ID: 1160865849

View in Genome Browser
Species Human (GRCh38)
Location 19:1255639-1255661
Sequence CCTGCAGCAGGGAGGCTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 618}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160865849_1160865859 10 Left 1160865849 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 74
4: 618
Right 1160865859 19:1255672-1255694 GATCCGCATGTGCAAGCCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 89
1160865849_1160865862 18 Left 1160865849 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 74
4: 618
Right 1160865862 19:1255680-1255702 TGTGCAAGCCCCCGGGTGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 144
1160865849_1160865868 29 Left 1160865849 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 74
4: 618
Right 1160865868 19:1255691-1255713 CCGGGTGAGTGGCCACCCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1160865849_1160865860 11 Left 1160865849 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 74
4: 618
Right 1160865860 19:1255673-1255695 ATCCGCATGTGCAAGCCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1160865849_1160865869 30 Left 1160865849 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 74
4: 618
Right 1160865869 19:1255692-1255714 CGGGTGAGTGGCCACCCTCGGGG 0: 1
1: 0
2: 2
3: 5
4: 71
1160865849_1160865866 28 Left 1160865849 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 74
4: 618
Right 1160865866 19:1255690-1255712 CCCGGGTGAGTGGCCACCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160865849 Original CRISPR CCTGCAGCAGGGAGGCTGAG GGG (reversed) Exonic
900139492 1:1133609-1133631 CCTGTGGAAGGGAGGCTGGGAGG - Intergenic
900181734 1:1314069-1314091 CCTGCAGCAGCCGGGCTCAGCGG + Intronic
900806664 1:4772036-4772058 ATTACAGCAGGGAGGATGAGGGG - Intronic
901050405 1:6423406-6423428 GCTCCAGCAGCGAGGCTGCGAGG + Intronic
901154117 1:7123985-7124007 CCTGCAGCTGAGAAGCTGTGGGG - Intronic
901242247 1:7702243-7702265 GCTGCTGCAGGAAGGGTGAGGGG + Intronic
901870017 1:12133022-12133044 CCTGCTCCAGGGTGGCTAAGCGG + Intronic
901965652 1:12863758-12863780 AGTGTAGGAGGGAGGCTGAGGGG + Intronic
901981049 1:13034136-13034158 AGTGTAGGAGGGAGGCTGAGGGG + Intronic
902001038 1:13194794-13194816 AGTGTAGGAGGGAGGCTGAGGGG - Intergenic
902020268 1:13340498-13340520 AGTGTAGGAGGGAGGCTGAGGGG - Intergenic
902292943 1:15447009-15447031 CCTGCTGCTGGGGGGCTGTGAGG - Intronic
902664099 1:17925473-17925495 CCCACAGCATGGAGGCTCAGGGG + Intergenic
902754657 1:18541114-18541136 CCAGAGGCAGGGAGGCTGGGGGG - Intergenic
903125204 1:21243065-21243087 CCTGCAGAGCAGAGGCTGAGTGG + Intronic
903259773 1:22125198-22125220 CATGGGGCAGGGAGGCAGAGAGG - Intronic
903384986 1:22920319-22920341 CCTGCAGCAAGGAAGCTGCAGGG + Intergenic
904437061 1:30505954-30505976 CAAACAGCAGAGAGGCTGAGAGG - Intergenic
904448962 1:30598787-30598809 CCTGTGACAGGGAGGGTGAGTGG + Intergenic
904684459 1:32250430-32250452 CCTGCACCTGGGGGCCTGAGCGG + Intergenic
904830479 1:33303449-33303471 CATGTAGCAGTGATGCTGAGGGG + Intergenic
905106442 1:35565979-35566001 CCTGCAGGAGGGAGGCTCCAGGG + Exonic
905335420 1:37241353-37241375 GCTGAGGCAGGCAGGCTGAGAGG - Intergenic
905649267 1:39645684-39645706 CCTGCAGAGGGAAGACTGAGTGG - Intergenic
906215444 1:44035682-44035704 CCTGCAGCAGGGCAGCTCTGGGG - Intergenic
906231929 1:44171671-44171693 ACTGGTGCAGGCAGGCTGAGTGG - Intergenic
906659318 1:47571384-47571406 ACTCCAGCATGGAGGCTGGGAGG - Intergenic
906745127 1:48216060-48216082 CCTGCAGCATGGAGAAGGAGGGG + Intergenic
907112204 1:51936256-51936278 CCAGGAGAAGGGAGCCTGAGGGG - Intronic
907250269 1:53133471-53133493 TCAGCAGCAGGGAGGCTGGGAGG + Intronic
909193727 1:72588687-72588709 CCTGCAGTGGGGAATCTGAGAGG + Intergenic
909958176 1:81802740-81802762 AGTGGAGCGGGGAGGCTGAGCGG + Intronic
910125594 1:83838408-83838430 TCAACAGCAGGGAGGCTGTGGGG - Intergenic
910369884 1:86504135-86504157 CCTCAAGCAGAGAGGCTCAGGGG - Intergenic
910701017 1:90074203-90074225 CATGCAGGAGGGAACCTGAGGGG - Intergenic
912591347 1:110824262-110824284 GCTGCAGCAGGGGGGCTGGAGGG + Intergenic
912702204 1:111886850-111886872 CCTTCAGGAAGGAGGCTTAGTGG - Intronic
913317592 1:117565857-117565879 CTTGCAGCTGGGAGCCTGCGGGG - Intergenic
913513698 1:119584736-119584758 CCAGCTACTGGGAGGCTGAGGGG + Intergenic
913517327 1:119615654-119615676 CCAGCTACTGGGAGGCTGAGGGG + Intergenic
915239214 1:154507886-154507908 AATGCAGGAGGGAGGCTGAAGGG - Intronic
915248043 1:154569773-154569795 CATGCTGCAGGGAGGAAGAGAGG - Exonic
915488722 1:156239882-156239904 CCAGCAGGAGGGGGGCGGAGGGG - Intronic
915524491 1:156467606-156467628 TCTTCATCAGGGAGGCTGAGAGG + Exonic
916851805 1:168711726-168711748 CCTGCATCTGGGAGGGTGAAGGG + Intronic
918871209 1:189977395-189977417 GCTGCAGTAGGGAGTCTGTGTGG + Intergenic
919361975 1:196608262-196608284 CCTGTACCTGGGAGGCAGAGGGG + Exonic
919859198 1:201727898-201727920 CCTGCTGCACATAGGCTGAGAGG + Intronic
919990672 1:202707151-202707173 AATGCAGAAGGGATGCTGAGTGG + Intronic
920177052 1:204108562-204108584 GCTGCAGCAGGAAGGCTTTGAGG + Intronic
920261632 1:204692314-204692336 CCTGCAGAAGGGAAGTGGAGTGG - Intergenic
920736536 1:208537952-208537974 CCTGCATCAGGGCATCTGAGAGG - Intergenic
920849487 1:209618874-209618896 GCTGCAGCAGGGAGGAGGAGGGG + Intronic
921039574 1:211416759-211416781 CCGGCAGCGGGGAGGCGGCGGGG + Intergenic
921088132 1:211815708-211815730 GCTGCAGCAGGGAGGGAGTGAGG - Intronic
921519420 1:216141304-216141326 ACTGCAGCAGGGAGTCTCACTGG - Intronic
922719981 1:227895393-227895415 CCTGCAGCAAGGACCCTGTGAGG - Intergenic
922822772 1:228495258-228495280 CCTGCAGCAAGGACTCTGTGAGG - Exonic
922880960 1:228980304-228980326 ACTGGAGCAGGGAGGCTGGGAGG + Intergenic
923546017 1:234923796-234923818 CCAGCAGGAGGCAGGATGAGGGG - Intergenic
924499852 1:244627131-244627153 CAGGAAGTAGGGAGGCTGAGGGG + Intronic
1062911563 10:1215478-1215500 TGTGCAGGAAGGAGGCTGAGTGG - Intronic
1064098129 10:12439520-12439542 CCTACAGCAGGGAGGAGGACTGG - Intronic
1064205889 10:13323041-13323063 CCTGCAGCTGGGAGAGAGAGGGG + Exonic
1064633796 10:17343484-17343506 CCTGCAGAAGAGAGGTGGAGAGG + Intronic
1066048916 10:31617908-31617930 CAAGCCGCAGAGAGGCTGAGTGG - Intergenic
1066283320 10:33939813-33939835 CCTGCTGTGGGGAGGATGAGGGG - Intergenic
