ID: 1160873166

View in Genome Browser
Species Human (GRCh38)
Location 19:1286076-1286098
Sequence CGCCGCCGCCGCCGAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 1, 2: 5, 3: 79, 4: 428}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160873166_1160873176 3 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873176 19:1286102-1286124 GCGGAGGAGGCGGAGAAGGCTGG 0: 1
1: 0
2: 10
3: 160
4: 1572
1160873166_1160873173 -10 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873173 19:1286089-1286111 GGCGGCGGCGGCGGCGGAGGAGG 0: 27
1: 1196
2: 1797
3: 3171
4: 6353
1160873166_1160873174 -7 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873174 19:1286092-1286114 GGCGGCGGCGGCGGAGGAGGCGG 0: 21
1: 104
2: 1404
3: 2580
4: 8441
1160873166_1160873179 13 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873179 19:1286112-1286134 CGGAGAAGGCTGGCAGGCGGCGG 0: 1
1: 0
2: 3
3: 37
4: 360
1160873166_1160873177 7 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873177 19:1286106-1286128 AGGAGGCGGAGAAGGCTGGCAGG 0: 1
1: 0
2: 2
3: 52
4: 695
1160873166_1160873178 10 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873178 19:1286109-1286131 AGGCGGAGAAGGCTGGCAGGCGG 0: 1
1: 0
2: 2
3: 61
4: 627
1160873166_1160873175 -1 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873175 19:1286098-1286120 GGCGGCGGAGGAGGCGGAGAAGG 0: 1
1: 2
2: 52
3: 724
4: 7116
1160873166_1160873181 18 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873181 19:1286117-1286139 AAGGCTGGCAGGCGGCGGCCGGG 0: 1
1: 0
2: 3
3: 25
4: 316
1160873166_1160873180 17 Left 1160873166 19:1286076-1286098 CCGCCCGCTCGGCGGCGGCGGCG 0: 1
1: 1
2: 5
3: 79
4: 428
Right 1160873180 19:1286116-1286138 GAAGGCTGGCAGGCGGCGGCCGG 0: 1
1: 0
2: 1
3: 35
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160873166 Original CRISPR CGCCGCCGCCGCCGAGCGGG CGG (reversed) Intergenic
900092098 1:925026-925048 CGCCCCCTCGGCCGAGCCGGAGG - Intronic
900473182 1:2864398-2864420 CGCCTCCGGCAGCGAGCGGGTGG + Intergenic
901063770 1:6485522-6485544 GCCCGCCCCCGCCGAGCGCGGGG + Intronic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
902808920 1:18877376-18877398 CCCCGCCGCGGCCCAGCGGGGGG - Intronic
902823254 1:18956263-18956285 CCCCGCCGCCGCCGCCCGGCGGG + Exonic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
903750447 1:25617595-25617617 CGCCCCCGCCTCCTCGCGGGAGG + Exonic
903829119 1:26164413-26164435 CGCCGCCGCCGCCGCCTGCGAGG + Intergenic
904128825 1:28260532-28260554 TGCCGCCGCCGCGTACCGGGCGG - Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904190137 1:28737087-28737109 CGCCGCCGTCGCCGCCCGTGAGG + Exonic
904542100 1:31239952-31239974 CGCCGCCGCCACCGACAGGGAGG + Intergenic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
905182657 1:36176494-36176516 CGCCCCCGCCGGTGAGCGCGGGG + Exonic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
905990787 1:42335294-42335316 CGCCGCTGACGCCGGGCCGGCGG - Intronic
906027223 1:42683230-42683252 CGCCGCCGCCGCCGCACACGTGG - Intronic
906293000 1:44632046-44632068 CGCCGCCCTCGCCGGCCGGGCGG + Intronic
