGGGGTGG + Intronic
1168721820 19:58558538-58558560 GCCGCGCGGTGGGCGCGGAGAGG - Exonic
925029207 2:636496-636518 GCTCCTCAGAGGGGCCGGTGAGG - Intergenic
925131365 2:1496335-1496357 GCTCCTGGGGCGGGGCGGGGCGG + Intronic
925412904 2:3650292-3650314 GCTCCTCCTGGGGGCCGGAGTGG + Intergenic
926069795 2:9877862-9877884 TCCCCTTGGTGGGGGAGGAGAGG - Intronic
927114380 2:19886598-19886620 GCTGCTTGGTTGGGGTGGAGGGG - Intergenic
927640270 2:24841420-24841442 CCTCCTCAGTGAGGGAGGAGTGG + Intronic
927754478 2:25697775-25697797 GCAACTCGGTGGGAGGGGAGGGG + Intergenic
927964884 2:27262528-27262550 GCGCCGCGGGGGTGGCGGAGGGG + Intronic
928549516 2:32357283-32357305 GCTCCTCGGCGGCGGGGGCGGGG + Exonic
929604666 2:43226555-43226577 GCTCCGCGGGGGGGGCGGGCCGG - Exonic
930071329 2:47369087-47369109 GCACCTGGGGCGGGGCGGAGCGG + Intronic
933683363 2:85123118-85123140 GCTACTTGTTGGGGGCTGAGAGG - Intergenic
934712945 2:96527590-96527612 GGTCCTCGGTGGGGGTGGAATGG + Intergenic
937307393 2:120880917-120880939 GCTCCCTGGTGGGGGCAGGGGGG - Intronic
938405733 2:131032190-131032212 GCTCCTCTGTGGGGCCGAGGAGG + Intronic
942712165 2:178848762-178848784 GCTCCTCGGTGGTGGGGTGGAGG + Intronic
944111434 2:196135488-196135510 GCTCCTGGGCGGGGGCGCAGTGG + Exonic
944528959 2:200649195-200649217 GATCCATGGTGGGGGCGGAGGGG - Intronic
946152326 2:217785051-217785073 GCCCCTCGGGGGTGGCAGAGAGG + Intergenic
947558775 2:231126288-231126310 GCTACTGGGCGGCGGCGGAGGGG + Intronic
948824208 2:240566554-240566576 CCTCCTCGGGCGGGGCGGGGCGG + Intronic
948828763 2:240587104-240587126 GCTCCTCGCAGGGAGCGGGGCGG + Intronic
1168831402 20:847048-847070 GCCCCACGGTGGGCGTGGAGAGG + Intronic
1173656659 20:44704380-44704402 GCTCCTCGGTGGGGCCTTGGGGG + Intergenic
1175247613 20:57591218-57591240 GCTCTTCTGTGGGGCCGGGGCGG + Intergenic
1175521343 20:59604381-59604403 GCGCCGGGGTGGGGGAGGAGGGG - Intronic
1175715820 20:61253407-61253429 GCCCCTGGGCGGAGGCGGAGGGG + Intronic
1175765250 20:61587879-61587901 GGGCCTGGGCGGGGGCGGAGTGG - Intronic
1176233700 20:64044569-64044591 GCTGAGAGGTGGGGGCGGAGTGG + Intronic
1176790067 21:13310333-13310355 TCACCTCGTTGTGGGCGGAGAGG - Intergenic
1180156932 21:45982468-45982490 GTCCCTCGGTGGGGACGGTGGGG - Intronic
1180650004 22:17369668-17369690 GGTCCTCGGCGGGGGCGGCGGGG - Exonic
1181003218 22:19997754-19997776 GCTCATCATTGGGGGCGGAGTGG - Intronic
1181179171 22:21055245-21055267 GCCCCTGGGTGGGGGCTGTGGGG - Intronic
1181781977 22:25200156-25200178 GCTCCTCTGAGGGAGGGGAGTGG + Intronic
1181917528 22:26292779-26292801 GCTTCTCCGTGGAGGAGGAGAGG - Exonic
1182456813 22:30456993-30457015 GCTCCTCTGTGGCAGCTGAGTGG - Intronic
1182481841 22:30614299-30614321 GCTGCTGGGTGGGGGCAGAGAGG + Intronic
1183411157 22:37655641-37655663 GCTCCTGGGGCGGGGCTGAGGGG - Exonic
1183601392 22:38842587-38842609 GCTCTTGGGTGGGGGCTGAATGG - Intronic
1183686109 22:39362316-39362338 GCTCGGTGGTGGGGGTGGAGTGG - Intronic
1183833991 22:40436932-40436954 GCCCCCCGCTGGGGGTGGAGAGG - Intronic
1183956256 22:41382194-41382216 GCGCCTCGGTGAGGGCGGGGGGG + Exonic
950056152 3:10026401-10026423 GCGCCTCGGTGGCGTCAGAGCGG + Exonic
