ID: 1160868968

View in Genome Browser
Species Human (GRCh38)
Location 19:1268427-1268449
Sequence GAGTGGGCCTGGCCCCGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160868964_1160868968 -7 Left 1160868964 19:1268411-1268433 CCTGGGTGGAGGAGCAGAGTGGG 0: 1
1: 0
2: 5
3: 75
4: 537
Right 1160868968 19:1268427-1268449 GAGTGGGCCTGGCCCCGCGTGGG 0: 1
1: 0
2: 2
3: 12
4: 139
1160868958_1160868968 14 Left 1160868958 19:1268390-1268412 CCTGTGGAAGGAGAGAAAAGGCC 0: 1
1: 0
2: 1
3: 38
4: 324
Right 1160868968 19:1268427-1268449 GAGTGGGCCTGGCCCCGCGTGGG 0: 1
1: 0
2: 2
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160868968 Original CRISPR GAGTGGGCCTGGCCCCGCGT GGG Intronic
900184393 1:1326083-1326105 GAGTGGCCCAGGCCCTGCTTTGG - Intronic
900376030 1:2355268-2355290 GCGCGGGCCGGGCCCCCCGTGGG + Intronic
900599355 1:3496515-3496537 GGCTGGGCCTGGCCCCAAGTGGG - Intronic
900867364 1:5277867-5277889 GAATGGGCCGGGCCCCTTGTGGG + Intergenic
902823442 1:18956882-18956904 GAGAGGGCGTGGCCCCGCCGGGG - Intergenic
903350044 1:22711580-22711602 GAGCGCGCCAGCCCCCGCGTCGG + Intronic
905168239 1:36096131-36096153 GAGTGGGGCTGGCCTGGCGAGGG + Exonic
905202415 1:36323434-36323456 GAGTGGGCCTGGCCCCGGGCCGG - Intronic
906263200 1:44408095-44408117 TAGTGGGCTCGGCTCCGCGTTGG + Intronic
907484442 1:54767465-54767487 CAGAGGGCCTGGCCCGGTGTTGG + Intergenic
907893761 1:58663839-58663861 GAGTCGGCCTGGCTCTGGGTGGG + Intronic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
913592499 1:120342178-120342200 GAGCGGGGCTCGCCCCTCGTCGG - Intergenic
913650851 1:120912952-120912974 GAGCGGGGCTCGCCCCTCGTCGG + Intergenic
914170261 1:145216115-145216137 GAGCGGGGCTCGCCCCTCGTCGG - Intergenic
914525379 1:148460081-148460103 GAGCGGGGCTCGCCCCTCGTCGG - Intergenic
914598295 1:149175749-149175771 GAGCGGGGCTCGCCCCTCGTCGG + Intergenic
914641022 1:149607047-149607069 GAGCGGGGCTCGCCCCTCGTCGG + Intergenic
915359392 1:155277263-155277285 GAGAGGGCGTGGCCTAGCGTTGG - Intronic
915558821 1:156674931-156674953 GAGAGGGGCTGGGCCCGTGTGGG - Intronic
917790127 1:178494103-178494125 CATTGGGCCTGGCCCAGGGTTGG - Intergenic
1063464778 10:6236053-6236075 CACTGTGCCTGGCCCCACGTCGG + Intergenic
1066963666 10:42242539-42242561 GAGTCGGACGGGCCCCGCGGGGG - Intergenic
1069624583 10:69860008-69860030 GGGTGAGGCTGGCCCCACGTTGG - Intronic
1069710888 10:70487887-70487909 GAGTGGGCCTGGGCCCAAGGTGG - Intronic
1076899207 10:133328832-133328854 GTGAGGGCCTGGGCCAGCGTGGG - Intronic
1077092627 11:786654-786676 TGGTGGGCCTGGCCACGGGTGGG - Intergenic
1082932987 11:58628611-58628633 GATTGGGCCTGGCCCTGGCTAGG - Intergenic
1083934980 11:65865401-65865423 GAGGGGGCCTGGCCTTGTGTGGG + Intronic
1084527215 11:69704697-69704719 GAGCGCGCCCGGCCCCCCGTCGG - Intergenic
1085050391 11:73377148-73377170 GGGTGGCCCTGGCCCTGCGCCGG - Intronic
