ID: 1160868805

View in Genome Browser
Species Human (GRCh38)
Location 19:1267779-1267801
Sequence CCCGCATGGACGGCGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160868790_1160868805 12 Left 1160868790 19:1267744-1267766 CCCGCGTCTGGGGCTCCAGTGGG 0: 1
1: 1
2: 2
3: 17
4: 253
Right 1160868805 19:1267779-1267801 CCCGCATGGACGGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1160868792_1160868805 11 Left 1160868792 19:1267745-1267767 CCGCGTCTGGGGCTCCAGTGGGT 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1160868805 19:1267779-1267801 CCCGCATGGACGGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1160868796_1160868805 -3 Left 1160868796 19:1267759-1267781 CCAGTGGGTGGGTGGCCCCTCCC 0: 1
1: 0
2: 3
3: 31
4: 300
Right 1160868805 19:1267779-1267801 CCCGCATGGACGGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160868805 Original CRISPR CCCGCATGGACGGCGGGCGC AGG Intronic
900109392 1:999201-999223 CCCGCGTAGACCTCGGGCGCTGG + Exonic
900659591 1:3775929-3775951 CCCGCATGCACGCGGGGGGCTGG + Exonic
911208573 1:95117375-95117397 CCCGCCCGGACTGCGGGCTCGGG - Exonic
917334938 1:173916888-173916910 CCCGGATGGATGGCAGGCCCTGG + Intronic
917647598 1:177044482-177044504 CCCGCCAGGACCTCGGGCGCAGG + Intronic
924414894 1:243849599-243849621 CCCGCCTGGACCGGGGGCGGCGG - Intronic
1064060097 10:12129841-12129863 CCCGCCTGGGCTGCGGGCGGTGG + Intronic
1077051208 11:567955-567977 CCAGCAGGGACGGCGGGTGGGGG - Intergenic
1077229038 11:1450502-1450524 CCCGCAGGGCAGGCGGGCCCAGG - Intronic
1077247575 11:1547013-1547035 CTGGCGTGGAGGGCGGGCGCGGG - Intergenic
1077386112 11:2270277-2270299 CCGACAGGGACGGGGGGCGCAGG + Exonic
1084176202 11:67423675-67423697 ACAGCATGGAGGGAGGGCGCAGG - Exonic
1085266795 11:75242142-75242164 CCCGCGGGCGCGGCGGGCGCGGG - Exonic
1086888198 11:92226600-92226622 CCGGAATGGACGTCGGGGGCGGG + Intergenic
1089273324 11:117316047-117316069 CCAGCCTGGGCAGCGGGCGCGGG + Exonic
1090799081 11:130159668-130159690 CCCCCAGGGCCGGCGGGGGCGGG + Exonic
1093894787 12:24563195-24563217 CCGGCAGGGAGGGCGCGCGCGGG + Intergenic
1098951940 12:76648627-76648649 CCCGCATGGGCAGCTGGCTCTGG - Intergenic
1101167510 12:102053051-102053073 CCCCCATGGACGGAGGCTGCAGG + Intronic
1104669019 12:130667717-130667739 CCCCCAGGGAGGGCGGGGGCTGG + Intronic
1104897734 12:132172513-132172535 CCCGGAGGAACGGCGGGCTCCGG - Intergenic
1106335463 13:28778766-28778788 CCGGCCTGGACGGCGGGGACCGG + Intergenic
1107604046 13:42040852-42040874 CCCGGGCGGCCGGCGGGCGCGGG + Intronic
1108396562 13:49996711-49996733 CGCGGGTGGACGGCGGGAGCAGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118992501 14:70809266-70809288 CCCCCAACGACGGCGGCCGCAGG + Exonic
1127734676 15:61829775-61829797 CCCTCCTGGATGGCGGGAGCTGG - Intergenic
1132877821 16:2148257-2148279 CCCGCATGGACGGGCACCGCGGG - Intronic
1133271944 16:4614605-4614627 CCCGCGTGGCCGCCGGGCGGGGG - Intronic
1134102103 16:11459834-11459856 CCAGCATGGACGGTAGGAGCTGG - Intronic
1140504882 16:75464851-75464873 CCCTCCTGGACGGCGCGCTCTGG + Intronic
1142164301 16:88577535-88577557 TCCTCCTGGACGGCGGGAGCTGG - Exonic
1142863474 17:2777071-2777093 CACGTATGGACGGCGCGAGCCGG + Intronic
1143246125 17:5486811-5486833 CCAGCATGCAGCGCGGGCGCGGG + Intronic