1066431091 10:35352600-35352622 CATCCAGCAGGGAGGCTGGACGG - Intronic
1067054817 10:43044404-43044426 CTGGCAGCAAGCAGGCTGAGGGG - Intergenic
1067115669 10:43433834-43433856 CCAGCTACCGGGAGGCTGAGAGG + Intergenic
1067201009 10:44172013-44172035 CCTGCAGCAGGAGGGATGAGGGG + Intergenic
1067772650 10:49138474-49138496 GCTGCAGCAGTGAGGCGCAGAGG - Intergenic
1069572166 10:69500885-69500907 CCTGGTGCAGGGATGCTGTGGGG - Intronic
1069660571 10:70121002-70121024 CCTGCAGCTGGGAGGCCACGGGG - Intronic
1069949327 10:72008423-72008445 CCTCCAGCAGGCTGACTGAGCGG - Exonic
1070152528 10:73813687-73813709 CCTGCAGCTAGGAGGGGGAGGGG - Exonic
1070439527 10:76429789-76429811 CCTACAGCAGGGAAGCTGGGTGG - Intronic
1070793284 10:79202547-79202569 CCAGCACCAGAGGGGCTGAGTGG - Intronic
1070842794 10:79499536-79499558 CCTGCAGCAGAGTGGGTGAAGGG + Intergenic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1074445712 10:113519726-113519748 CCTCCGGCCAGGAGGCTGAGAGG - Intergenic
1075723208 10:124599063-124599085 ACTGCATCAGGGTGGATGAGTGG - Intronic
1075879911 10:125842198-125842220 CCTACTGCAGGGAGGCTGGCAGG - Intronic
1076236743 10:128869324-128869346 ACAGCAGCAGGGGGGCTTAGGGG + Intergenic
1076344222 10:129769331-129769353 GCTGCAGCTTGGAGGCAGAGCGG - Intergenic
1076744169 10:132504472-132504494 CCTGCAGTCCGAAGGCTGAGAGG - Intergenic
1076831098 10:132994689-132994711 GCTGCCTCAGGGAAGCTGAGTGG + Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077137796 11:1009962-1009984 CCAGCTGCGGGGAGGCTGGGAGG - Intronic
1077169658 11:1160563-1160585 CCAGATGCAGGGTGGCTGAGGGG - Intronic
1077286272 11:1767405-1767427 CCAGGAGCTGGGAAGCTGAGCGG - Intergenic
1077529403 11:3088117-3088139 CCTGCTCCATGGAGGCAGAGAGG - Exonic
1078170324 11:8924695-8924717 TCTGGGGCAGGGAGGCTGTGAGG - Intronic
1078241475 11:9534661-9534683 CCTGCAGCAGTGAGGCAAAGTGG - Intergenic
1079223834 11:18588444-18588466 GCGGCCCCAGGGAGGCTGAGGGG - Intronic
1079727600 11:23895366-23895388 TCAGAAGCAGGGAGACTGAGAGG + Intergenic
1079757862 11:24288105-24288127 CCTGCAGCAGGAGATCTGAGTGG + Intergenic
1080596985 11:33781800-33781822 CCTGCAGCAGGAGATCTGAGTGG + Intergenic
1081621054 11:44619382-44619404 CCTGCGCCAGGGACGCTGTGGGG - Exonic
1082027901 11:47586204-47586226 CCTGCGGCAGAGTGCCTGAGAGG + Intergenic
1083276567 11:61600290-61600312 CCTGCAGCGAGGAGGTTGGGTGG - Intergenic
1083744208 11:64726275-64726297 CCTGCAGCACGGAGGTTTTGGGG - Intergenic
1083755110 11:64788104-64788126 TCTGCTGGAGGGTGGCTGAGGGG + Intergenic
1084087722 11:66862228-66862250 CCCCCAACAGGGAGGCTGAGAGG + Intronic
1084211892 11:67628251-67628273 CCTGCAGGCAGGAGGCAGAGAGG + Exonic
1084312767 11:68326424-68326446 CCTTCAGCAGTGAAGCTGAGTGG - Intronic
1084492380 11:69485906-69485928 GCTGCAGCAGGGAGCCTGCCAGG + Intergenic
1084780997 11:71408012-71408034 CCTGGAGAAGGGAGGATTAGGGG + Intergenic
1086159911 11:83710409-83710431 CCAGCATTTGGGAGGCTGAGCGG - Intronic
1087718509 11:101636258-101636280 CTAGTACCAGGGAGGCTGAGTGG + Intronic
1087864606 11:103208343-103208365 CCTGCACCATGGAGGGTTAGTGG + Intronic
1087926267 11:103922428-103922450 CCTTCAGGATGGAGGGTGAGGGG - Intronic
1088620151 11:111673570-111673592 CATTCAGCAGTGAGGCTGAAAGG - Intronic
1088960752 11:114662398-114662420 CCTGCAGCAGTGAGGCTTGTGGG - Intergenic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1089396827 11:118141486-118141508 CCTGCAGCAGGAAGCTGGAGAGG + Intronic
1089685271 11:120142638-120142660 CCTGCAAAAGGGAAGCTGTGAGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1090402435 11:126457886-126457908 GCTGCAGCAGAGAGACAGAGAGG + Intronic
1090438589 11:126708033-126708055 CCTGCTTCAGGGATGCGGAGGGG - Intronic
1090745982 11:129705082-129705104 CCTGTGGTAGGGAGGCTCAGTGG + Intergenic
1090948525 11:131452253-131452275 CCTGCAGCCGGGAGGCCACGGGG - Intronic
1090975919 11:131679812-131679834 CCTGCATCAGGGTGACTGGGAGG - Intronic
1091006378 11:131957397-131957419 CCTGCAGGAGGGAGTTGGAGGGG - Intronic
1091191533 11:133699620-133699642 CCTGCAGCAGAGAATCTGGGAGG + Intergenic
1091393813 12:141646-141668 CCTGGGGGAGGGGGGCTGAGGGG - Intronic
1091678341 12:2507932-2507954 GCTGCAGTAGGAAGGGTGAGAGG + Intronic
1091710137 12:2734090-2734112 ACTGCAGAAGTGAGGTTGAGTGG - Intergenic
1091767410 12:3130573-3130595 CCTGGGGCAGGGTGGCAGAGTGG + Intronic
1091769549 12:3142152-3142174 CCAGCAGCAGTCAGGCAGAGCGG - Intronic
1091845822 12:3655724-3655746 CCTCCAGGAGGCAGGCTGGGTGG - Intronic
1094367656 12:29701243-29701265 CCCGCAGCAGGAAGCCTCAGTGG - Intronic
1096230308 12:49893116-49893138 CCTGCAGCATGGAGGGTGGAAGG - Intronic
1096719351 12:53509585-53509607 CCTGAACCCGGGAGGCAGAGGGG - Intronic
1097141210 12:56903668-56903690 CATGTAGCAGGGAGGCCTAGTGG - Intergenic
1097849325 12:64395868-64395890 TGTGCAGCAGGAAGCCTGAGAGG - Intergenic
1100511037 12:95274066-95274088 CCTGCAGTACGCAGACTGAGAGG + Intronic
1101828184 12:108237023-108237045 CCTGCATCAGCTGGGCTGAGAGG - Intronic
1102310130 12:111838188-111838210 CCTGAACCCGGGAGGCAGAGAGG - Intergenic
1102482527 12:113233519-113233541 CCTGGAGCAGGAAGGCGGCGTGG - Intronic
1103197332 12:119056109-119056131 CTTGTGGGAGGGAGGCTGAGAGG - Intronic
1103832309 12:123789630-123789652 AGTGCTTCAGGGAGGCTGAGGGG - Intronic
1103923397 12:124410985-124411007 CCTGGAGGAGGAAGGGTGAGAGG + Intronic
1104906012 12:132213948-132213970 CATGCTGCAGGGAGGGTGTGCGG - Intronic
1106846524 13:33743364-33743386 CCTGTAGCAAAGAGACTGAGAGG + Intergenic
1107317405 13:39148273-39148295 CCAAAAGCAGGGAGGCTGGGAGG + Intergenic
1108208272 13:48112940-48112962 CCCGAAGCAGGGAGGCTGGGGGG + Intergenic
1108363854 13:49691410-49691432 CCTGAAGCATGGGCGCTGAGTGG - Exonic
1108500751 13:51067615-51067637 CCTGTAACAACGAGGCTGAGTGG + Intergenic
1108615622 13:52129088-52129110 CCGGCCGCAGGGAGGCGCAGCGG - Intergenic
1108701497 13:52948000-52948022 GCTGCAGCAGCGGGGCTGAGTGG + Intergenic
1110224961 13:73110137-73110159 CCCGAAGCAGGGAGGCTGGCTGG + Intergenic
1110506885 13:76297510-76297532 GGTGCAGCTGGGAGGCTGAGTGG + Intergenic
1112325593 13:98441014-98441036 CCTGCAGGGGTGATGCTGAGTGG + Intronic
1113029944 13:105982349-105982371 GCTGCAGCAGGGGGCCTGTGTGG - Intergenic
1113638197 13:111936781-111936803 TTTGCAGCTGGGAGGCTGGGAGG - Intergenic
