ID: 1160871306

View in Genome Browser
Species Human (GRCh38)
Location 19:1279099-1279121
Sequence TGCCTCTCTCCTGCCCCCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 266}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160871295_1160871306 29 Left 1160871295 19:1279047-1279069 CCCAACAGCCACCGCCCAGGACG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871304_1160871306 -8 Left 1160871304 19:1279084-1279106 CCTGACTGTGACTTGTGCCTCTC 0: 1
1: 0
2: 3
3: 21
4: 252
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871294_1160871306 30 Left 1160871294 19:1279046-1279068 CCCCAACAGCCACCGCCCAGGAC 0: 1
1: 1
2: 1
3: 30
4: 303
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871303_1160871306 -3 Left 1160871303 19:1279079-1279101 CCTTGCCTGACTGTGACTTGTGC 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871296_1160871306 28 Left 1160871296 19:1279048-1279070 CCAACAGCCACCGCCCAGGACGC 0: 1
1: 0
2: 1
3: 25
4: 189
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871299_1160871306 18 Left 1160871299 19:1279058-1279080 CCGCCCAGGACGCTGAGGCTCCC 0: 1
1: 0
2: 0
3: 30
4: 296
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871298_1160871306 21 Left 1160871298 19:1279055-1279077 CCACCGCCCAGGACGCTGAGGCT 0: 1
1: 0
2: 6
3: 97
4: 1189
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871302_1160871306 -2 Left 1160871302 19:1279078-1279100 CCCTTGCCTGACTGTGACTTGTG 0: 1
1: 0
2: 2
3: 8
4: 166
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871301_1160871306 14 Left 1160871301 19:1279062-1279084 CCAGGACGCTGAGGCTCCCTTGC 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266
1160871300_1160871306 15 Left 1160871300 19:1279061-1279083 CCCAGGACGCTGAGGCTCCCTTG 0: 1
1: 0
2: 1
3: 39
4: 1212
Right 1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160871306 Original CRISPR TGCCTCTCTCCTGCCCCCGT GGG Exonic
900000895 1:14319-14341 TGACTGCCTCCTGCCCCTGTTGG - Intergenic
900020609 1:184835-184857 TGACTGCCTCCTGCCCCTGTTGG - Intergenic
900264130 1:1748994-1749016 TAGCTCTGTCCTGCCCCCTTCGG + Intergenic
900977402 1:6026141-6026163 TGCCTGTCTCCTGCCCCATCTGG + Intronic
901447032 1:9314823-9314845 TGCCTCCTTCCTGACCCCGGGGG - Intronic
902070698 1:13733507-13733529 TGCATCTCTCCTGCCTCACTGGG + Intronic
902333622 1:15742813-15742835 TGCCTCCCTCCCGCCCCCTCAGG + Exonic
902413929 1:16227971-16227993 CGCCTCTCTCCCGCCGCCGCGGG + Intergenic
903332275 1:22602278-22602300 AGCCTCTCCCCCGCCCCCATGGG - Exonic
903510439 1:23870635-23870657 TGCCTCTCACCTGTCCCTGCAGG - Exonic
903664023 1:24995838-24995860 GGCCCCTTTCCTGGCCCCGTGGG - Intergenic
904198009 1:28800523-28800545 TGGCTCTGTCCTGACCCCTTGGG + Intergenic
904424610 1:30415395-30415417 GGCCTCACTACTGCCCCTGTGGG - Intergenic