1085413843 11:76307379-76307401 GCCTGGGCCTGGCCCAGGGTAGG + Intergenic
1085527512 11:77172888-77172910 GAGTGGCCCTGGCCTGGGGTTGG + Intronic
1088658461 11:112024849-112024871 GACTGGGCCGCGCCCCGCGCAGG - Exonic
1090969013 11:131623709-131623731 GAGTGGGCCTGGCCCAGAGGGGG - Intronic
1091439543 12:501955-501977 GAGTGGGCCTGGGCCAGCTGAGG + Intronic
1104950901 12:132439457-132439479 CACTGGGCCAGGCCCCACGTGGG - Intergenic
1108140115 13:47411592-47411614 GAGGGGGCCTGGGCCAGCTTAGG + Intergenic
1110426587 13:75374171-75374193 GAGTGGGCAGGGCCTGGCGTGGG - Intronic
1113904065 13:113811295-113811317 GAGTGGGCCTGGGCCTGTGGGGG + Intronic
1118288971 14:64503668-64503690 GAGTCGGCCTGCCGCCGCGGCGG - Exonic
1119731723 14:76955535-76955557 GAGAGGGCCAGGGCCTGCGTGGG - Intergenic
1122552047 14:102555519-102555541 GCGAGGGCCAGGCCCGGCGTGGG - Intergenic
1122904620 14:104795954-104795976 GAGAGGGCGTGGCCCCGGGACGG - Intergenic
1124249350 15:28096946-28096968 GAGGGGTCCTGGCCCCGGGCTGG - Intronic
1125960637 15:43826944-43826966 GAGTGGGCTCCGCCCCGCCTCGG + Exonic
1130433383 15:83872060-83872082 CAGTGGGACTGGCCAAGCGTTGG + Intronic
1132737809 16:1395703-1395725 GAGTGGAGCTGGCACCACGTGGG - Intronic
1133369902 16:5239608-5239630 GAGCGGGTCTGGCCACGGGTAGG + Intergenic
1136707448 16:32201648-32201670 GAGTGGGGGTGGCCCTGGGTGGG + Intergenic
1136760463 16:32727769-32727791 GAGTGGGGGTGGCCCTGGGTGGG - Intergenic
1136807640 16:33142617-33142639 GAGTGGGGGTGGCCCTGGGTGGG + Intergenic
1138144730 16:54598215-54598237 GAGTGGGTCAGGCCCTGTGTAGG + Intergenic
1141214566 16:82011362-82011384 GAGTGGGCCTGGGCTGGGGTTGG - Intronic
1141722274 16:85763134-85763156 GTGTGGTCCTGGCCCCCCGTGGG + Intergenic
1142188529 16:88706322-88706344 GCGCGGGCCTGGCCCCGGGATGG - Exonic
1142257461 16:89021385-89021407 GAGAGGGGCAGGTCCCGCGTGGG - Intergenic
1203062616 16_KI270728v1_random:988084-988106 GAGTGGGGGTGGCCCTGGGTGGG - Intergenic
1147251024 17:39152329-39152351 GATTGGGTCTGGCCCTGAGTAGG - Intronic
1149313978 17:55421832-55421854 GAGTGGGCCAGGCCGGGGGTCGG + Exonic
1149664884 17:58358452-58358474 CAGGGGGCCTGGCCCGGCGTAGG + Exonic
1150239851 17:63622648-63622670 CAGCGGGCCTGGCTCCGCGCGGG - Exonic
1156448699 18:37254347-37254369 GAGGGGGCCTGGCAGCGCGCGGG + Intronic
1156462074 18:37326722-37326744 GAGTGGGCCTGGCCCAGATCTGG + Intronic
1157428076 18:47601288-47601310 GACTGGGCCTGGCCACTCCTAGG - Intergenic
1157445738 18:47745586-47745608 CAGTGGGCCTGACCCCGAGAGGG - Intergenic
1158137771 18:54224768-54224790 GAGGGGGCGTGGCCCCGAGAAGG - Exonic
1159943531 18:74426727-74426749 GAGTGGGGCTGGGCCAGGGTAGG + Intergenic
1160766393 19:810504-810526 GCGTGAGCCTGGGGCCGCGTGGG - Intronic
1160868968 19:1268427-1268449 GAGTGGGCCTGGCCCCGCGTGGG + Intronic
1161208762 19:3055794-3055816 GGCTGGGCCGGGCCCCGCGCAGG - Intronic
1163027074 19:14518565-14518587 GAGGGGGCGTGGCCCCGCGCGGG - Intronic