1113771404 13:112911482-112911504 CCTGCAGCAGGCAGGATCCGGGG - Intronic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1118286579 14:64479815-64479837 TCTGCAGTTGGGAGGCTGAGAGG - Exonic
1118404740 14:65412453-65412475 CCTGAAGGCCGGAGGCTGAGCGG - Intronic
1118487540 14:66228048-66228070 GCTGCATGAGGGAAGCTGAGAGG + Intergenic
1119153918 14:72390963-72390985 CCTGGAGCATGAAGTCTGAGTGG - Intronic
1119323812 14:73746780-73746802 GCTGCAGCAGGGAGGGTGTGTGG - Intronic
1119603089 14:75990619-75990641 CCTGGGGCAGGGAGGTTGGGAGG + Intronic
1120047173 14:79820657-79820679 ACTTGAGCAGGGAGGGTGAGAGG - Intronic
1120609100 14:86618435-86618457 ACAGCAGCTGGGAGACTGAGAGG + Intergenic
1120827400 14:88968236-88968258 CCCACAGCAGGCATGCTGAGAGG + Intergenic
1121111648 14:91317008-91317030 CATGCAGCCTGGGGGCTGAGGGG - Intronic
1121554293 14:94824579-94824601 CCTGGAGCAGAGTGGATGAGGGG + Intergenic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1122321913 14:100860542-100860564 CTAGCAGCATGGAGGGTGAGGGG - Intergenic
1122371970 14:101233957-101233979 TCTGCAGCAGGCAGGGTGTGTGG - Intergenic
1122539767 14:102491639-102491661 GTTGCAGCAAGGAGGCTGGGAGG - Intronic
1122903158 14:104790261-104790283 CCTGCAGGAGCAAGGCTGGGGGG + Intronic
1122940587 14:104979252-104979274 AGGGCAGCAAGGAGGCTGAGGGG + Intergenic
1123176210 14:106421648-106421670 CTCCCTGCAGGGAGGCTGAGGGG - Intergenic
1202947476 14_KI270726v1_random:41917-41939 CTCCCTGCAGGGAGGCTGAGGGG + Intergenic
1123755488 15:23394671-23394693 CCTGCAGGAGGAAGGGTGGGGGG + Intergenic
1124003689 15:25779941-25779963 CCTGCCGCAGGCAGGCCGGGCGG + Intronic
1124006975 15:25802373-25802395 CCTACAACAGGGAGGCTCACGGG - Intronic
1124700004 15:31904432-31904454 CCTGCTGCAGAGAGGCACAGTGG - Intergenic
1125720377 15:41842413-41842435 CCTGAAGCAGGGATGCTCAGAGG - Intronic
1125752066 15:42036177-42036199 GCCGCAGCAGGGAGGGTGCGGGG + Intronic
1126574356 15:50182727-50182749 CCTGCGCCAGGGAGACTGCGTGG + Exonic
1127399528 15:58572523-58572545 GGAGCAGCAGGGAGGCTGGGAGG - Intergenic
1128567343 15:68710232-68710254 ACTGCATCTGGGAGGCTGAGGGG - Intronic
1128718853 15:69930805-69930827 CCTGCAGCAGGAAGGCAGCTAGG + Intergenic
1128867591 15:71126234-71126256 ACCACAGCAGGGAGGCTCAGAGG - Intronic
1129328262 15:74813244-74813266 CCTGGGGCAGGGAAGCAGAGAGG - Intronic
1129389157 15:75211935-75211957 ACTGGTGCAGGTAGGCTGAGTGG + Exonic
1129448350 15:75634563-75634585 CCAGCAGCAGAGGGGCAGAGAGG - Intergenic
1129898073 15:79123141-79123163 TCTGTAGGAGGGAGGCTGTGAGG + Intergenic
1131150121 15:90042528-90042550 CGGGGAGCAGAGAGGCTGAGTGG - Intronic
1131791909 15:95974140-95974162 CCCGCAGCAGAGGGGCTGTGAGG + Intergenic
1132237358 15:100232275-100232297 CCTGCAGCATGGAGCCAGGGTGG + Intronic
1132284718 15:100654529-100654551 CTGACAGCAGGGAGGCTGAAGGG - Intergenic
1132801691 16:1757826-1757848 CCTGCATCATGGGGGCTGCGGGG + Intronic
1133223350 16:4328526-4328548 CCTGGAACAGGGATGCTGGGAGG + Intronic
1133574143 16:7071403-7071425 CCTGCAGCTAGGAGGCTAGGAGG - Intronic
1134402175 16:13920324-13920346 CCAGCACCAGGCAGGCTGGGTGG - Exonic
1135128343 16:19830393-19830415 CCTGCAGCAGAGGGGCTGGAGGG + Intronic
1135625180 16:23988832-23988854 GCTGGAGCACGGAGGGTGAGAGG + Intronic
1136395840 16:29991967-29991989 CCTGAGGCAGGGAGAATGAGAGG + Intronic
1136460871 16:30409316-30409338 ACTGCAGCAGTGAGGGTGGGTGG + Intronic
1136545033 16:30949786-30949808 ACTGCAACAGTGAGGCAGAGTGG + Intronic
1137575072 16:49594081-49594103 CAGGCAGCTGGGGGGCTGAGGGG - Intronic
1137779752 16:51087988-51088010 TCTGCAGCATGGAGGCTTAACGG + Intergenic
1138244837 16:55459850-55459872 ACTGCAGGAGGGAAGCTGGGTGG - Intronic
1138247867 16:55480400-55480422 CCGGCAGGAGGGAGGAGGAGTGG + Intronic
1138335007 16:56246093-56246115 CAGGCAGCAGGTAGGCTGTGAGG - Intronic
1138417151 16:56878055-56878077 CCTGAAGGAGGGAGGGAGAGAGG - Exonic
1138487798 16:57357990-57358012 CCTGCAGCAGCCAGCGTGAGTGG - Intergenic
1138529411 16:57627002-57627024 CCTGGGGCAGGGAGGCACAGTGG - Intronic
1138961361 16:62034330-62034352 GGTGCAGCAGCGAGGCTGAATGG + Intronic
1139518089 16:67463782-67463804 CCTTGAGCAGGGCCGCTGAGGGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1140419666 16:74807828-74807850 GCTGCAGGAGGGAGGCTGGCTGG - Intergenic
1140480681 16:75261379-75261401 CCTACAGCCAGGAGGGTGAGTGG - Intronic
1140526706 16:75629057-75629079 CCTGCTGCAGGCAGCCTGTGGGG + Intronic
1140661750 16:77195552-77195574 CCTACAGCAGAGAGGAGGAGCGG + Exonic
1141279042 16:82614058-82614080 CATGAAGCAGGAAGGCTGGGAGG + Intergenic
1141423448 16:83931429-83931451 CCTGGAGCAGGGAGGGGCAGGGG + Intronic
1141570081 16:84928910-84928932 GCTGGGCCAGGGAGGCTGAGCGG - Intergenic
1141799748 16:86298685-86298707 TCTGCAGCAGGGAGCCTCCGAGG + Intergenic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142123197 16:88397117-88397139 GCTCCTGCAGGGAGGCTAAGTGG + Intergenic
1142143717 16:88483865-88483887 CATGCAGCAGGGAGGCGGGAAGG - Intronic
1142311272 16:89315414-89315436 CCTTCAGCAGTGAGGCAGAAAGG - Intronic
1142501901 17:337741-337763 CCTCGAGCAGCGAGACTGAGCGG - Intronic
1142559647 17:802614-802636 CCAGCCCCAGGGAGGCTGCGCGG - Intronic
1142585105 17:967262-967284 CCTGCTGCTGGGAGTCTGGGAGG + Intronic
1142682684 17:1559652-1559674 CCTGGAGCAAGGAGCCTGAGTGG - Intronic
1142811232 17:2396569-2396591 CTTTCAGCAGGGATGCTGAGCGG - Intronic
1142848761 17:2694415-2694437 CCTGCAGCAGGGACGCAGCGGGG + Intronic
1142964479 17:3572168-3572190 CCTGCAGCAGCTTGCCTGAGCGG + Exonic
1143874204 17:9979526-9979548 CCTGCAGAAGGGATGCTCACAGG - Intronic
1144061177 17:11583996-11584018 GCTGCTGCAGGGAGGGTGTGGGG - Intergenic
1144186591 17:12802354-12802376 CCTGCAGCAGGGACACTCTGTGG - Intronic
1144704035 17:17355689-17355711 CCTGCAGCAGGGAGGCAGTGTGG + Intergenic
1145157738 17:20554081-20554103 CCTGCACCAGGGTGGGGGAGGGG - Intergenic
1146277300 17:31523871-31523893 CCTGCAGCAGGGGGCCGGGGTGG - Exonic
1146938248 17:36825912-36825934 TAGGCAGGAGGGAGGCTGAGAGG - Intergenic
1147258046 17:39193797-39193819 CCTGCAACAGGAGGGATGAGGGG + Intronic
1147384085 17:40071604-40071626 CCTGCCCCAAGGAGGCCGAGGGG - Intronic
1147543051 17:41377254-41377276 GCAGCAGCAGAGAGGTTGAGAGG + Intronic
1147931982 17:43987452-43987474 TCAGTAGCAGGGAGGCTGAGAGG - Intronic