904806015 1:33133072-33133094 TGTCTCTCTCCTGACCCACTGGG - Intergenic
905008317 1:34729231-34729253 TGTTTCTCTCCTACCTCCGTGGG + Intronic
905466983 1:38162360-38162382 TCCCTCTCTCCTTCCCCCAAAGG - Intergenic
905954560 1:41981415-41981437 TTCCTCCCTCCTGCCCCCGACGG - Intronic
906083104 1:43107451-43107473 TGCCCCCCTCCCTCCCCCGTGGG - Intergenic
906554793 1:46700944-46700966 TCTCTCTCTCATGCCCCCATAGG - Intronic
906643928 1:47459362-47459384 TGCCTCTCTACTGCTCCTGAAGG - Intergenic
907047228 1:51306677-51306699 AGCCTCTGTCCTGCCCCAGGTGG - Intronic
907328593 1:53656968-53656990 TTCCTCTCTCCTGCACCCTCCGG - Intronic
909483328 1:76148695-76148717 TGCCTGTCTCCTGTCCCCAGGGG + Intronic
912655363 1:111481812-111481834 TGGGTCTCTGCTGCCCTCGTGGG - Intergenic
913521201 1:119647564-119647586 CGCCTCTCTCCTGCCCTTCTCGG + Intronic
915610015 1:156984308-156984330 TGCATCCCTCCTGCCCACGGTGG - Intronic
915648154 1:157288585-157288607 TGTCTCTCTCCTGCTACAGTGGG - Intergenic
916025234 1:160827833-160827855 TGCCTCTCTCCTGGGACCGTGGG + Exonic
916066450 1:161139967-161139989 TGACTCTTTGCTGCCCCCATGGG + Intergenic
916530586 1:165652743-165652765 TGCCCCTCTCCTGGCTCCATTGG - Intronic
919760754 1:201096572-201096594 TGCCTCCCACCTGCCCACGATGG - Intronic
919935058 1:202245746-202245768 TGCCTCTGTCCTCTCCCCATGGG - Intronic
919987842 1:202688355-202688377 ATGCTCTGTCCTGCCCCCGTGGG + Intronic
920385781 1:205569386-205569408 GGCCTCTCCCCCGGCCCCGTGGG + Intronic
922549612 1:226484376-226484398 TGCCTCTCTGCTGCCCTGGAAGG - Intergenic
922563401 1:226585687-226585709 TGCCTCTCTCACCGCCCCGTGGG + Intronic
922605349 1:226886735-226886757 TTCCCCTCTGCTGCCCCCGCTGG - Intronic
924541742 1:244987004-244987026 TGCCACTCTTGTGCCTCCGTAGG + Intronic
924582214 1:245332332-245332354 CACCTCTCACCTGCCCCCTTGGG - Intronic
924603594 1:245513170-245513192 TGCCTCTCAACTGCCCCTGGTGG + Intronic
1063458882 10:6203195-6203217 GGCCGCTCTCCTGCCAGCGTCGG + Intronic
1065677808 10:28196993-28197015 TTCATCTCTCCTGCCACCCTTGG + Intronic
1067260456 10:44685262-44685284 TGCTTCTCTCGTGCTCCCGGAGG + Intergenic
1068070071 10:52184008-52184030 TGCCTCCCTGCTGCCCTCCTGGG + Intronic
1068610600 10:59056178-59056200 TGCCACTCTCCTCCTCCTGTGGG - Intergenic
1072936336 10:99717130-99717152 TGCCTCAGCCCAGCCCCCGTTGG + Intronic
1073450003 10:103603584-103603606 TGGCTCTCACTGGCCCCCGTAGG + Exonic
1073458388 10:103651391-103651413 GGCCTTTCTCCTGCCCCAGTGGG + Intronic
1073512427 10:104051185-104051207 TGCCTCTCTCTTGTCCCCTATGG - Intronic
1075656801 10:124167284-124167306 TCTCCCTCTCCTGCCACCGTAGG - Intergenic
1075874244 10:125793375-125793397 TGCCTCTCCCCTGGGCCTGTAGG - Intronic
1075917485 10:126181661-126181683 TGCCTCTCTCCTTCCTCTGAAGG - Intronic
1076203027 10:128573103-128573125 TGCCTGTCCCCTGCTCCCCTGGG - Intergenic