956505090 3:69929379-69929401 GCTCCTGGGGTGGGGTGGAGTGG + Intronic
961332098 3:126148431-126148453 GCTCCCCGGTGTTGGTGGAGGGG - Intronic
961495251 3:127286936-127286958 GCTCCTGGGCGGTGGGGGAGGGG + Intergenic
961538439 3:127584327-127584349 GCTACTCGGTGGGGCCGAGGTGG + Intronic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
965395819 3:168159511-168159533 GCTCTTCGGTGGAGACTGAGGGG + Intergenic
965928132 3:174008355-174008377 GCTCCTCCGTGGGCGGGGGGTGG - Intronic
968066453 3:195762072-195762094 GCTCCTGGGTGAGGGCGGCTCGG - Exonic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
969641435 4:8401477-8401499 GGTCCTAGGTGGGGATGGAGGGG - Intronic
971194860 4:24462918-24462940 GCTCCTGGGTGAAGGTGGAGGGG - Intergenic
973616525 4:52684175-52684197 GCTTCTCTGTGGGGGTGGGGTGG + Intergenic
973623764 4:52751452-52751474 GATCCTGGGTTGGGGCGGAGCGG + Exonic
973623778 4:52751484-52751506 GATCCTGGGTTGGGGCGGGGCGG + Exonic
982109580 4:152041530-152041552 GCTGGTGGGTGGGGGCGGTGGGG - Intergenic
984923407 4:184785591-184785613 CCTCCTGGGCGGGGGCGGGGGGG + Intronic
985025806 4:185737897-185737919 GCTCCAGGGAGGAGGCGGAGGGG + Intronic
985717391 5:1470299-1470321 GCTGCTCCCTGGGGGCTGAGTGG - Intronic
993307586 5:86290819-86290841 CCGCCTCGGTGGGGGCTGAAAGG - Intergenic
995764676 5:115602361-115602383 GCCCCTCGGGGGCGGCGGGGTGG - Exonic
995859263 5:116624592-116624614 GCTGCACGGTGGGGGATGAGGGG + Intergenic
996004541 5:118404968-118404990 CCTCCTCGGTGGGGGGGGGTGGG + Intergenic
996962707 5:129270209-129270231 GCACCTCACTGGGGGCAGAGTGG - Intergenic
997346395 5:133195457-133195479 CCTCCTGGCTGGGGGTGGAGGGG + Intergenic
997884716 5:137619893-137619915 GCTTCTCAGTGGTGGGGGAGGGG + Exonic
1002087950 5:176787525-176787547 TCTCCATGGTGGGGGCGGGGGGG + Intergenic
1005327916 6:24720414-24720436 GGTCCCAGGTGGGGGCTGAGCGG - Exonic
1006296187 6:33171083-33171105 GGCCTTCGGTGGGGGTGGAGGGG + Intronic
1007390623 6:41547780-41547802 ACTCCTCAGTTGGGGCGGGGGGG - Intronic
1009289868 6:61868723-61868745 ACTCCTTGGTGGGGGAGGGGTGG - Intronic
1012550947 6:100464546-100464568 GCTCCGCGGTGGTGTGGGAGAGG - Intronic
1012815458 6:104017821-104017843 GCTGCCTGGTGGGGGTGGAGGGG - Intergenic
1012873237 6:104696149-104696171 GCCCCATGGTGGGGGCGGGGGGG + Intergenic
1013459175 6:110358496-110358518 GCACCTCCGGAGGGGCGGAGAGG - Intergenic
1014586330 6:123202230-123202252 CCACCACGGTGGGGGCGGGGGGG - Intergenic
1015726987 6:136309299-136309321 GCTACTCGGTGGGGGTGCTGAGG - Intergenic
1015749914 6:136549850-136549872 GCTCCTCAGCGGGGTCGGTGTGG - Intronic
1018345936 6:162899418-162899440 GCTCCTAGGTGGTGCCGAAGCGG - Intronic
1019208001 6:170378751-170378773 GCTCCTGGTTGTGGGCGGGGTGG + Intronic
1019735518 7:2648157-2648179 GCTCTGCGGTGGGGGCTGAGCGG + Intronic
1020009142 7:4799040-4799062 GCTGCTCGGAGGGGCCGCAGGGG - Intronic
1020347659 7:7182773-7182795 GCCCCTCCTGGGGGGCGGAGAGG - Exonic
1024627189 7:51218022-51218044 GCTCCTCAGTGGGGGCCCTGTGG - Intronic
1026522893 7:71132064-71132086 ACTCCGCGCGGGGGGCGGAGAGG + Intergenic
1026974746 7:74490461-74490483 GCTCCCCAGTGGGGGTAGAGTGG - Intronic