1148093772 17:45038624-45038646 CCTGCAGAATGGGGGCTGAGGGG + Intronic
1148602461 17:48904802-48904824 CCAGCACTTGGGAGGCTGAGTGG + Intergenic
1148664234 17:49362345-49362367 CCAGCGGCCGGGATGCTGAGGGG - Intronic
1148870998 17:50658718-50658740 CCTGCATCTGGCAGGCTGTGGGG + Intronic
1151933639 17:77248252-77248274 CCAGCACCAGGGAGCATGAGTGG - Intergenic
1151995091 17:77603354-77603376 CTCGGAGCAGGGAGGCTGTGGGG - Intergenic
1152065818 17:78112101-78112123 CCTGGAGCACTGAGGCTGACGGG + Exonic
1152099137 17:78290958-78290980 CCTGCAGCAGGGAGATTAAGGGG - Intergenic
1152303425 17:79508281-79508303 CCTTCCGGAGGGAGGCTTAGTGG + Intronic
1152330448 17:79669683-79669705 AGTGCAGCAGCAAGGCTGAGTGG + Intergenic
1152350979 17:79784050-79784072 CCTGCAACGGGGGCGCTGAGTGG - Exonic
1152461989 17:80446349-80446371 CCTGGAGCAGGGATGCTGCAGGG - Intergenic
1152563187 17:81088895-81088917 CCTGCAGGAGGGAGGGGGAGTGG - Intronic
1152640771 17:81448316-81448338 CCTGCTGCAGGGAGGCCTATGGG + Intronic
1152739607 17:82013189-82013211 CCGGCAGCTCGGGGGCTGAGAGG - Intronic
1152901196 17:82941994-82942016 CCTGCCGGAAGGAGGCTGAGAGG - Intronic
1152944119 17:83189815-83189837 CCAGCAGCAGGCAGGCTCCGGGG - Intergenic
1153229303 18:2921164-2921186 CCTGCAGAAGGGAGGCAGGTTGG + Intronic
1153825297 18:8869072-8869094 CCTGGAGATGGGAGGCTGATGGG + Intergenic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1155322368 18:24631987-24632009 CCTGCAACGGGGAGGGGGAGGGG + Intergenic
1156331605 18:36129076-36129098 CCGGGAGCAGGGCGGCTGGGAGG - Intronic
1156660121 18:39336718-39336740 CATGCAGCAGGCAGGGTGGGAGG - Intergenic
1157276392 18:46313837-46313859 CCTGCAGCCGGGAGCCTGGTTGG - Intergenic
1157518929 18:48331398-48331420 CGTGCAGCATGGAATCTGAGTGG + Intronic
1157523850 18:48363915-48363937 CCTTCATCTGGGAGGCTGTGGGG - Intronic
1157579582 18:48765536-48765558 CCGGCAGCATGGAGGGAGAGGGG + Intronic
1157721906 18:49931802-49931824 CCTGCAGCATGAAGGCAGAGCGG + Intronic
1157763831 18:50283142-50283164 GAAGCAGCAGGGAAGCTGAGAGG + Intronic
1158519808 18:58162408-58162430 CCTGAAGGAAGAAGGCTGAGTGG - Intronic
1158641316 18:59206529-59206551 CATGAAGCAGGGAGGCCTAGGGG - Intergenic
1158851269 18:61497511-61497533 CCTCCAGGAGGGTGGCAGAGAGG - Intronic
1158945735 18:62445482-62445504 CCTGCAGCTGGGAGGGGGCGGGG + Intergenic
1159843192 18:73425217-73425239 CATGCAGCAGACAGGCAGAGTGG + Intergenic
1159884580 18:73891834-73891856 CCTGCAGCAAGGAGGGTGCCTGG + Intergenic
1160019802 18:75171610-75171632 AGTGCTGCAGAGAGGCTGAGAGG + Intergenic
1160414241 18:78696954-78696976 CCTGCAGAAGGCAGGCTTTGGGG - Intergenic
1160596036 18:79975027-79975049 CCTGCAGCATGGAGAATGAGAGG - Intronic
1160659308 19:290997-291019 CCGGCAGCAGGAAGTCTGTGCGG - Exonic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1161251932 19:3285308-3285330 GCTGCAGGAGGGAGGGTAAGGGG - Intronic
1161297183 19:3526044-3526066 CCTAGAGCAAGGAGGCTGGGAGG - Intronic
1161421573 19:4178765-4178787 CTTGAACCTGGGAGGCTGAGCGG + Intronic
1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG + Intronic
1161477436 19:4494321-4494343 CCGACCGCGGGGAGGCTGAGCGG + Exonic
1161635593 19:5386923-5386945 CCAGCATTTGGGAGGCTGAGCGG - Intergenic
1161773137 19:6242108-6242130 CTTGAGGCAGGGAGGCTGGGAGG - Intronic
1162545153 19:11324746-11324768 CCTGAAGCCGGGGGGTTGAGGGG + Exonic
1162635132 19:11962166-11962188 CCAGCACTTGGGAGGCTGAGGGG + Intronic
1162725197 19:12686114-12686136 ATGGCAGCAGGGAGGTTGAGAGG - Intergenic
1162782890 19:13015830-13015852 TCTGCAGCAGTGAGGATGAGAGG + Intronic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163499573 19:17668234-17668256 CCTGGAGGATGGAGGCTGAGCGG - Intronic
1164521537 19:28983707-28983729 CTCCCAGCAGGGAGGCAGAGTGG - Intergenic
1165055905 19:33176290-33176312 CATGCTGCAGGGATGCTGGGTGG + Intergenic
1165890855 19:39111535-39111557 GCTGGAGCAGGGAGAGTGAGAGG + Intergenic
1165994404 19:39833809-39833831 GTTGCAGGAGGGAGGCTGGGAGG - Intronic
1166043632 19:40217355-40217377 ACTGCAGCAGGCAAGCTGCGAGG + Exonic
1166256992 19:41613701-41613723 ACTGCAGCAGGCAGGGTGTGGGG + Intronic
1166907052 19:46118686-46118708 ACTGCTGCAAGGAGGCAGAGGGG + Intergenic
1166992155 19:46699089-46699111 GCTGCAGCAGGGAGGGCGAGGGG - Intronic
1167166095 19:47801663-47801685 CCTGCAGCAGGGTGGGTAAAGGG + Exonic
1167175584 19:47861602-47861624 CCTGCAGCAGGGTGGGTAAAGGG - Intergenic
1167338777 19:48902849-48902871 GCTGGAGCAGGGAGAGTGAGAGG + Intronic
1168265967 19:55224309-55224331 CGTGCAGGATGGAGGCTGATGGG + Intergenic
1168659570 19:58155243-58155265 GTGGCAGCAGGGAGGCTGTGGGG + Intergenic
925140040 2:1543947-1543969 CCAGGAGCCGGGAGGCAGAGGGG + Intergenic
925167871 2:1729552-1729574 CCTACAGCAGGGTGGGGGAGGGG + Intronic
925180043 2:1811665-1811687 ACAGCAGCAGGCAGGGTGAGAGG - Intronic
925259514 2:2517546-2517568 CCTGCACCAGGGAGCAAGAGAGG + Intergenic
925511871 2:4636803-4636825 CATGAAGGAGGGAGGCTGAGTGG - Intergenic
925896077 2:8473294-8473316 CCTGCAGGAGGGAGGAAAAGGGG + Intergenic
925941841 2:8828161-8828183 CATGCAGCCAGGAGGGTGAGAGG - Intronic
927144920 2:20157280-20157302 GGAGCAGGAGGGAGGCTGAGAGG + Intergenic
927174967 2:20399458-20399480 CCTGGAGGTGGGAGGCAGAGTGG + Intergenic
927504870 2:23606322-23606344 CCAGCAGCAGAGCGGCTGGGAGG - Intronic
927650997 2:24913687-24913709 GCTGCCGTAGGGAGGGTGAGAGG - Intronic
927652049 2:24919127-24919149 CCTCCAGCAGGAACGCAGAGCGG + Exonic
927699422 2:25258475-25258497 CCTGCAGTAGGTAGGCTGGGGGG + Intronic
927810010 2:26175461-26175483 CCTGTAACTGGGAGGATGAGGGG + Intronic
927888780 2:26735364-26735386 CCTGCAGCTGGGAGACTGAGAGG - Intergenic
927939670 2:27095615-27095637 CCTGCAGGAGGGAGTCTGCAAGG - Intronic
928373161 2:30755730-30755752 CCTGCAGCCAGAAGCCTGAGTGG - Intronic
929440740 2:41964278-41964300 CTTGGAGCAGGGAGGCAGAGAGG - Intergenic
930664419 2:54088070-54088092 CCTGCAGCTGGGAGTCTTTGTGG + Intronic
931002858 2:57808315-57808337 CCTATAGCAGGGAGTCTGAGAGG + Intergenic
931275423 2:60739956-60739978 CCAGCATTTGGGAGGCTGAGTGG - Intergenic
931639496 2:64369611-64369633 CCACCAGCAGGGAGGATAAGTGG + Intergenic
931758104 2:65392290-65392312 CCTGTGGTTGGGAGGCTGAGTGG - Intronic
931800288 2:65751296-65751318 CTTGGGGAAGGGAGGCTGAGTGG + Intergenic
932376541 2:71241085-71241107 CCACCTACAGGGAGGCTGAGGGG - Intergenic
