ID: 1160872593

View in Genome Browser
Species Human (GRCh38)
Location 19:1283953-1283975
Sequence CCCACGAGATCCCTTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160872581_1160872593 5 Left 1160872581 19:1283925-1283947 CCTCCCGACCCTGGCCCACCCCT No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872586_1160872593 -9 Left 1160872586 19:1283939-1283961 CCCACCCCTCCTCACCCACGAGA No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872578_1160872593 10 Left 1160872578 19:1283920-1283942 CCCCTCCTCCCGACCCTGGCCCA No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872580_1160872593 8 Left 1160872580 19:1283922-1283944 CCTCCTCCCGACCCTGGCCCACC No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872577_1160872593 11 Left 1160872577 19:1283919-1283941 CCCCCTCCTCCCGACCCTGGCCC No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872583_1160872593 1 Left 1160872583 19:1283929-1283951 CCGACCCTGGCCCACCCCTCCTC No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872587_1160872593 -10 Left 1160872587 19:1283940-1283962 CCACCCCTCCTCACCCACGAGAT No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872582_1160872593 2 Left 1160872582 19:1283928-1283950 CCCGACCCTGGCCCACCCCTCCT No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872585_1160872593 -4 Left 1160872585 19:1283934-1283956 CCTGGCCCACCCCTCCTCACCCA No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872584_1160872593 -3 Left 1160872584 19:1283933-1283955 CCCTGGCCCACCCCTCCTCACCC No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872579_1160872593 9 Left 1160872579 19:1283921-1283943 CCCTCCTCCCGACCCTGGCCCAC No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data
1160872575_1160872593 28 Left 1160872575 19:1283902-1283924 CCTGGTTTGAGAAGAGACCCCCT No data
Right 1160872593 19:1283953-1283975 CCCACGAGATCCCTTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160872593 Original CRISPR CCCACGAGATCCCTTGAAGC AGG Intergenic
No off target data available for this crispr