1027270940 7:76518395-76518417 GCTCCTCAGTGGGCTCAGAGAGG - Intergenic
1027320701 7:77008226-77008248 GCTCCTCAGTGGGCTCAGAGAGG - Intergenic
1028622191 7:92836661-92836683 GCCGCTCGCTGGGGGCGGACGGG + Intergenic
1030591647 7:111489456-111489478 GCCCCTCAGTGAAGGCGGAGAGG - Intronic
1030604427 7:111624347-111624369 GCTTCTCAGTGGAGGTGGAGAGG + Intergenic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1034215223 7:149400480-149400502 GTACCTCGGTGGGGAAGGAGAGG - Intergenic
1035662899 8:1360689-1360711 TCTCCATGGTGGGGGCGGTGTGG - Intergenic
1036167185 8:6446952-6446974 GCACCCTGGTGGGGACGGAGAGG + Intronic
1036663097 8:10721026-10721048 GCTCCACGCTGGGGCAGGAGAGG + Intergenic
1038360159 8:26867013-26867035 GCTCTTCTCTGGAGGCGGAGAGG + Intronic
1040610438 8:48977520-48977542 GGCCCGCGGTGTGGGCGGAGAGG - Intergenic
1041089857 8:54291930-54291952 GCTCCCAGGTGGGAGTGGAGTGG + Intergenic
1041176904 8:55206403-55206425 GCTCCTGGGTGGGTGGGGACTGG - Intronic
1041254208 8:55965357-55965379 TCTCCTGGGTGGGGGAGGAGTGG + Intronic
1042267712 8:66925646-66925668 GCTCTGGGGAGGGGGCGGAGGGG + Intergenic
1044242400 8:89902532-89902554 GCGCCGCGATAGGGGCGGAGCGG - Exonic
1047998537 8:130358437-130358459 GCTCCTCAGCGGCGGGGGAGGGG + Intronic
1048032883 8:130649649-130649671 GCTGCTGGATGGGGGAGGAGGGG + Intergenic
1049304488 8:141893714-141893736 GCTCCTCTGAGGGGGTGGGGAGG - Intergenic
1052218653 9:25995515-25995537 GCTCCTCGGGGGGCGGGGGGCGG - Intergenic
1053482282 9:38424465-38424487 ACTGCTCGGCGGGCGCGGAGCGG - Intergenic
1057772862 9:97983502-97983524 TTTCCGCGGCGGGGGCGGAGGGG - Exonic
1059354075 9:113686390-113686412 CCTCCTAGCTGGGGGCAGAGTGG - Intergenic
1059785750 9:117581884-117581906 ACTTCTGGGTGGGGGCGGGGGGG - Intergenic
1060845927 9:126837538-126837560 CCTCCTGGGTGGGCGTGGAGAGG + Exonic
1061571041 9:131477605-131477627 ACTCCTCGGGTGGGGAGGAGCGG - Intronic
1061968885 9:134032934-134032956 GCTCCTCGGAGGGAACAGAGCGG - Exonic
1062005750 9:134237666-134237688 GCTCCATGGTGGGGGTGGCGAGG + Intergenic
1062341416 9:136095313-136095335 GCACCGCGGCGGGGGCGGGGCGG + Intergenic
1203362007 Un_KI270442v1:223978-224000 GCTCCTACGGGGGGGGGGAGGGG + Intergenic
1186361356 X:8845320-8845342 GGTCCTCCCTGGGGGTGGAGAGG + Intergenic
1188004769 X:25009744-25009766 GCTCCTTGTGCGGGGCGGAGGGG + Intronic
1189262751 X:39689584-39689606 GCCCCTCGGTGGGGGTGGAGGGG + Intergenic
1190416413 X:50184503-50184525 GCTCCTTGTTGGGGGTTGAGGGG - Intergenic
1193679554 X:84501885-84501907 GCACCTTGGTGGGGGCGGGGTGG - Intronic
1194035329 X:88863937-88863959 GCTTCTCGGTGGGCGCGGGTGGG + Intergenic
1196106223 X:111898865-111898887 TCTCCTTGGTGGGGGAGGAGTGG - Intronic
1197050138 X:122047339-122047361 GATCCTCGGTGGGGGGAGGGGGG + Intergenic
1197226322 X:123960107-123960129 GCGCCTCGCGAGGGGCGGAGGGG + Intergenic
1197458461 X:126707592-126707614 GCTTGTGGGTGGGGGTGGAGAGG + Intergenic
1198311157 X:135426421-135426443 GCCCCTGGGTGGGGGTGGGGAGG + Intergenic
1200786365 Y:7263918-7263940 GCCTGTCGGTGGGGGCGGGGAGG - Intergenic
1201396691 Y:13556025-13556047 CCTCCTCAGTTGGGGCAGAGAGG - Intergenic