932463430 2:71897944-71897966 CCTGCTGCAGGCAAGCTGAGAGG - Intergenic
933574984 2:84057179-84057201 CCTGCAGAAGGGAAGTTTAGGGG - Intergenic
933937378 2:87217484-87217506 TCTGCAGCAGGCAGGCTGTGTGG + Intergenic
935681949 2:105645741-105645763 CCTGAAGCAGGGAGAGTGACTGG - Intergenic
936355762 2:111748318-111748340 TCTGCAGCAGGCAGGCTGTGTGG - Intergenic
936445411 2:112590848-112590870 CCTGCGGAAGAGATGCTGAGTGG + Intergenic
936501724 2:113072194-113072216 CCAGCAGCAGTGAGGCTGGTGGG - Intronic
937312144 2:120909045-120909067 CCTCCAGCAGAGAGGCTGTGAGG + Intronic
937319363 2:120951794-120951816 CATGCAGAAGGAAGGCGGAGTGG + Intronic
938062037 2:128261897-128261919 CCGGCAGGAGGGAGGCAGACAGG + Intronic
938066390 2:128284085-128284107 CCGGCAGGAGGGTGGCTGTGGGG - Intronic
938069754 2:128302170-128302192 GCTGCCTCAGGGAGTCTGAGAGG + Intronic
938338916 2:130522796-130522818 CCTGCAGCAGCGCGGCCGCGCGG - Exonic
938350922 2:130597954-130597976 CCTGCAGCAGCGCGGCCGCGCGG + Exonic
940848995 2:158670727-158670749 TCTGCAGCAGGGCTGCTGTGTGG + Intronic
942053658 2:172163097-172163119 ACTGCTGCAGGGAGGGTGTGGGG - Intergenic
942215999 2:173719639-173719661 CCAGCAGCCTGGAGACTGAGTGG - Intergenic
944547481 2:200812151-200812173 GCTTCGGCAGGGAGGCCGAGGGG + Intronic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
946250341 2:218407494-218407516 CCTGCAGTAGCGAGGCTCAGAGG + Intergenic
946462090 2:219877840-219877862 CCTGCAGCTCAGAGGCAGAGAGG - Intergenic
947532066 2:230915541-230915563 ACAGCAGCACGGTGGCTGAGAGG + Intronic
947745129 2:232503446-232503468 GCTGGGGGAGGGAGGCTGAGCGG - Intergenic
947922947 2:233894088-233894110 TCTGCAGGAGGAAGGCAGAGAGG + Intergenic
948135367 2:235632383-235632405 CAGGCAGAGGGGAGGCTGAGAGG - Intronic
948326713 2:237127950-237127972 CCTGCACCAGGCCTGCTGAGGGG - Intergenic
948385488 2:237578155-237578177 CCTGAAACAGGGAGGCCCAGAGG + Exonic
948488432 2:238295991-238296013 TCTGCAGCAGGAGGGCTGTGTGG - Intergenic
1168821123 20:774438-774460 CATGAAGAAGGGAGGCTGAGAGG + Intergenic
1168978494 20:1985709-1985731 CCTGAACCAGGGAGGCTCAGTGG + Intronic
1169155205 20:3323737-3323759 CCTGCTCTGGGGAGGCTGAGTGG + Intronic
1169257406 20:4109874-4109896 CCTGCAGGCTGCAGGCTGAGGGG - Intergenic
1169779338 20:9292682-9292704 CCTGCAGCAGGCAGGCAGCAGGG + Intronic
1170756720 20:19212209-19212231 CCTGCAGCGGCGAGGCTGGTCGG - Intergenic
1170938354 20:20828392-20828414 GCTGCAGCAGGAAACCTGAGAGG + Intergenic
1171094202 20:22315890-22315912 CGAACAGCAGGGAGACTGAGGGG + Intergenic
1171442885 20:25179837-25179859 CCTGGAGCAGAGATGCTCAGAGG + Intergenic
1172096506 20:32463186-32463208 CCTCCAGCTGGGAGGCTCAGTGG + Intronic
1172187750 20:33041857-33041879 CCTGCATCAGGGAGGCGTTGGGG + Intronic
1172240066 20:33407252-33407274 CCTGCAGAAGGGAGGTGGAGTGG - Intergenic
1172775275 20:37403450-37403472 CCAACAGCAGGCAGGCAGAGTGG - Exonic
1173646959 20:44639340-44639362 CCTCCAGGAGGGAGGATGCGGGG + Intronic
1173827492 20:46057148-46057170 CCTGCGGCAGGAAGGAGGAGTGG - Exonic
1173957295 20:47043503-47043525 ACTGCAGAAAGGATGCTGAGAGG - Intronic
1174211554 20:48883013-48883035 CTTGAACCCGGGAGGCTGAGAGG - Intergenic
1174400999 20:50275906-50275928 CCAGAAGCAAGGAAGCTGAGTGG - Intergenic
1174483041 20:50844716-50844738 CCTGCAGCAGGAGTGCTGGGGGG - Intronic
1174541866 20:51296139-51296161 CCTGGAGAAGGGAGGTGGAGGGG + Intergenic
1174650020 20:52116986-52117008 CTTGAACCTGGGAGGCTGAGAGG + Intronic
1175182899 20:57161055-57161077 CCTCCACTTGGGAGGCTGAGAGG - Intergenic
1175224630 20:57437849-57437871 CCAGCTGCAAGGAGGCTGAAAGG + Intergenic
1175281409 20:57806545-57806567 GATGCAGCTGGGAGGCTGACTGG - Intergenic
1175301431 20:57946005-57946027 CTTGCAGAATGGAGGATGAGAGG - Intergenic
1175479511 20:59301388-59301410 CCTGCAGAAGGCAGATTGAGGGG - Exonic
1175858227 20:62134067-62134089 GGGGCAGGAGGGAGGCTGAGTGG + Intronic
1175889175 20:62308536-62308558 TCTGCAGAAGTGGGGCTGAGGGG + Intronic
1175894600 20:62330554-62330576 CGTGCAGCAGGAAGGCATAGCGG + Exonic
1176081643 20:63276362-63276384 GCAGCCGCAGGGAGGCTGAGTGG - Intronic
1176153023 20:63602771-63602793 ACTGTGGCAGGGAGGCTGGGAGG - Intronic
1176366336 21:6035129-6035151 CCTGCAGCAGGGGCTGTGAGGGG + Intergenic
1176429304 21:6566428-6566450 CCTGCTGGAGGGAGGAGGAGGGG - Intergenic
1178555395 21:33586588-33586610 CCTGAAGCAGACAGGTTGAGGGG - Intronic
1178615425 21:34128924-34128946 CCTGGAGCTGGGTGGCTCAGAGG + Intronic
1178806666 21:35845253-35845275 CCTGCAGATGGGGAGCTGAGAGG + Intronic
1178978230 21:37239049-37239071 GCTGCAGCAGGAAGGCTCCGAGG - Intronic
1179140290 21:38719303-38719325 CCTGAAGGAGGGATGCAGAGGGG + Intergenic
1179292398 21:40030192-40030214 AGAGGAGCAGGGAGGCTGAGAGG - Intronic
1179659461 21:42865168-42865190 GCTGCAGAAGGGAGGCAGAAGGG + Intronic
1179664259 21:42899351-42899373 CTTGAATCAGGGAGGCGGAGAGG - Intronic
1179704696 21:43173890-43173912 CCTGCTGGAGGGAGGAGGAGGGG - Intergenic
1179717498 21:43297442-43297464 GGGGCAACAGGGAGGCTGAGAGG - Intergenic
1179757181 21:43503416-43503438 CCTGCAGCAGGGGCTGTGAGGGG - Intergenic
1179913065 21:44460400-44460422 AGTGCAGCATGGAGGCAGAGGGG - Exonic
1180579755 22:16822197-16822219 CATGTAGCACAGAGGCTGAGAGG + Intergenic
1180944186 22:19680633-19680655 CCCCCAGCAGGGAGGGGGAGAGG - Intergenic
1181023264 22:20114227-20114249 ACTGCTGCAGGAAGGCTGTGGGG - Intronic
1181045972 22:20214418-20214440 CCTGCAGGCGGGAATCTGAGCGG - Intergenic
1181808779 22:25391109-25391131 CCTTCAGCAGTGAAGCTGACTGG + Intronic
1182766931 22:32764453-32764475 CCCGCAGCAGTGAGGCTGTTGGG - Intronic
1182873656 22:33671193-33671215 CCTGCAGCAGGGAGGTTTAGAGG - Intronic
1183083750 22:35474085-35474107 CATCCAGCAGCGATGCTGAGGGG + Intergenic
1183201350 22:36387576-36387598 CCGGCAGCAGCGAGGCCTAGGGG - Intronic
1183285511 22:36960074-36960096 CAGGGAGCTGGGAGGCTGAGAGG - Intergenic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183716409 22:39535826-39535848 CCTGGGCCTGGGAGGCTGAGAGG + Intergenic
1184403656 22:44287839-44287861 GCTGCAGCAGGGAGGGTGCTGGG - Intronic
1184824257 22:46936383-46936405 TCCCCAGCAGGGAGGCTGTGCGG - Intronic
1184996395 22:48210414-48210436 CCTGGAGCAGGCAGGAGGAGAGG - Intergenic
949872330 3:8599317-8599339 CCTACAGAAGCCAGGCTGAGAGG + Intergenic