906720118 1:47997828-47997850 CGCGTCCGCCGCCGAGCCGGCGG - Intergenic
907038359 1:51236447-51236469 GGCCGCCGCCGCCCCGCGGGGGG + Exonic
907429931 1:54405902-54405924 CGCCGCCGCCGGGCTGCGGGCGG - Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908184725 1:61641851-61641873 TGCGGCGGCCGCCGAGCGGTAGG - Intergenic
908193295 1:61725156-61725178 CGCCTCCGCCCAGGAGCGGGAGG + Intronic
908581912 1:65525537-65525559 CGCAGCCGCCCCTGAGCGGGAGG - Intronic
912383289 1:109259025-109259047 CGCTGCCGCAGCCGCGAGGGCGG + Exonic
913518264 1:119623296-119623318 CGCCGCCGCCCCCGCGCCGCTGG + Exonic
914386275 1:147172648-147172670 CGCCGCCGCCGCCTCGATGGTGG + Intergenic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
916065514 1:161132653-161132675 CGCCGCCGCGGCCGTGGGGGAGG + Exonic
918114164 1:181482836-181482858 CGGCTGCGCCGCCGAGAGGGCGG - Intronic
920394185 1:205631855-205631877 CGCCGCCGCTGCCGCGTGCGGGG - Exonic
920805693 1:209231774-209231796 CCCCACCGGCGCCGAGCGCGCGG - Intergenic
920912628 1:210232881-210232903 CGCAGTCACCGCCGAGCGGGCGG + Exonic
921355570 1:214281460-214281482 AGCCGGGGGCGCCGAGCGGGAGG + Intronic
921909042 1:220528130-220528152 GGCGGCCGCCGCCGGGTGGGCGG - Intergenic
922196489 1:223364221-223364243 CCCAGGCGCCCCCGAGCGGGCGG + Intergenic
922925423 1:229343115-229343137 AGCCGCCCCCACGGAGCGGGCGG - Intronic
924415256 1:243850563-243850585 CGGCGGCGGCCCCGAGCGGGAGG - Intronic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1065214915 10:23439622-23439644 CGCCGCGGCCGCCGAGCACCGGG + Exonic
1065342819 10:24723162-24723184 GGCCGCCGGGCCCGAGCGGGCGG - Intronic
1066429332 10:35336854-35336876 CGCCGCCGCCGCCCATGGCGAGG + Exonic
1066429344 10:35336886-35336908 CGCCGCCGCTGCTGACCCGGCGG + Exonic
1069709263 10:70478632-70478654 AGCCGCAGCCCCCGGGCGGGAGG - Intergenic
1069818273 10:71212414-71212436 CGCGGCCGCGGCAGAGCTGGGGG - Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1071695426 10:87864079-87864101 CGCCGCCGCCGCCGTGTTGGAGG - Exonic
1071784091 10:88880165-88880187 CGCCGCCGCCACAGAGGAGGGGG + Exonic
1072562296 10:96587114-96587136 CGCCACCGCCGCCGGGCCGAGGG + Intronic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1073063519 10:100745667-100745689 CGCCGCCGCGGCCGAAGGGCCGG - Intronic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1074722118 10:116272601-116272623 CGCCGCCGCCACCGAGGGCTCGG - Intronic
1075802146 10:125160356-125160378 CGCCGCCGCCGCCTCCAGGGTGG - Intronic
1076424520 10:130358144-130358166 AGCCGCGGCCGTCGAGTGGGTGG + Intergenic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076879146 10:133231397-133231419 CAGCGCGGCCGCCGAGCGAGGGG + Exonic
1077334286 11:1996608-1996630 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1078102768 11:8339583-8339605 CGCCTCTGCCGCCGAGCGCAGGG - Intergenic
1078222694 11:9364644-9364666 TGCGGCCCCCGCCGAGCTGGCGG - Intergenic
1079451177 11:20601166-20601188 CGCCGCCGCCTCCGGGCTGTTGG - Exonic
1079459767 11:20669500-20669522 CGCCGCCGCCGCCGCGCCAGCGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080036712 11:27719240-27719262 AGCCGCCGCCGCCACCCGGGTGG - Intronic