1076477444 10:130762454-130762476 TGCCTCTGCCCTGCACCCGCAGG + Intergenic
1077185107 11:1232261-1232283 TGCCTCCCACCTGCCTCCATGGG - Intronic
1077529746 11:3089666-3089688 ACCCTCTCTCCTGCCCTCGGCGG + Intronic
1079455694 11:20634230-20634252 TGCCTCTCTCCTCTCCCACTGGG - Intronic
1080395121 11:31882986-31883008 TGCCTCTCCCCAGCCCCGGCTGG - Intronic
1080584043 11:33665807-33665829 GGCCTCTCTCTTCCCCCTGTAGG - Intronic
1081674447 11:44960418-44960440 TCCCTCTCTCCTGCCTCCCCAGG + Intergenic
1082627373 11:55501607-55501629 AGCCTCTCTCATGTCCCCGGTGG - Intergenic
1082714148 11:56592119-56592141 TGTCTCTGTCCTGCCCCCAGAGG + Intergenic
1083262805 11:61532323-61532345 TGACTCACTGCTGCCCCCCTGGG + Intronic
1084432310 11:69117906-69117928 TGCCTCTCTTCTGCACTCTTGGG + Intergenic
1084860464 11:72014660-72014682 TGTCTGTCTCCTGCCCTCGCAGG + Exonic
1085297911 11:75441309-75441331 TGCCTCTCCCCTGCCCCACAGGG - Exonic
1085400500 11:76232950-76232972 TGCAGCCCTCCTGCCCCCCTAGG + Intergenic
1086244841 11:84740218-84740240 TGCCTCTATGCTGCCCCCGGGGG - Intronic
1086701130 11:89901235-89901257 TGCTCCTCTCCTGCTCCTGTTGG - Intergenic
1086705037 11:89943292-89943314 TGCTCCTCTCCTGCTCCTGTTGG + Intergenic
1087332192 11:96794173-96794195 TCCCTCTCTCCTGTCTCCTTGGG + Intergenic
1087533492 11:99413587-99413609 TTCCTCTCTGTTGCCCACGTTGG - Intronic
1089040071 11:115439439-115439461 TTCCTCTATCCTGCCCTTGTTGG + Intronic
1090405270 11:126472856-126472878 TCCCTCTCTCCTGCCCCTTTTGG - Intronic
1090817799 11:130314492-130314514 TGCCTCTCTCCTCCCCCGGGAGG + Exonic
1091373982 12:14434-14456 TGACTGCCTCCTGCCCCTGTTGG - Intergenic
1095357219 12:41289687-41289709 GGCCTCTGTTCTGCCCCAGTGGG + Intronic
1095725117 12:45443442-45443464 TCCCTCTCTCCTGCCCAGGCTGG - Intergenic
1097233848 12:57527011-57527033 TGCCTCTTTCCTGCCCCTGTTGG + Exonic
1099764917 12:86970943-86970965 TGCCTGTGCCCTGCCCCCATAGG - Intergenic
1101230914 12:102740019-102740041 TGTCTCTCTCCTTCCCAGGTGGG + Intergenic
1102265430 12:111480430-111480452 TGCCTGTCTCCTGGCACCCTGGG - Intronic
1102429132 12:112868005-112868027 GGCCTTTCTCCTGGCCCTGTGGG - Intronic
1104051680 12:125198833-125198855 TGCCTCCCTCCTGCCCCTGGAGG + Intronic
1104586690 12:130053503-130053525 TGCCTGTCTCCTGCCACCGCTGG - Intergenic
1104619778 12:130302292-130302314 TGCCTCTCCCCACCCCCCATAGG + Intergenic
1105632776 13:22187695-22187717 TGGTTCTCTCCTGCCCTCTTTGG + Intergenic
1105831443 13:24165681-24165703 TGCCAGCCTCCTGCCCCCATTGG - Intronic
1105958031 13:25301983-25302005 TGCTTCTCTCCAGCCCCACTGGG - Intronic
1106128584 13:26921069-26921091 TGCCTCTCTCCCTCCAGCGTGGG - Intergenic
1106437947 13:29740340-29740362 GGCCTCTCTCCAGCGCCCGGTGG - Intergenic
1107823307 13:44305524-44305546 AGCCTGTCTCCTGCCTCCGAAGG - Intergenic