950046132 3:9949581-9949603 CCTGCAGCATGAAGGCCAAGAGG - Exonic
950577725 3:13842797-13842819 CCTGGAGCAGGGAGGCAGGATGG + Intronic
950626107 3:14248359-14248381 CCTGCAGCAGGAAGGGTCAGAGG + Intergenic
950631059 3:14282253-14282275 CCAGGATGAGGGAGGCTGAGGGG - Intergenic
950643308 3:14362199-14362221 GCTGCAGGAGGGAAGGTGAGAGG - Intergenic
951039986 3:17979371-17979393 GCTGGGGTAGGGAGGCTGAGGGG + Intronic
951446478 3:22786882-22786904 CCAAAAGCAGGGAGGCTTAGAGG + Intergenic
951525320 3:23647659-23647681 CCTGCAGCAGGAGACCTGAGTGG + Intergenic
952946155 3:38478981-38479003 GCTGAAGCTGGGAGGCTGGGGGG + Intronic
953207870 3:40847985-40848007 GCTGCAGCAGGGAGTCTGGAGGG + Intergenic
953223664 3:40997781-40997803 TCTCCACCAGGGAGGCAGAGAGG + Intergenic
953392633 3:42542653-42542675 CCTGCAGCGTGGTGGCTGATGGG - Intergenic
953490448 3:43345749-43345771 CCTGCAGCAGTGAGGTGGTGTGG + Intronic
953885434 3:46712250-46712272 AGGGCAGCAAGGAGGCTGAGGGG + Exonic
954034145 3:47841506-47841528 GCTGCAGCAGGGAGCCAGAAGGG - Intronic
954373414 3:50182170-50182192 CATGCCCCAGGGAGCCTGAGCGG + Intronic
954493579 3:50930917-50930939 ACTGCTGCAGGGAGGGTGAAGGG - Intronic
954612961 3:51955931-51955953 CCGGCAGCAGAGCGGCGGAGAGG - Exonic
954710502 3:52503047-52503069 CCTGCAGCTGGGAGCCTCTGCGG - Exonic
954808954 3:53236269-53236291 CCTGCGGCAGGGAGGCCTGGAGG - Intronic
955033901 3:55248005-55248027 CCTGCAGCAAGGAGGTTTGGAGG + Intergenic
955960648 3:64337931-64337953 CCTGCATGAAGGAGGCTGAGAGG + Intronic
956343003 3:68247488-68247510 CATGCTGCAGGTATGCTGAGGGG + Intronic
956678199 3:71754370-71754392 CCAGCAGCAGGAAGGCGGCGTGG - Exonic
957730288 3:84125580-84125602 ACTACGGGAGGGAGGCTGAGTGG + Intergenic
959911220 3:111765752-111765774 CCCTGAGAAGGGAGGCTGAGAGG + Intronic
960943943 3:122953255-122953277 CCTGGGGCGGGGAGGCAGAGAGG - Intronic
961410176 3:126714666-126714688 CCTACAGCAGGCAGGCAGGGTGG - Intronic
962284559 3:134075324-134075346 GCTGCATCAGTGAGGCTGAGAGG + Intronic
962418881 3:135209810-135209832 ACTGCAGCATGGAGGATGGGTGG + Intronic
962479469 3:135785975-135785997 CTTCCAGCAGGGAGGCAGTGAGG - Intergenic
962491641 3:135898926-135898948 CCTGCAGCAGGCAGCCTGCTGGG - Intergenic
963588921 3:147231488-147231510 CCTAAAGCAGGGAGGATGAGAGG + Intergenic
964437893 3:156673996-156674018 CTTGCAGAAGGGAAGCTGTGAGG - Intronic
965205782 3:165718177-165718199 CATGTAGCAGGGAGGCCTAGTGG + Intergenic
965615325 3:170586301-170586323 CAGGCTGCAGGGAGGTTGAGGGG + Intronic
965839416 3:172886284-172886306 CCTGCACCAGGGATGCTTGGTGG + Intergenic
966254270 3:177899514-177899536 CCAGGAGCTGGGAGCCTGAGTGG + Intergenic
967791806 3:193557934-193557956 CATGCTGCAGTGAGGCTGATGGG - Intronic
967946030 3:194804963-194804985 CTTGCCCCAGGGATGCTGAGTGG - Intergenic
968547466 4:1206292-1206314 GCTGCAGCCGGGTGGGTGAGTGG - Intronic
968586054 4:1416533-1416555 CAGGCAGCAGGGAGGCCGTGCGG - Intergenic
968586119 4:1416904-1416926 CCTGCAGCACTGAGGACGAGGGG - Intergenic
969191595 4:5525532-5525554 CCTGCAGATGGGATCCTGAGGGG - Intronic
969254984 4:5995391-5995413 CCTGCAGCAGGGCGGCAGCTGGG - Intergenic
969315913 4:6381215-6381237 GAGGCAGCAGGGAGCCTGAGGGG + Intronic
969486076 4:7473241-7473263 GCTGCAGCCGGGAGCCTGCGGGG + Intronic
969610958 4:8227607-8227629 TCTGCAGCACCGAGGCGGAGGGG + Exonic
970485858 4:16524263-16524285 CCTCCAACAGGGAGCCTCAGGGG - Intronic
970554193 4:17215026-17215048 GCTGCAGCAGGGACTCTGTGTGG + Intergenic
970638764 4:18039890-18039912 CCAGCTGCTGGGAGGCTGAGTGG + Intergenic
971177444 4:24293517-24293539 CAGGCAGCAGTGGGGCTGAGGGG - Intergenic
971287716 4:25306539-25306561 CATGCTGCAGGGAGGAGGAGAGG + Intergenic
971413920 4:26405123-26405145 CCTACCACAGGGTGGCTGAGGGG - Intronic
974429687 4:61779598-61779620 ACTGCAGCACCGAGGCTGGGTGG - Intronic
974515108 4:62898034-62898056 CCTGCAGCATGGAAAGTGAGGGG - Intergenic
976700571 4:87965778-87965800 GCTGCTGCAGGGAGGATGTGTGG + Intergenic
978061408 4:104344776-104344798 CATGCAGGAGGGAGGCTGGGAGG + Intergenic
980086291 4:128393651-128393673 CGGGCAGCAGGGAGGGAGAGCGG + Intergenic
982232594 4:153222836-153222858 GCTGCAGAAGGGCGGCTGCGGGG + Intronic
984947785 4:184983366-184983388 CTTGCAGCTGGGAGGCTGGTGGG - Intergenic
984973473 4:185210053-185210075 CCGGCAGCGGGGAGGCGGCGGGG + Intronic
985015521 4:185629807-185629829 CCAGCAGTTGGGAGGCTGAGGGG - Intronic
985625391 5:982808-982830 CCTGCTCCAGGGCTGCTGAGTGG - Intergenic
985726314 5:1517595-1517617 CCTGAAGCAGGGCTCCTGAGTGG + Intronic
985785036 5:1888891-1888913 CTGGCAGCAGGGAGGTGGAGTGG + Intergenic
985965732 5:3337902-3337924 CCTGTAACAGGGAAGGTGAGTGG + Intergenic
985973353 5:3394340-3394362 TCTGCAGCACGGTGGCTGTGCGG + Intergenic
986337396 5:6765917-6765939 GCTGCAGCAGGGAGGCTGGCAGG - Intergenic
988687571 5:33539967-33539989 CCTGCACCATGGAGGGCGAGCGG + Intronic
989568961 5:42927274-42927296 CATGCAGTGGGGAGGCTGGGGGG + Intergenic
990846323 5:60144102-60144124 GCTGCCGCTGGGAGGATGAGTGG - Intronic
991214537 5:64147564-64147586 ACTGCAGCAGAGTGACTGAGAGG - Intergenic
992948911 5:81837672-81837694 CCTGCTCCTGTGAGGCTGAGGGG + Intergenic
993871565 5:93260674-93260696 CATGGAGAAGGGAGGCTGAAGGG - Intergenic
993950617 5:94170535-94170557 GCTGCATCAAGGAGGTTGAGAGG + Intronic
993984741 5:94583926-94583948 CCTGCAGCTGAGCAGCTGAGGGG + Intronic
996390023 5:122950460-122950482 CCTGCACCATGGAAGCAGAGAGG - Intronic
996893524 5:128452881-128452903 CCAAAAGTAGGGAGGCTGAGAGG - Intronic
997370807 5:133358459-133358481 CCCCCAGCAGGGAGGGCGAGGGG + Intronic
998093440 5:139383897-139383919 CCTGCCTCAGGGACCCTGAGGGG - Intronic
998108145 5:139481536-139481558 CCAGCTGCAGGGAGGCTAGGTGG + Exonic
998119060 5:139561388-139561410 CCTGCAGCAGGGAGGAAGACAGG + Exonic
998796412 5:145824298-145824320 AAAGCAGCAGGCAGGCTGAGGGG + Intronic
999182941 5:149682835-149682857 AGAGCAGGAGGGAGGCTGAGGGG + Intergenic
999322544 5:150624563-150624585 CCTGGAGATGGGAGGCTGAGCGG + Intronic
999454480 5:151703323-151703345 GCTGCAGCAAGGTGCCTGAGGGG - Intergenic
999967629 5:156826444-156826466 GCTGCAGCTGGAAGGCTCAGGGG - Intergenic
1000226158 5:159263641-159263663 CCTTCAACAAGGAGGTTGAGGGG - Intronic
1001783056 5:174387076-174387098 CCTCCAGCAGGGACACTGACTGG + Intergenic
1002191865 5:177482552-177482574 AGTGCAGGAGGGAGGCTGGGAGG - Intergenic