1080458475 11:32435075-32435097 CGCCGCCGCCACCCAGGGAGGGG + Exonic
1080515549 11:33016181-33016203 CAACGCCCCCGCCGAGCGGGCGG + Intronic
1082029500 11:47594258-47594280 CGCCCCTGCCGCAGCGCGGGCGG - Exonic
1083173133 11:60934596-60934618 GGCGGCCGCCGTCCAGCGGGTGG - Exonic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083672119 11:64305585-64305607 CGGCGGCGCCGCCGAGTGAGGGG + Intronic
1083936587 11:65872806-65872828 CGCCGCGGCAGGCGGGCGGGCGG - Exonic
1084000156 11:66291788-66291810 CGCCGCCGGTGCCGCGGGGGCGG + Intergenic
1084070069 11:66728168-66728190 CGGAGCCGCGGCCGGGCGGGCGG + Intronic
1084129032 11:67119336-67119358 CGCCGCCGCCGCTGCCGGGGAGG - Intronic
1084546229 11:69816452-69816474 CGCCGCCCCCACGGAGGGGGCGG + Intronic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1085096038 11:73761215-73761237 CCCCGTCGCCGCCGTGCGGGAGG - Intergenic
1085294817 11:75425456-75425478 CGCCACCGCCGCCGAGCTCACGG + Exonic
1089347039 11:117797203-117797225 CGCCGCCGCAGCCGAGCGCTGGG - Exonic
1090344991 11:126062651-126062673 CGCCGCCGCGCGCGCGCGGGGGG - Intronic
1091259786 11:134224971-134224993 CGCCGCTGCCGCCGGGCAGTGGG - Exonic
1202817269 11_KI270721v1_random:51790-51812 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1093464891 12:19439579-19439601 CGACGCCGCTGCAGAGCAGGAGG - Intronic
1096101240 12:48971616-48971638 CGCCGCGGCCGCCGGGAGGAAGG + Exonic
1096460715 12:51820389-51820411 CCCCGCCGCCTCCGCGTGGGAGG - Intergenic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1099989753 12:89709259-89709281 CGCCGCCAGCGTGGAGCGGGAGG - Intronic
1100329692 12:93571712-93571734 GACCGCCGCCTCCGAGCGCGGGG + Exonic
1100329764 12:93571961-93571983 CGAGGCCGGGGCCGAGCGGGCGG - Exonic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1100469024 12:94873761-94873783 CGCCGCGGCCGCCAAGCCGGCGG + Intergenic
1100540027 12:95548818-95548840 CGTCGCGGCCGCCGAACCGGGGG - Intronic
1100565627 12:95790912-95790934 CGCTGCCGCTGCCGCCCGGGGGG + Intronic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1101935355 12:109052613-109052635 CGCCGCCGCCGCCGGACCGAGGG - Exonic
1102136866 12:110582941-110582963 CGCCGCCGCCGCCGGCCCTGGGG + Exonic
1102278358 12:111599395-111599417 GGCCGGCGCGGCGGAGCGGGCGG - Exonic
1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG + Exonic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103595355 12:122021818-122021840 CGCCGCCGCCGCCGGCAGTGCGG - Exonic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103764667 12:123271659-123271681 CGCCGCCGCCGCCGCCCTCGCGG - Exonic
1104841453 12:131828032-131828054 CGCCGCCGCAGCGCAGCAGGTGG - Intergenic
1106269360 13:28138707-28138729 CGCCGCCGCCAGCGAGGAGGAGG - Exonic
1110119770 13:71866572-71866594 CGCCGCCGCCGCCGAAGCGATGG + Exonic
1112050620 13:95641771-95641793 GGCCGCCGCCGCCGCGGGTGCGG - Exonic
1112216319 13:97434314-97434336 CGCCGCCGCCGGCGCCCAGGGGG + Exonic
1113254849 13:108495731-108495753 GAGAGCCGCCGCCGAGCGGGTGG + Intergenic
1113541774 13:111115151-111115173 CGCCGCCGCCGCCCCGCGCACGG + Intronic
1113820595 13:113209711-113209733 CGCCGCGCCCGCCAAGCCGGGGG + Exonic
1115851296 14:37592309-37592331 CGTCGCCGCCGCCGCCCGCGCGG + Exonic