1108745357 13:53387918-53387940 TGCATCTTTTCTGCCCCCTTGGG + Intergenic
1110471609 13:75866357-75866379 TCCCTCTCTCCTTCCCCCATCGG + Intergenic
1110730842 13:78877090-78877112 AGCCTCTCTCCTGCACTTGTAGG + Intergenic
1110741918 13:79007791-79007813 GGCCCCTCTCCTGCCACTGTGGG - Intergenic
1112103574 13:96216728-96216750 TCCCTCTCTCCTGCCCTAGAGGG + Intronic
1112436748 13:99396009-99396031 TGCCTCTGTCCTGATCCTGTGGG + Intergenic
1113379366 13:109787556-109787578 GGCGTCTCTCCAGCCCCCGCAGG + Intergenic
1115500410 14:34044492-34044514 TTCCTCTCTCCTGCTCTCCTGGG - Intronic
1116871284 14:50071087-50071109 TGCCTCTCTCCAGCCTCCAGCGG + Intergenic
1118005307 14:61559986-61560008 AACCTCTCTCCAGCCCCCGGGGG - Intronic
1118330888 14:64815197-64815219 TGCCTCTCCCCTGTCCCCTTAGG - Intronic
1120940350 14:89942049-89942071 TCTCTCTCTCCTGCCACCATGGG + Intronic
1121005567 14:90488685-90488707 GGCATCTCTGCTGCCCACGTGGG + Intergenic
1121407297 14:93727092-93727114 TGCCTGTCTCCCACCCCCCTGGG - Intronic
1121638276 14:95468197-95468219 TGGCTCTCTCCTTCCCCACTCGG + Intronic
1121777080 14:96598150-96598172 TCCCTTTCTCCTGCCCCTCTAGG + Intergenic
1121777122 14:96598283-96598305 TCCCTTTCTCCTGCCCCTCTAGG + Intergenic
1122005204 14:98697743-98697765 TGTCACTCTCCTGACCCCATGGG + Intergenic
1122068425 14:99189684-99189706 TGCCTTTATCCTGCCCTCATGGG - Intronic
1122323603 14:100869545-100869567 AGCCTCTGTGCTGCCCGCGTTGG + Intergenic
1122323790 14:100870587-100870609 AGCCTCTGTGCTGCCCGCGTTGG + Intergenic
1122408700 14:101514996-101515018 TGCCTCTCTGGTGCCCCCTCTGG + Intergenic
1124117065 15:26854576-26854598 TGCCTCTCTCCCTCCCTCCTAGG - Intronic
1124659547 15:31535309-31535331 TGTCTCTCTCCTGCCACCTTGGG + Intronic
1125547115 15:40513912-40513934 TGCGTCTCTCCTGCCCCAGGAGG + Intergenic
1125795584 15:42401967-42401989 TGCCTCTCTAATGCCCCCCCTGG - Intronic
1126238828 15:46417492-46417514 TCTCTCTCTCCTGCTGCCGTGGG + Intergenic
1127256667 15:57299054-57299076 TGCCTCCCTCCTGGTCCCATGGG - Intronic
1127331429 15:57943792-57943814 TGCCTCTCTGCTGGCCCCTCTGG - Intergenic
1128300909 15:66565784-66565806 TGCCTCTGTCCTGCACACGAGGG + Intronic
1128532281 15:68462680-68462702 TGCCTCTCCACTGCCCTCCTGGG + Intergenic
1131292643 15:91120277-91120299 TCTCTCTCTCCTGCCACCATGGG - Intronic
1132452615 15:101976626-101976648 TGACTGCCTCCTGCCCCTGTTGG + Intergenic
1132454284 16:14000-14022 TGACTGCCTCCTGCCCCTGTTGG - Intergenic
1134311239 16:13077011-13077033 TTGCTCTCTCCAGCCTCCGTGGG - Intronic
1135256409 16:20944898-20944920 TTCCTCTCTGCTCCCCCAGTGGG + Intronic
1135955334 16:26952083-26952105 CGTCTCTCTCCTGCCTCAGTTGG - Intergenic
1136417346 16:30112256-30112278 GGCCTCTCTCACGCCCCCGGTGG + Intronic
1136547846 16:30965579-30965601 TGACCCTCTTCTGCCCCCGCAGG + Exonic