1002441637 5:179267337-179267359 CTTGGTGCAGCGAGGCTGAGAGG + Intronic
1002710311 5:181191197-181191219 CTTGCAGCACGGAGGCGGCGGGG + Intergenic
1002837208 6:874989-875011 CCTGCAGCTGGAAGGAAGAGTGG + Intergenic
1003004548 6:2368949-2368971 CCTGAGGCAGTGAGGCTGGGCGG - Intergenic
1003449629 6:6218886-6218908 CAGCCAGCAGGGAGGCTCAGAGG - Intronic
1004248158 6:14000277-14000299 CCTGCAGCAAGGAGGGGGTGTGG + Intergenic
1005102763 6:22191230-22191252 TCTCCAGCAGGGAGGAGGAGGGG + Intergenic
1005125389 6:22441386-22441408 CCTTCAGCAGACTGGCTGAGTGG + Intergenic
1005332311 6:24761700-24761722 GCTGCAGCAGGGAGGCGAGGCGG - Intergenic
1006105390 6:31713372-31713394 CCAGCAGCAGGGAAGTTGAGGGG + Intronic
1006224305 6:32522993-32523015 ACTAAAGCAGAGAGGCTGAGGGG + Intronic
1006419834 6:33925977-33925999 GCAGAGGCAGGGAGGCTGAGGGG - Intergenic
1006767579 6:36522333-36522355 CCAGGAGCAGGGTGGCAGAGGGG + Intronic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1007404163 6:41624062-41624084 TCTTCTCCAGGGAGGCTGAGTGG - Intergenic
1007475465 6:42116826-42116848 CCTGCAGCAGGGGTCCTCAGTGG + Intronic
1007597678 6:43061494-43061516 TCTGCAGCAGGGAGGCCATGAGG + Exonic
1007731736 6:43951604-43951626 CCTGCAGCAGCCAGGCAGAGGGG - Intergenic
1008042882 6:46820500-46820522 CCTGCCTCAGGGAGGCAGATGGG + Intronic
1008302042 6:49853253-49853275 CCTGCAGCAGAGATTTTGAGAGG - Intronic
1012427079 6:99126773-99126795 GTGGCAGCTGGGAGGCTGAGAGG - Intergenic
1012458491 6:99433102-99433124 CATGCTGTTGGGAGGCTGAGTGG - Exonic
1013656601 6:112253482-112253504 TCTGCAGCAGGGAAGGTGAGGGG - Intronic
1013818356 6:114125897-114125919 CATGCAGCATGGAAGCTGACAGG + Intronic
1014411327 6:121125461-121125483 CCTGTAGGAAGGAGGCTGATAGG + Intronic
1015203995 6:130614401-130614423 ACCACAGCAGCGAGGCTGAGGGG + Intergenic
1015848395 6:137546726-137546748 TCTGGAGAGGGGAGGCTGAGTGG + Intergenic
1016163365 6:140908433-140908455 AGCACAGCAGGGAGGCTGAGTGG - Intergenic
1016461237 6:144282394-144282416 CCTGCAACAAGGATGCTCAGTGG - Intergenic
1016486276 6:144543131-144543153 CCTGCCGAAGGGAAGATGAGAGG + Intronic
1017717277 6:157221935-157221957 CAGGCAGCAGGGAGGCAGTGAGG - Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1017759523 6:157557081-157557103 ACTGCAGCTGGAGGGCTGAGCGG - Intronic
1017827890 6:158095893-158095915 CCTGCAGGTGGAAGGCTGCGGGG - Exonic
1017995125 6:159525597-159525619 CCTGGATCAGGCAGGCAGAGAGG - Intergenic
1018026264 6:159808718-159808740 CCTGCAGCAGGGAAACACAGGGG - Exonic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018072104 6:160173972-160173994 CCCTGAGCAGGGAGGTTGAGAGG - Intronic
1018610291 6:165641915-165641937 CCTGCAGGACAGAGGCTGCGGGG - Intronic
1018649129 6:165976813-165976835 CCTGCTGCAGGGTGGCTGGTGGG - Intronic
1018791982 6:167155690-167155712 GCAGCTCCAGGGAGGCTGAGGGG + Intronic
1018923396 6:168190864-168190886 CATCCAGGAGGGAGACTGAGGGG + Intergenic
1019170032 6:170128768-170128790 CCTGGACCAGGGAGGCAAAGAGG - Intergenic
1019288614 7:236180-236202 TGTGCAGAAGGGAGGCTGAGCGG + Intronic
1019310241 7:356937-356959 CCTGCAGCAGGGAGGGGAAGGGG + Intergenic
1019413070 7:914993-915015 CCGGCTGCAGGGAGGCTGCTGGG - Intronic
1019516554 7:1442689-1442711 CGAGCTGCAGGGAGGCAGAGGGG - Intronic
1019525215 7:1477658-1477680 CCTGCAGCCTGGAGGCCGTGCGG - Exonic
1019564797 7:1673962-1673984 CCTTCAGAGGGGAGGCAGAGAGG + Intergenic
1019757965 7:2787445-2787467 AGTGCAGCAGGGAGGCTGACGGG - Intronic
1019879377 7:3845032-3845054 CCTGGAGCAGAGAGGCAAAGTGG + Intronic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1021046001 7:15924218-15924240 CCTGCAGAAAGGATGATGAGTGG - Intergenic
1021825285 7:24544776-24544798 GCCGCAGCAGAGGGGCTGAGGGG + Intergenic
1022292430 7:29017118-29017140 CCTGCAGCTTGGAGAGTGAGAGG - Intronic
1023986375 7:45099518-45099540 GCAGCAGCAGGGAGGCTGCCAGG + Intergenic
1024812068 7:53223616-53223638 CCTGCAGGAGGGACACTGTGGGG - Intergenic
1026145705 7:67744638-67744660 CCTGCAGGAGGGAGGAAGAAAGG - Intergenic
1026502895 7:70958006-70958028 CCTGGAGCTGGGAGGCTCAGAGG + Intergenic
1026535100 7:71232706-71232728 ACTGCAGCACGGACCCTGAGCGG - Intronic
1026977527 7:74507627-74507649 CCTGGAGCATGGAGTGTGAGGGG + Intronic
1027269108 7:76510622-76510644 CCAGCACCCGGGAGGCTCAGGGG - Exonic
1027745855 7:82073049-82073071 CCTGCATCAGGGAGGTGGAATGG - Intronic
1028187333 7:87802277-87802299 CCAGCTACTGGGAGGCTGAGAGG + Intronic
1028583886 7:92434310-92434332 CCTGGAGCAGGGAGTTTGAAGGG + Intergenic
1028751635 7:94389973-94389995 ACTGCAGCAGGAATTCTGAGGGG - Intergenic
1029434427 7:100554378-100554400 TCTGAAGCAGTGAGGCTGGGAGG + Intronic
1029489527 7:100862772-100862794 CCTGGCGCACGGAGGGTGAGAGG - Exonic
1029812026 7:103058873-103058895 CCTGCAGAAGTCAGGTTGAGAGG + Intronic
1029973945 7:104815242-104815264 GCTGCAGCAGGGAGGCGGGGTGG - Intronic
1030751999 7:113240314-113240336 CCGGCAGCAGGGGGGTTGGGGGG - Intergenic
1031431053 7:121670110-121670132 CCTGAAGGGGGGTGGCTGAGTGG - Intergenic
1031528720 7:122851445-122851467 CCCACAGCAGGAAGCCTGAGGGG + Intronic
1032062105 7:128733602-128733624 ACTGGAGCAAGGAGGCAGAGGGG - Intergenic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1032856879 7:135842312-135842334 CCTGCAGCTGGGGGGCTGGAGGG - Intergenic
1032962808 7:137059047-137059069 CCAGCACTAGGGAGGCTGAGGGG + Intergenic
1033432180 7:141299502-141299524 CCTGCAGAAGGGAGGCCCTGAGG - Intronic
1033477159 7:141702084-141702106 CCTGCGGCAGGGAGACGGCGGGG + Exonic
1033660421 7:143398585-143398607 CATGCAGGTGAGAGGCTGAGAGG - Exonic
1034262027 7:149763249-149763271 CCAGCAGGAAGGAGGCTGTGTGG - Intergenic
1034465807 7:151227849-151227871 GCGGCAGCGGGGAGGCTAAGCGG - Intergenic
1034546468 7:151792924-151792946 CCTGCAGCAGGGAGGGAGCCGGG + Intronic
1034750313 7:153562180-153562202 GCTGCAGGAGGAAGCCTGAGGGG - Intergenic
1035334787 7:158120971-158120993 CTTGGAGCAGGGAGGCTGGTTGG - Intronic
1035684434 8:1513044-1513066 CCAGCTCCAGGGAGGCTCAGTGG + Intronic
1035684469 8:1513190-1513212 CCAGCTCCAGGGAGGCTCAGTGG + Intronic
1036392291 8:8334003-8334025 CCTGCATCAGAGAGGATGAAGGG + Intronic
1036445950 8:8822141-8822163 GCAGCACCAGGCAGGCTGAGAGG + Intronic
1036749028 8:11431681-11431703 CTTGCTGCAGGCAGGCTGACCGG - Intronic