1117424427 14:55580273-55580295 CGGCGGCGCCTCGGAGCGGGCGG + Intronic
1117478191 14:56118353-56118375 CGCCGCCGAAGCCCCGCGGGAGG - Exonic
1117842119 14:59870641-59870663 AGCCGCCGTCGCCGCGCCGGGGG - Exonic
1118186487 14:63542940-63542962 CTCCGCCGCCGCGGAACCGGAGG - Exonic
1118186539 14:63543127-63543149 CGCCGCCGCCGCCGGGTCCGGGG - Exonic
1118351007 14:64972378-64972400 CGCCGCCGCCCCGGAGAGAGGGG + Intronic
1118388901 14:65280193-65280215 TGCCGCCACCGCCGAGGGGATGG - Intergenic
1118992459 14:70809108-70809130 CGCCGCTGCCGCCCCGCCGGGGG - Exonic
1119319095 14:73718881-73718903 CGCCGCCGCCGCCCACCAGCAGG - Exonic
1119743210 14:77027297-77027319 CGCCGCCGCCGCCGCTGCGGTGG - Exonic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1120914796 14:89701676-89701698 CGCCGGCGCCGGGAAGCGGGGGG - Intergenic
1120941698 14:89955914-89955936 CGCGGCGGCCGCCGAAGGGGCGG + Intronic
1122231197 14:100306972-100306994 CGCCGCCGCGGGCGCGCAGGCGG - Intergenic
1123004434 14:105314638-105314660 CGCCGGCGCCGCCGATTGGCTGG - Exonic
1124427046 15:29570946-29570968 CGGCGCGGCCGGCGGGCGGGCGG - Intergenic
1126406875 15:48331389-48331411 CGCAGCCGCCGCCGGACGAGGGG - Intronic
1127753436 15:62068009-62068031 CGCCGCCGCCGCCGTAGGTGTGG - Exonic
1129116499 15:73368082-73368104 ACCCGCGGCCGCCGAGGGGGAGG + Exonic
1129348280 15:74938166-74938188 CCCCGCCGCCGCCGGCCGCGCGG - Exonic
1129424657 15:75454789-75454811 CGCCGCCGCCGCCTTGGGGTGGG + Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1130908604 15:88256350-88256372 CGCCGCCGCCGCCGCCGGGTGGG + Exonic
1132512760 16:352489-352511 AGCCGCAGCCGCCGAGATGGGGG - Exonic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132805500 16:1773349-1773371 CGCGGCGGCCTCCGAGCCGGCGG - Exonic
1133052330 16:3124260-3124282 CGACGGGGCCGCCGAGCGAGAGG - Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133634657 16:7653843-7653865 CGCCGCGGCCGCCTACCGAGGGG + Exonic
1133784364 16:8963405-8963427 CGTCGCCGACGACGCGCGGGAGG - Exonic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136588488 16:31202727-31202749 CGCTGCAGCCGCCGACCAGGAGG + Exonic
1136625559 16:31459796-31459818 CGACGCGGCCGACGAGGGGGCGG - Exonic
1137617701 16:49856947-49856969 CGCCGCCGCCGCTGCCCAGGAGG - Intronic
1137988718 16:53131323-53131345 CGCCGCCGCCGCTGCTCGGCCGG + Intronic
1138420063 16:56893078-56893100 CCCCGCCCCCGCCGGGCAGGAGG - Intronic
1139402949 16:66696673-66696695 CGCAGCCGCAGCCGGGCGGCGGG - Exonic
1139615444 16:68085755-68085777 CGCCGCCGCCCCCGGGCTCGCGG + Exonic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1141682690 16:85553629-85553651 CGCCGCAGCCACCGAGCTGCTGG + Intergenic
1141683379 16:85556644-85556666 CGCCGCGGCGGCGGAGCGAGCGG + Intergenic
1141727402 16:85799151-85799173 CGCCGGGGCCGCCCAGGGGGAGG + Exonic
1142336136 16:89490490-89490512 AGGCGCCGCCGCCGAGCCCGCGG - Exonic
1142592507 17:1012556-1012578 ATCTGCCACCGCCGAGCGGGGGG + Intronic
1142610825 17:1108634-1108656 CGCCGCCTCCCTGGAGCGGGTGG - Intronic
1142762421 17:2050232-2050254 GGCCGCCGCCGCCGCGCCCGGGG - Intergenic