1137034928 16:35561827-35561849 TGCCTATGTCCTGCCTCCCTTGG - Intergenic
1137287242 16:47026561-47026583 TGCCTCTCTCCCGCCTCATTAGG - Intergenic
1139480432 16:67227488-67227510 TGCCTCTCTCAGGCCTCCGCTGG - Intronic
1139515053 16:67447760-67447782 TGCCCCTCTGCTGCGCCCTTTGG + Intronic
1142133314 16:88440851-88440873 TGCCACTCTCGGGCCACCGTGGG + Intergenic
1142248063 16:88978820-88978842 TGCCTGTCTCCTACCCCGGGTGG - Intergenic
1142364779 16:89644506-89644528 TGCCTCAGTCCTGTCCCCTTGGG - Exonic
1142381463 16:89734681-89734703 TGCCTCCCGCCTGTCCACGTGGG - Intronic
1143474640 17:7195713-7195735 CACCTCTCTCCCGCCCCCGGGGG - Intronic
1143490204 17:7281680-7281702 CACCTCGCTCCTGCCCCCGCGGG - Exonic
1143634489 17:8156518-8156540 TGTATCTCTCCCGCCCCCGTTGG - Intronic
1143780813 17:9228373-9228395 AGCCTCTCTCCAGCCTCCCTGGG - Intronic
1144624811 17:16839231-16839253 TGCCTCCCTCCTGCCCTCCATGG + Intergenic
1144881619 17:18433490-18433512 TGCCTCCCTCCTGCCCTCCATGG - Intergenic
1145150614 17:20510896-20510918 TGCCTCCCTCCTGCCCTCCATGG + Intergenic
1146409646 17:32571384-32571406 TGCCTTTCTTCTGCTCCCCTGGG + Intronic
1146508277 17:33424189-33424211 TTCCTCACTCCTGCCCCCAAGGG + Intronic
1147326737 17:39673263-39673285 TGAGTCTCTCCTGCCCCCACTGG - Intronic
1147578957 17:41617926-41617948 TGCCTCCCTCCTGCCCTCCATGG + Intergenic
1149430695 17:56594027-56594049 TGCCTTTCTTCCGCCCCGGTGGG + Exonic
1150006805 17:61475103-61475125 TGGCTCCCACCTGCCCCTGTAGG + Intronic
1150210058 17:63436903-63436925 TGCCTTGCTCCTGCCCCAGGGGG + Intronic
1150280950 17:63929419-63929441 TGCCCCTCTCCTTACCTCGTAGG + Exonic
1150792262 17:68208086-68208108 TGAGCCTCCCCTGCCCCCGTGGG + Intergenic
1151928007 17:77213021-77213043 TGCCAGGCTCCTGCCTCCGTAGG + Intronic
1152623750 17:81379155-81379177 TGCCACTCTCATGCCCCTGCGGG - Intergenic
1152880363 17:82811255-82811277 TGCCTCTCTCCTCCAGCCGCTGG + Intronic
1152938446 17:83153710-83153732 TGCCTGCCTCCTGCCCCGCTGGG + Intergenic
1156448430 18:37253534-37253556 TCCCTCACTCCTGCCCCTGGTGG + Intronic
1158521140 18:58172092-58172114 TGGCTCTCTCCTGACCCCTAAGG - Intronic
1160000797 18:75019815-75019837 TCTCTCTCTCCTGCCACCATGGG - Intronic
1160148512 18:76383156-76383178 TGCTTCTCTCCCGCCCTCCTGGG - Intronic
1160163259 18:76491377-76491399 GGCCTCGCTCCCGCCCCCGCCGG + Intronic
1160605008 18:80043642-80043664 TGCCTATCCCCTGCCTCCGGGGG - Intronic
1160828452 19:1091526-1091548 TGCCTCTCGCCAGCTCCTGTGGG - Intronic
1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG + Exonic
1161076048 19:2286301-2286323 GGCCTCTGTTCTGCCCCCGAAGG + Intronic
1161112791 19:2479255-2479277 TCTCTCTCTCCCTCCCCCGTCGG - Intergenic
1163347068 19:16750003-16750025 TGCCTCTCAACTGCCCCCCGAGG + Exonic
1163762651 19:19145918-19145940 CGCCTCTCTCCGGCCCCCGGGGG - Exonic