1036766077 8:11550080-11550102 AGTGCAGGAGGGAGGCTGTGTGG + Intronic
1037584458 8:20267166-20267188 CCTCCACCAGGGTGCCTGAGAGG - Intronic
1037635515 8:20698387-20698409 CTTGCTGCAAGCAGGCTGAGTGG + Intergenic
1037814468 8:22104486-22104508 GCTGCAGCAGGGAGGTGGGGTGG + Exonic
1037952625 8:23028796-23028818 CCCAGAGCAGGGAGGCCGAGGGG - Intronic
1037963434 8:23116430-23116452 CCCAGAGCAGGGAGGCTGAGGGG + Intronic
1037967574 8:23146111-23146133 CCCAGAGCAGGGAGGCCGAGGGG - Intronic
1038013540 8:23494098-23494120 CCAGCAGCAGGGAGGGTGGGTGG - Intergenic
1038704844 8:29884036-29884058 ACTGCAGCAGAGAGTCGGAGCGG + Intergenic
1039116371 8:34095649-34095671 CATGCACCAGGAAGGCTGAGTGG - Intergenic
1039289777 8:36081845-36081867 ACTGGAGCAGGGAGGGTGAGAGG + Intergenic
1039595948 8:38789776-38789798 CCTGCTGCAGGGAGGCCGTAAGG + Intronic
1039777031 8:40746928-40746950 TCTGCAGCAGTGATTCTGAGTGG - Intronic
1039954305 8:42195411-42195433 ACAGGTGCAGGGAGGCTGAGAGG - Intronic
1041487699 8:58396951-58396973 CCTGCAGTAGGTCGGCTGTGCGG + Intergenic
1041777246 8:61536902-61536924 CCTTCAGCAAGGATGATGAGAGG - Intronic
1041935367 8:63326556-63326578 CCTGGAGCAGGGCTGCTCAGTGG - Intergenic
1041975515 8:63794737-63794759 CCTGCAGCAGGAGATCTGAGTGG + Intergenic
1042014470 8:64292817-64292839 CCTGGAGGAGGGAGGGAGAGAGG - Intergenic
1042080052 8:65041786-65041808 CCTACAGCAGTAAGGCTGGGAGG - Intergenic
1042508741 8:69589600-69589622 CCTGCAGAAGGCAGCTTGAGTGG + Intronic
1044347335 8:91120513-91120535 CCTGCAGCACAGAGGCAAAGGGG + Intronic
1044436540 8:92170933-92170955 GCAGCAGCAGGGAGGCTGCAAGG + Intergenic
1044623642 8:94215475-94215497 CCTGCAGTTGGGGGGCAGAGGGG + Intronic
1044918699 8:97145181-97145203 TCAGAAGCAGGGAGGATGAGAGG - Intronic
1045415228 8:101959855-101959877 TCTGCAGTAGGGAGGGTGGGTGG - Intronic
1046133935 8:110002645-110002667 CCAGCAGCTGGGAAGATGAGTGG - Intergenic
1046641893 8:116740789-116740811 CCTACAGCAGAGTGGTTGAGGGG + Intronic
1046672183 8:117068263-117068285 TCTACAGCAGGCAGGCTCAGAGG - Intronic
1047417969 8:124681252-124681274 TCTGCCGCTGGGATGCTGAGTGG - Intronic
1047728076 8:127702035-127702057 CATGCATCAGAAAGGCTGAGTGG + Intergenic
1047965534 8:130043492-130043514 CCTGAACCCGGGAGGCAGAGAGG + Intergenic
1048280019 8:133098742-133098764 CATCCATCAGGGAGGGTGAGGGG + Intronic
1048500343 8:134969574-134969596 CCTCCAAAAGGGAGGCTTAGGGG + Intergenic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1048856403 8:138689997-138690019 CCTCCAGCAGGGTTGCTGTGTGG + Intronic
1048899542 8:139024332-139024354 CCTGCACCAGGGTGGCTCATGGG - Intergenic
1049431919 8:142569276-142569298 CCTCCAGCTGGGAGGGCGAGTGG - Intergenic
1049555902 8:143281865-143281887 CCTGGAGCAGGAGGGCAGAGAGG + Intergenic
1049580615 8:143408939-143408961 CCTTGGGCAGGGATGCTGAGGGG + Intergenic
1050479525 9:6075392-6075414 CCTGGAGGAGGGAGGTAGAGAGG - Intergenic
1050790632 9:9464285-9464307 CCAAAAGCAGGGAGGGTGAGAGG - Intronic
1051287315 9:15510518-15510540 CCTGAAGCAGGGATGCTGCCCGG + Intronic
1053428275 9:38025357-38025379 CCTAGAGCAGGAAGCCTGAGAGG - Intronic
1056292735 9:85160343-85160365 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056292875 9:85161314-85161336 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056506850 9:87265722-87265744 CCTTCAGCAGGGAGCCTGGAAGG - Intergenic
1056796957 9:89665194-89665216 TCTGCAGCAGGGAGGAAGCGAGG - Intergenic
1056813530 9:89782758-89782780 CCGCCAGCTGGGAGGCTGATGGG + Intergenic
1056850503 9:90079970-90079992 CCTGTAGTAGGGAAGCTGAGAGG - Intergenic
1057040460 9:91844044-91844066 CCTGCAGCGGGGCGGATGAAGGG + Intronic
1057173257 9:92976392-92976414 CCTGCTGCAGCCAGGCTGACAGG - Exonic
1057738366 9:97688796-97688818 TCTGCAGCAGGGACTCTGAAAGG + Intronic
1058560963 9:106228844-106228866 CCAGCAGAAAGGAGGGTGAGAGG - Intergenic
1059282521 9:113147340-113147362 CCTCCTGCAGGAAGACTGAGGGG - Intergenic
1060148526 9:121271702-121271724 CCTGCAGCAGAGAGGCCTGGAGG + Intronic
1060705623 9:125796571-125796593 TCTGCAGTAGGGAGGCTGTAAGG + Intronic
1060770254 9:126327054-126327076 CCTGCAGCCGGGAGGGCGGGCGG + Intronic
1061883917 9:133582061-133582083 CCTGCAGAGGGAAGGCTCAGAGG + Intronic
1062414978 9:136443875-136443897 CCTGCAGCAGGGAGGTCGCCAGG + Exonic
1062448953 9:136607535-136607557 CATGCACCAGGGAGGCTGTGCGG + Intergenic
1062485157 9:136770621-136770643 CTTTCAGGAGGGACGCTGAGGGG - Intergenic
1062521662 9:136960429-136960451 CCTGCAGCTGGGTGGCGGGGGGG + Intergenic
1062632150 9:137468038-137468060 CCTCCAGCAGGGCGTCTGAGAGG + Intronic
1203563175 Un_KI270744v1:74343-74365 CATGCACCAGGCAGGCAGAGGGG + Intergenic
1185643590 X:1601332-1601354 CCAGCAGCAGGGAGGACGGGAGG + Exonic
1187274141 X:17803835-17803857 CTGGCCCCAGGGAGGCTGAGGGG + Intronic
1188528269 X:31109256-31109278 CATGCAGCAGGCAATCTGAGTGG + Intronic
1189264125 X:39700521-39700543 CCTGCTGCATGCAGGCAGAGTGG + Intergenic
1189316895 X:40062874-40062896 TCTGCAGCAGGGAGGCAGCCTGG + Exonic
1189899432 X:45690618-45690640 GCTGCAGCAGAGAGGATGAAGGG - Intergenic
1190087028 X:47404277-47404299 CCAGCTACAGGGAGGCCGAGGGG - Intronic
1190499108 X:51057677-51057699 CCTGTAGCAGGGATGATGATGGG - Intergenic
1190980762 X:55455173-55455195 CCGGCAGCAGGGTGGCCTAGAGG - Intergenic
1190987935 X:55518007-55518029 CCGGCAGCAGGGTGGCCTAGAGG + Intergenic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1191650129 X:63528581-63528603 CTTGCAGCAGGGATGATTAGTGG - Intergenic
1192681157 X:73255087-73255109 CATGAAGCAGGGGGGCTTAGGGG + Intergenic
1195798416 X:108679714-108679736 CCTGTAGTTGGGTGGCTGAGGGG + Intronic
1195962213 X:110397751-110397773 CTTGTAGCAGGGAAGCTGATGGG - Intronic
1197350066 X:125372214-125372236 CGGGAAGCAGGGAGGGTGAGGGG + Intergenic
1197590450 X:128402927-128402949 CTTGCAGCAGGGATGATCAGTGG + Intergenic
1198669144 X:139059484-139059506 CCTGAAGCAGTGAAGCAGAGAGG - Intronic
1199547192 X:149018735-149018757 CCACAAGCAGGGAGGATGAGTGG + Intergenic
1199683394 X:150242987-150243009 CAGGCAGGAGGGAGGCTGATTGG + Intergenic
1200062108 X:153488306-153488328 CCAGCAGCCCGGAGGCAGAGGGG - Intronic
1200225242 X:154413390-154413412 CATGCAGAAGGGAGGCACAGGGG - Intronic
1201619316 Y:15937913-15937935 CCTGTAGAAAGGAGGATGAGGGG + Intergenic
1201941719 Y:19467195-19467217 TCTGCAGCAGGGAGGCAGCAGGG + Intergenic