1142764326 17:2057101-2057123 CGCCGCCGCCGCCCCGCAGGTGG - Exonic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1142859952 17:2755522-2755544 CGCCGGCCCCGCAGAACGGGCGG - Intergenic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1144185137 17:12789727-12789749 TGCCGCCGCCGTCGCCCGGGAGG + Exonic
1144339970 17:14302681-14302703 CGGCGCCTCCGCCTGGCGGGCGG + Intronic
1144910025 17:18672932-18672954 CCCAGCCGCGGCCGGGCGGGCGG - Intronic
1145327706 17:21844356-21844378 CGCCGCCGCCGCTCTGAGGGCGG + Intergenic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1147393008 17:40121875-40121897 GGCCGCCGCCGCCTCGAGGGGGG - Intergenic
1148060134 17:44830327-44830349 CGCCGCGGCCCGGGAGCGGGGGG + Intronic
1148262312 17:46193824-46193846 GGCCGGCGCCGCGGAGCGAGAGG + Intronic
1148440416 17:47709022-47709044 CGCCGCCCCCGCCGGGCGAGAGG + Exonic
1148698631 17:49575659-49575681 CGCCGCCGCCGCCGGTGGGAGGG + Intergenic
1148826461 17:50397620-50397642 CGTCGCCGCCGCCGGAGGGGTGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150423169 17:65056599-65056621 CGCCGCCGCCGCCGCCTCGGCGG + Exonic
1150423288 17:65056952-65056974 CGCAGCCGCGGCCGGGCGCGCGG + Intergenic
1150791921 17:68205840-68205862 CGCCGCCGCCGCCTAGGTTGAGG + Intergenic
1151797151 17:76353893-76353915 CGCCGCCGCCTCAGAGCCAGAGG + Exonic
1151838690 17:76601697-76601719 CGCCTCCGCCTCCCAGTGGGTGG + Intergenic
1151919144 17:77140862-77140884 CGCGGCCGCGGCCGAGGGAGCGG - Intronic
1152663178 17:81552362-81552384 CGGAGCCGCCGCCGCGCGGCCGG - Exonic
1152708890 17:81860402-81860424 CGCCGACGCCCCCGAGGAGGAGG - Exonic
1153238923 18:3013379-3013401 CGCCCCCGCCGCCGAGCGCCAGG + Intergenic
1154377936 18:13824151-13824173 AGCCGCAGCCGCCTAGCTGGGGG + Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1156088810 18:33440756-33440778 CGCCGCCGCCGCCGCCCCCGCGG - Intronic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157849005 18:51030358-51030380 CTCCGCGGCCGCCCAGGGGGTGG + Exonic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1158976633 18:62716159-62716181 CGACGCCGAGGCCGAGCAGGAGG - Exonic
1159040680 18:63320398-63320420 CGCGGGCGCAGCGGAGCGGGCGG - Intergenic
1159040702 18:63320455-63320477 CCGCGCCGCGGCCGCGCGGGAGG - Intergenic
1160204673 18:76822794-76822816 CGCCGCCGCCGCCGACTGGCCGG + Intronic
1160765669 19:806450-806472 TGCCGCCGCCGCCGAGGGGATGG - Exonic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160853506 19:1205934-1205956 CGCCGCGGCCGCCGCGCGTGTGG - Intronic
1160865519 19:1254301-1254323 CGCCGCCGCTGCTGCGCGGGGGG + Exonic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161022109 19:2015472-2015494 GGCCGCGGGCGCGGAGCGGGCGG - Exonic
1161029514 19:2051185-2051207 CGCCGCCGCCGCCGCCAGCGCGG + Exonic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161172429 19:2819758-2819780 CAGCGCCGCCTCCGGGCGGGCGG - Intergenic
1161400678 19:4065400-4065422 CGCCGCCTCGCCCGCGCGGGGGG + Intronic
1161438819 19:4279338-4279360 CCCCGCCGCCGCCGGGAGGTGGG - Exonic
1161628764 19:5340883-5340905 CGCCGCCGCCGCCGCCGGGTCGG + Intergenic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1162486018 19:10961049-10961071 CGCCGCCGCCGCCAAACGAGGGG - Exonic