1164377443 19:27701016-27701038 TGGCTATGTCCTGCCCCCGGAGG + Intergenic
1166147736 19:40848839-40848861 TCCCTCTCTCCTCCACCCTTGGG - Intronic
1166937815 19:46345513-46345535 TGCCACTCTACTGCCTCTGTAGG - Intergenic
1167197446 19:48040286-48040308 TGCCTCTCTCCTTACCTCATGGG - Intronic
1168059289 19:53882366-53882388 TGCCCCTCTCCTGCCCACCTCGG + Exonic
925405593 2:3603806-3603828 TGCCTGTCTCCTGCCACCTAAGG + Intronic
926171078 2:10552976-10552998 TGTCTGTCTCCGGCCCCCCTGGG - Intergenic
926923517 2:17963108-17963130 TGCCTATCTCCTGCTCCATTCGG - Intronic
926979581 2:18553936-18553958 TTCCTTTCTCCAGCCCCCGTAGG - Intergenic
927975544 2:27335685-27335707 GGCTCCTCTCCTGCCCCGGTTGG - Exonic
928447987 2:31349930-31349952 TGCCTGTCATCTGCCCCCATGGG + Intronic
931760222 2:65410335-65410357 TGTCTCTCTCCTGCCCATGCTGG + Intronic
936568828 2:113599100-113599122 TGACTGCCTCCTGCCCCTGTTGG + Intergenic
937017428 2:118618833-118618855 TGGCTCTCTCCTACCCTCCTTGG + Intergenic
937900447 2:127015775-127015797 TTCCTCTCTCCTGCTTCCTTTGG + Intergenic
937952748 2:127401149-127401171 TGCCTCTCCTCTGCGCCCCTCGG - Intergenic
946651162 2:221893302-221893324 TCCCTCTCTCCTGCCACCATGGG + Intergenic
948351042 2:237341080-237341102 TGCCGCTCTCCTGTCCCTGAAGG + Exonic
948368516 2:237473662-237473684 TGCCTCTCTCCGGCCCGAGGCGG + Intergenic
948614098 2:239187230-239187252 TGCCTCTCAGAAGCCCCCGTCGG - Intronic
1168966788 20:1903605-1903627 TACCACTCTCCTGCCTCCTTGGG + Intronic
1169498958 20:6141094-6141116 TGCCTCTTTCCTGCCATCTTTGG + Intergenic
1172626562 20:36350804-36350826 TGCCTGACTCCTTCCCCAGTGGG + Intronic
1172754065 20:37271053-37271075 TGCCTAGCTCCTGTCCCCCTGGG + Intergenic
1172894680 20:38292211-38292233 TTCCTCTCTCCTGCCCTCCCAGG - Intronic
1173089996 20:39961334-39961356 TGCCTCTCTTCTGCTTCCATTGG + Intergenic
1174564709 20:51456594-51456616 GGCCTCTCTCCTTCCAGCGTGGG + Intronic
1175277120 20:57779800-57779822 TGTCTCTCTCCTCCCTCCGTGGG + Intergenic
1176229621 20:64025495-64025517 GTCCTCTCTCCTGCCCATGTGGG + Intronic
1178520529 21:33285513-33285535 GTCCTCTCTCCTGCCCCCTGTGG + Intronic
1179120882 21:38544574-38544596 CGCCTCTCTTCTGCCACAGTAGG - Intronic
1179433901 21:41346513-41346535 AGTCTCTCTCCTGCACACGTCGG + Intronic
1182816669 22:33170604-33170626 TCTTTCTCTCCTGCCCCCTTGGG + Intronic
1183329439 22:37211691-37211713 GGCCTCCCTCCTGCCTCCCTGGG + Intronic
1183485285 22:38084990-38085012 TCCCCCTTTTCTGCCCCCGTGGG - Exonic
1183659860 22:39212946-39212968 TCACTCTCTGCTGCCCCCTTAGG - Intergenic
1185049342 22:48545705-48545727 TCCCTCTCTCCTGCACCCAAGGG - Intronic
1185255640 22:49829185-49829207 GGCCGCTCGGCTGCCCCCGTGGG - Intergenic
951508941 3:23480160-23480182 GGCCTCCCTCCTGCACTCGTAGG + Intronic
953661351 3:44893973-44893995 TGGCTCTCTCCCACCCCCCTCGG + Intronic