1163106384 19:15125272-15125294 GACTGGGGCTAGCCCCGCGAGGG - Intronic
1166108609 19:40609885-40609907 GGGTGGGCCTGGAGCCGGGTGGG - Intronic
1166784281 19:45358406-45358428 GATGGTGGCTGGCCCCGCGTGGG - Intronic
925020552 2:564601-564623 GCTGGGGCCTGGCGCCGCGTGGG + Intergenic
926171393 2:10555085-10555107 CAGTGGGCCAGGCCCAGCCTGGG + Intergenic
927713972 2:25341274-25341296 GCGGGGGCCGGGCCCCGCGCAGG - Intronic
928904582 2:36356124-36356146 GCGGGGGCCTCGCCCCGCGAGGG + Exonic
932073686 2:68644321-68644343 GAGTGGGGCTTGTCCCGCCTGGG + Intronic
936080437 2:109429218-109429240 GGGTGGGCCTTGGCCCGGGTGGG - Intronic
948900853 2:240956237-240956259 GAGGGGGCCTGGCCCAGCTGGGG + Intronic
948920228 2:241062909-241062931 GAGGGGCCCTGGCCCCGCTGGGG + Intronic
1168760512 20:347159-347181 GCTGGGGCCTGGCCGCGCGTGGG - Intronic
1171229873 20:23475661-23475683 GAGTGTCCCTGGCCCCCAGTGGG + Intergenic
1172034049 20:31999526-31999548 GAGTGGGCCTGGGTCAGCCTTGG - Exonic
1173916186 20:46709985-46710007 GAGAGTGCCTGGGCCCGAGTGGG - Intronic
1175967002 20:62664781-62664803 GAGTGGGCCAGACCCAGGGTGGG - Intronic
1176180337 20:63746841-63746863 GCGTGGCCCTGGCCCCGCAGTGG + Exonic
1176307004 21:5128818-5128840 GGGTAGTCCTGACCCCGCGTGGG - Intergenic
1178916433 21:36707957-36707979 GGCTGGGCCTGGCCCAGCGTGGG + Intronic
1179850055 21:44133212-44133234 GGGTAGTCCTGACCCCGCGTGGG + Intergenic
1180248136 21:46562147-46562169 GAGTGGCCCTGGCCCTAAGTTGG + Intronic
1180950813 22:19719701-19719723 GAGTGGGCCAGGCTCCTCGGGGG + Intronic
1181776151 22:25161402-25161424 GAGTGGGCCTGGGCCCGTGGAGG + Intronic
1183431592 22:37769186-37769208 AGGTGGGCCTGGCCCCAGGTTGG + Exonic
1183434369 22:37784874-37784896 CAGTGGGCCTGGCCACGCTCAGG - Intergenic
1184002916 22:41688505-41688527 GAGGGGGCATGGCCCAGCCTGGG - Intronic
1184387330 22:44183459-44183481 GAGTGAGCCTGGCCATGCCTGGG + Intronic
1184593877 22:45502865-45502887 GCGCGGCCCTGGCCCAGCGTTGG + Intronic
1184600537 22:45540797-45540819 GGGTGGGCCTGGCTCAGCATAGG + Intronic
1185389391 22:50550555-50550577 GAGTGGGCCTGGCCTGGTGTGGG - Exonic
949779478 3:7669782-7669804 GAGTAAGCCTGGCCAGGCGTAGG - Intronic
957073018 3:75580456-75580478 GAGCGGGCCTGGCCACGGGCAGG - Intergenic
961115219 3:124323458-124323480 GAGTGGGCCAGGCTCTGTGTTGG - Intronic
968394415 4:220653-220675 GACTGCGCCTGGCCCCCAGTAGG - Intergenic
968593576 4:1471554-1471576 GAGTGGGCGTGGTCCTGAGTGGG + Intergenic
968811483 4:2801403-2801425 GAGTGGGCCAGACCCCGGGTTGG - Intronic
969374285 4:6753078-6753100 GACTGGGCCTCGCCCTGCGGGGG + Intergenic
969611240 4:8228804-8228826 GAGAGGGCCTGGCCCTGCGTGGG - Intronic
969674739 4:8608349-8608371 GAGAGGGACTGGCCCTGGGTGGG + Intronic
969796539 4:9532150-9532172 GAGCGGGCCTGGCCACGGGCAGG + Intergenic
976146209 4:82044488-82044510 GAGTGGCCCTGCCCAGGCGTGGG - Intergenic