1149454970 17:56780421-56780443 CCCGGAGCGAGGGCGGGCGCGGG - Intergenic
1151657642 17:75503160-75503182 CCCTCAGCGAAGGCGGGCGCCGG - Exonic
1154125697 18:11689990-11690012 CCCGCGGGGGCGGCGGGCACCGG + Intronic
1157600769 18:48891930-48891952 CCCGCATGGGAGGAGGGGGCAGG + Intergenic
1160868805 19:1267779-1267801 CCCGCATGGACGGCGGGCGCAGG + Intronic
1161248980 19:3270528-3270550 CCCGCCTGGGCGTCGGGCGCAGG + Intronic
1161443347 19:4304787-4304809 CCCGCAGGGGCGTCGGGGGCGGG + Intronic
1162807301 19:13144608-13144630 CCCGCATGGACGGGGTCCTCAGG - Exonic
1163664142 19:18595190-18595212 CCAGCAGGGGCGGCGGGGGCCGG - Intronic
1168182645 19:54672554-54672576 CCCGCATGGGCTGAGGTCGCAGG - Intronic
926149164 2:10415200-10415222 GCCGCATGGAGGGCCGGCCCTGG + Intronic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
938416145 2:131105267-131105289 CGCGCATGCGCGGCGGGCCCCGG - Exonic
948572713 2:238927538-238927560 CCAACATGGAGGGCGGGAGCAGG + Intergenic
949014554 2:241702122-241702144 TCCGCGTGGGCGGCGGGCGCGGG - Intronic
1169367169 20:5001211-5001233 CCAGGGTGGCCGGCGGGCGCGGG + Intronic
1172703024 20:36863966-36863988 CCTGCCCGGACGCCGGGCGCAGG - Intergenic
1172835480 20:37870412-37870434 CCCGCAAGGACTGGGGGCACAGG - Intronic
1172855681 20:38000472-38000494 CCCGCGTGGGCGGCCAGCGCAGG + Intronic
1176380693 21:6111020-6111042 CCCGCCCGGGCGGCGGGGGCGGG + Intergenic
1176382415 21:6119961-6119983 CCAGGAGGGACGGCGGGCGTCGG + Exonic
1179164329 21:38924135-38924157 CTGGAATGGAGGGCGGGCGCTGG + Intergenic
1179529765 21:42010534-42010556 CCCTCATGGACCGAGAGCGCGGG - Intergenic
1179741057 21:43418278-43418300 CCAGGAGGGACGGCGGGCGTCGG - Exonic
1179742779 21:43427220-43427242 CCCGCCCGGGCGGCGGGGGCGGG - Intergenic
1180871769 22:19150510-19150532 CCAGCTTGAGCGGCGGGCGCGGG - Intergenic
1183386895 22:37519824-37519846 CCCACATGCACTGCGGGCGCGGG + Intergenic
989983117 5:50666703-50666725 ACCGGCTGGGCGGCGGGCGCCGG - Intronic
1002055703 5:176596944-176596966 CCGGCACGGGCGGCGGGCGGCGG + Exonic
1002296287 5:178232899-178232921 CCCGCCTGGGCGCCGGGAGCAGG - Intergenic
1002719119 5:181247129-181247151 CCGGCAGGTCCGGCGGGCGCAGG - Intronic
1007390205 6:41546417-41546439 TCCGCAGGGACGGCGGGCTCCGG - Exonic
1007591162 6:43021695-43021717 CCCGCGGGGACGTCGGGCCCCGG - Exonic
1008932399 6:56954658-56954680 CACGCCGGGACGGCGGGCACGGG + Intergenic
1013099601 6:106975259-106975281 ACCGCGTGGGGGGCGGGCGCCGG + Intronic
1015149218 6:130019840-130019862 CCCGCGCGGACGGCCGCCGCGGG - Intronic
1015526002 6:134175655-134175677 CCCCCATGGGCAGCGGGCGGCGG + Intronic
1015799353 6:137044722-137044744 CCCGCATGGGCGGCGGGGCTGGG + Exonic
1018943707 6:168329544-168329566 ACCGCATGGAGGGAGGGCTCAGG - Intergenic
1024537445 7:50450032-50450054 CCGGCGTGGACGGCAGGCTCGGG - Intronic
1029281616 7:99439174-99439196 CCGGCATGGACAGTGAGCGCGGG + Exonic
1029483556 7:100826608-100826630 CCCTCATGTACGGCGGGAGGTGG + Intronic
1037818882 8:22126110-22126132 CCAACGTGGACGGAGGGCGCCGG + Intronic
1042246385 8:66712746-66712768 CCGGCAGGGCCGCCGGGCGCCGG - Intronic
1057619133 9:96619492-96619514 GCTGCGGGGACGGCGGGCGCCGG + Exonic
1058176008 9:101737655-101737677 CCTGCATGGCCGGGGGCCGCCGG - Exonic
1198398802 X:136250830-136250852 CCCGCAGGGACTCCGCGCGCCGG - Intronic