954203196 3:49037700-49037722 TCTCTCTCTCTTGCCCACGTTGG - Intronic
955400399 3:58587102-58587124 TGCCCCCCTCCTTCCCCCGGCGG - Intronic
955506140 3:59635041-59635063 TTGCTCTCACCTGCCCCCATGGG + Intergenic
959356843 3:105342745-105342767 TGCCATTCTCCTGCCTCAGTAGG + Intergenic
960387336 3:117035985-117036007 TGCCTCTCTGCTCCTCCCCTGGG - Intronic
961816789 3:129555264-129555286 TGCCCCCCTCCAGCCCCCATGGG + Exonic
967013223 3:185458583-185458605 TGACTTTATCCTGCCCCAGTAGG + Intronic
967080631 3:186046283-186046305 TGCCTCTTTCTTGCCCTCATTGG - Intergenic
967552150 3:190809161-190809183 TGCCTCTCTGCTGACTCTGTGGG - Intergenic
969546683 4:7834672-7834694 TGCCCCTCAGCTGCCCCCTTGGG - Intronic
969689292 4:8695244-8695266 GGCCTTTCACCTGCCTCCGTGGG + Intergenic
972773164 4:42217429-42217451 TGTGTCACTCCTGACCCCGTGGG - Intergenic
972817152 4:42657036-42657058 TGCCTTTCTCCTCCTCCTGTCGG - Exonic
982331315 4:154184853-154184875 TCCCTCTCTCCTGCTGCCATGGG - Intergenic
984806726 4:183758183-183758205 GGCCTCTCGCCTGCCTCCTTAGG + Intergenic
984814707 4:183825564-183825586 TGCCTCTGTCCTGCCAACGTGGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
986445277 5:7815940-7815962 GGCCTCTCTTCTCCCCCTGTCGG + Intronic
986546976 5:8908254-8908276 GGACTCTCTGCTGCCCCCGGTGG - Intergenic
987989656 5:25193838-25193860 TGCCTCTCAGCTGCCCTGGTAGG + Intergenic
994878764 5:105460075-105460097 TCTCTCTCTCCTGCCACCATGGG - Intergenic
996119366 5:119653409-119653431 CCTCTCTCTCCTGCCACCGTGGG + Intergenic
997507905 5:134432830-134432852 TGCCTCTCTCCTCCCCTCTGTGG + Intergenic
997891855 5:137683995-137684017 TGCCTCACTCCTGCCTCTCTTGG - Intronic
998331885 5:141334863-141334885 TCCCTCTCTCCTTCCCTCCTGGG - Intronic
999154990 5:149451577-149451599 TGCCTCTCTCGTCCAGCCGTGGG + Intergenic
1002301034 5:178257387-178257409 TGCCTCTCTCCGGCCTGCGCTGG + Intronic
1002826321 6:777557-777579 TACCTGCCTCCCGCCCCCGTGGG + Intergenic
1005821902 6:29605696-29605718 TGACTCTCTCCTGCCATCCTAGG - Exonic
1006374451 6:33664076-33664098 TGCCTGGCGCCTGCCCCAGTTGG + Intronic
1010014716 6:71091119-71091141 TGTCTCTCTCCTGCACTGGTTGG + Intergenic
1011810804 6:91130109-91130131 TGCGTCTCTCCTGCCCAGTTTGG - Intergenic
1012357660 6:98336030-98336052 TGCATCTCTCCTGCCTCCTCAGG + Intergenic
1015775424 6:136809291-136809313 TCTCTCTCTCCTGCTACCGTGGG - Intergenic
1020115886 7:5476146-5476168 TGCCCCTCCCCTGCAGCCGTCGG - Intronic
1023874959 7:44281888-44281910 TGCCTCACTCCAGGCCCCTTGGG + Intronic
1027052179 7:75027460-75027482 TGCCTGTGTCCTGCCTCCGTGGG + Intronic
1028162518 7:87501296-87501318 TCTCTCTCTCCTGCCACCATGGG - Intergenic
1028479251 7:91286660-91286682 AGCCCCTCTGCTGCCCCTGTTGG - Intergenic
1030093342 7:105876715-105876737 TGCCTCTCTGCTGCCCCTGGCGG - Intergenic
1031106387 7:117547992-117548014 TGCCTCACTATTGCCCCCGTGGG - Intronic
