ID: 1160872650

View in Genome Browser
Species Human (GRCh38)
Location 19:1284164-1284186
Sequence CCGGGCGGCTCCGTCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160872650_1160872663 18 Left 1160872650 19:1284164-1284186 CCCCACCAGACGGAGCCGCCCGG No data
Right 1160872663 19:1284205-1284227 CTGGGCTACAGAGCCTTGTGTGG No data
1160872650_1160872659 -1 Left 1160872650 19:1284164-1284186 CCCCACCAGACGGAGCCGCCCGG No data
Right 1160872659 19:1284186-1284208 GGAAGCTTCTCCAGCCTGTCTGG No data
1160872650_1160872660 0 Left 1160872650 19:1284164-1284186 CCCCACCAGACGGAGCCGCCCGG No data
Right 1160872660 19:1284187-1284209 GAAGCTTCTCCAGCCTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160872650 Original CRISPR CCGGGCGGCTCCGTCTGGTG GGG (reversed) Intergenic
No off target data available for this crispr