986068163 5:4256186-4256208 GAGTGGGCCTCTCCCCTAGTGGG - Intergenic
998315631 5:141180069-141180091 GAGTCGGCCTGGCCCTGGGCTGG - Exonic
998366336 5:141634978-141635000 GAGTGGGGCTGACCCTGCCTGGG - Intronic
998374602 5:141682302-141682324 GAGTGGCCGGGGCCCCGCGGAGG - Intergenic
998911659 5:146966699-146966721 CACTGGGCCTGGCACAGCGTAGG + Intronic
1000339492 5:160266299-160266321 TATTGAGCCTGGCCCTGCGTGGG - Intronic
1001311772 5:170616304-170616326 CAGTGTGCCTGGCCCAGGGTAGG - Intronic
1001755773 5:174167382-174167404 AAGTGTGCCTGGCCCCTGGTAGG - Intronic
1002078027 5:176720949-176720971 GAATGGGCCTGGCACAGAGTGGG - Intergenic
1002164698 5:177337111-177337133 GAGTGGGCCGGGCCAGGCGTTGG - Intronic
1002181128 5:177431632-177431654 GTGTGGGCCTGGCCCCGGCTGGG + Intronic
1002453639 5:179333143-179333165 CAGTGGGCATGGCCCGGCTTGGG - Intronic
1007777152 6:44230190-44230212 GAGTGGGCCTGGACCAGGGCTGG + Intronic
1018007311 6:159634337-159634359 AAGTGGGCCTGGCCCAGGGTGGG + Intergenic
1018370754 6:163165649-163165671 GAGAGGCGCTGGCCCAGCGTGGG + Intronic
1018991118 6:168675155-168675177 CAGTGGGTCTGGCCCTGCCTTGG + Intergenic
1019624435 7:2008886-2008908 GAGTGGGCTTGGCCTCTCCTGGG - Intronic
1024179170 7:46871821-46871843 GAGTGGGCCAGGCGTCGTGTGGG + Intergenic
1031964296 7:128016506-128016528 GAGTGGGCATGGGGCCGTGTGGG + Intronic
1034899401 7:154898248-154898270 GCATGGGCCTGGCCCACCGTGGG + Intergenic
1036815860 8:11902485-11902507 GAGTGGGGAGGGCCCCGCTTTGG + Intergenic
1037951081 8:23019148-23019170 GAGAGGGCCTGGCCCTGGGGTGG + Intronic
1043740719 8:83808170-83808192 GAGAGTGCCTGGCCCAGGGTAGG + Intergenic
1045516176 8:102863269-102863291 GAGCGGGGCGGGCCCCGCGCCGG - Intronic
1048995674 8:139792422-139792444 GCGTGGGCCTGGCTGCGTGTGGG + Intronic
1049002919 8:139837595-139837617 GAGTGGGACTGGCCCCCTGAAGG + Intronic
1049003694 8:139841731-139841753 GAGTGGGCAGGGCCCAGCATGGG - Intronic
1049664113 8:143835495-143835517 GAGTGGGGCTGACCCTGCCTTGG - Exonic
1049719402 8:144108635-144108657 GGGTGGGCAGGGCCCCGGGTTGG + Exonic
1049781429 8:144430737-144430759 GGGTGTGCCTGGCCCAGCTTGGG + Intronic
1053157855 9:35792523-35792545 GCCTGGGCCTGGCCACGGGTGGG + Exonic
1056167900 9:83956539-83956561 GAGTGGACCTTGACCCGCCTAGG - Exonic
1060480885 9:124016205-124016227 GAGCAGGCCTGGCCTCGCGCCGG + Intronic
1061327949 9:129875426-129875448 GATGGGGCCTGGCTCCGCGAAGG - Exonic
1061397992 9:130353892-130353914 GGGTCAGCCTGGCCCCCCGTGGG + Intronic
1061590236 9:131593375-131593397 GAGTGAGTCTGGCCACCCGTTGG - Intronic
1062235682 9:135506541-135506563 GAGTGGGAGTGGCCCAGCCTCGG - Intergenic
1062272647 9:135716984-135717006 GAGTGGACCTGGCCCTGTGGTGG + Intronic
1185621353 X:1452963-1452985 GACTGGGCGTGGCCTCGCGGAGG - Intronic
1189043896 X:37571507-37571529 GAGTGGCGCGGGCCCCGCGTGGG + Intronic
1195614176 X:106899897-106899919 GAGAGGGCCTGGCCCCATGCTGG + Intronic