1032240198 7:130153981-130154003 TGTTTCTCACCTGCTCCCGTGGG - Intergenic
1032793621 7:135260161-135260183 TGCTTCTCTCCTGCAGCCTTGGG + Intergenic
1037911203 8:22744652-22744674 TTCTTCTGTCGTGCCCCCGTAGG - Intronic
1039265102 8:35815716-35815738 TGCGCCTCCCCTGCCCCCGCCGG - Intergenic
1040571706 8:48617163-48617185 TGCTGCTCTCCTGGCCCCGAGGG + Intergenic
1041015308 8:53587253-53587275 TCCCTCTACCCAGCCCCCGTAGG - Intergenic
1042484904 8:69338267-69338289 TGCCTCTCTCCTCCTCGCATTGG - Intergenic
1042643209 8:70956990-70957012 TGCCTGTTCCCTGCCCCCATTGG + Intergenic
1043230936 8:77800246-77800268 TCTCTCTCTCCTGCCACCTTGGG - Intergenic
1045873325 8:106950171-106950193 GGCCTCTCTCCTGTGCTCGTTGG - Intergenic
1047348937 8:124054915-124054937 TGCTTCTCTCCTTGCCCCTTCGG - Intronic
1047732387 8:127737734-127737756 AGCCGCTCTCCTACCCCCGCCGG - Intronic
1049018398 8:139937561-139937583 TCCCTCTCTCCTGGCCCCACTGG - Intronic
1049343712 8:142127421-142127443 TGCATCTGTCCAGTCCCCGTGGG - Intergenic
1049883702 9:14432-14454 TGACTGCCTCCTGCCCCTGTTGG - Intergenic
1050181956 9:2932858-2932880 TGCCTCTCTCCTCCTGCCCTGGG + Intergenic
1051681134 9:19609262-19609284 AGCCCCTCTCCTGCCCCGCTTGG + Intronic
1055372753 9:75617918-75617940 TGCCTCTCTCCTGGCTCTGTTGG + Intergenic
1058888817 9:109343553-109343575 TGCCACCCTCTAGCCCCCGTAGG + Intergenic
1059168770 9:112104532-112104554 TGCCTCTTTCCTGCCTTGGTAGG + Intronic
1060700376 9:125746176-125746198 TGCCTCTGTCCCGCCCCATTCGG + Intergenic
1060722160 9:125986524-125986546 TGGCCCTCTCCTGCCTCGGTGGG + Intergenic
1061091430 9:128428659-128428681 AGCCTCATTCCTGCCCCCTTTGG - Intronic
1061727510 9:132589706-132589728 TGCGTCTCCCCAGCCCCCCTCGG + Exonic
1062534853 9:137016885-137016907 TGCCTCTCCCCTGCCCTCCAAGG + Intronic
1062584819 9:137244494-137244516 TGGCTCTCTCCTGTCCCCGGAGG - Intronic
1186051786 X:5604341-5604363 TCGCTCTCTCCTGCCACTGTGGG - Intergenic
1186053465 X:5624593-5624615 TCTCTCTCTCCTGCCACCTTGGG + Intergenic
1186632283 X:11362783-11362805 TGTCTTTCTCCTGCCTCCTTCGG + Intronic
1190296312 X:49029860-49029882 AGCCTCACCCCTGCCCCTGTGGG - Exonic
1191969153 X:66794612-66794634 TGGCTCTGCCCTGCCCCCGGAGG + Intergenic
1192326364 X:70135522-70135544 CTCCTCTCTCCTGCTCCCTTTGG - Intronic
1195592037 X:106640962-106640984 TGCCTCTCTCCTAGCCTCTTAGG + Intronic
1197905984 X:131426486-131426508 TGCCTCCCAGCTGCCCCCATTGG + Intergenic
1200153494 X:153963156-153963178 TGCCTCTTGGCTGGCCCCGTGGG - Intronic
1200402114 X:156025729-156025751 TGACTGCCTCCTGCCCCTGTTGG + Intergenic
1200848973 Y:7862873-7862895 TGCCTGTGTCCTGCCCCCAGAGG - Intergenic
1201795801 Y:17895127-17895149 TGTCTGTGTCCTGCCCCCGGAGG - Intergenic
1201805754 Y:18010858-18010880 TGTCTGTGTCCTGCCCCCGGAGG + Intergenic