1163121933 19:15223529-15223551 CGCGGCCGCCGGCGGGAGGGAGG - Intergenic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163592744 19:18203677-18203699 CCCCTCCGCCGCAGAGCAGGGGG + Intronic
1163662997 19:18589560-18589582 CTTCGCCGCCGCCTCGCGGGAGG + Exonic
1163714643 19:18866688-18866710 CGCCGCCGCGGGCCAGCAGGGGG - Exonic
1164658542 19:29942329-29942351 CGCCGCCGCCGCCCCGCAGCGGG - Exonic
1165065399 19:33225601-33225623 CCCCGGCGCCTCGGAGCGGGTGG - Exonic
1165080116 19:33302105-33302127 CGCCGCCGCCGCCGCCCGTGGGG + Exonic
1165803181 19:38565368-38565390 CGCCGCCGCCCCCGCGCCAGCGG - Exonic
1165924951 19:39320958-39320980 CGCCACCGCCGCCGCAAGGGGGG + Intergenic
1166317982 19:41999208-41999230 CGCCGGCGCCGACGCCCGGGCGG - Exonic
1167859272 19:52269975-52269997 CGCCGCAGCCGCCATTCGGGAGG + Intronic
1168073069 19:53963337-53963359 CGCCGCCGCCCCCGCGGTGGGGG - Exonic
1168336504 19:55600298-55600320 CCTCGCCGCCGCCGAGGGGCAGG + Intronic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
927558029 2:24049730-24049752 CGCCGCCACTGCAGAGCCGGAGG - Exonic
929151221 2:38750905-38750927 GGCAGCCGCCGCCGAGGGCGGGG + Intronic
929857891 2:45651398-45651420 CGCCGGAGCCGGCGATCGGGAGG - Intronic
930700739 2:54456458-54456480 CCCGGCCGCCGAGGAGCGGGAGG + Exonic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931309597 2:61065877-61065899 CGCAGCCGCCTGCAAGCGGGCGG + Intronic
931355850 2:61537504-61537526 CGGCGGCGCGGCCGGGCGGGCGG - Intronic
932567688 2:72919982-72920004 GGCCGCCGCGGCCGAGGGGCTGG + Intronic
934588588 2:95526931-95526953 CGCCGCCCCCGCCCCGCGGACGG + Intergenic
935196643 2:100820239-100820261 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
936038394 2:109129978-109130000 CCCCGCCGCCCGCGAGCGTGGGG - Exonic
936126695 2:109794575-109794597 CGCCGCCGCCGCCCCCCGGCCGG - Intronic
937045132 2:118847102-118847124 CGCCGCCGCCGCCGCGCCGAGGG + Exonic
937284564 2:120741842-120741864 GGCCGCCGCCGGCGAGTGGCGGG + Intronic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
940639917 2:156334314-156334336 CCCAGCCGCCGGCGAGCTGGGGG - Intronic
941111688 2:161423882-161423904 CGCCGCGGCCGCCGCGCGCATGG + Exonic
941951350 2:171160336-171160358 GGCCGCCGCCGCCGAGCCCGGGG + Exonic
942046146 2:172100572-172100594 CGCCCCCGCCGCCGTGATGGTGG + Exonic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942278191 2:174337440-174337462 CGCCGCTGCCGCCGCCCGGGCGG - Exonic
942346215 2:175005257-175005279 CGCCGCCGCCGCCGCCAGTGCGG - Intronic
942448371 2:176092970-176092992 CGCCGCCGCCACCGATGAGGAGG - Exonic
942450932 2:176107669-176107691 CGCCGCCGCCGCCGCGTAGTAGG - Exonic
942461528 2:176171785-176171807 CAGCGGCGCCGCCGAGCGGTGGG - Exonic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
944743665 2:202635346-202635368 CGCCGCCGCCGCTCCGCGTGGGG - Exonic
944743682 2:202635412-202635434 CGCCGCCGCCGCCGCCTGCGGGG - Exonic
947418566 2:229921951-229921973 CGCCGCCGCCGCGCCGCTGGGGG - Exonic
947418570 2:229921954-229921976 AGCCGCCGCCGCCGCGCCGCTGG - Exonic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
949052153 2:241903150-241903172 TGCCGGTGCAGCCGAGCGGGCGG - Intergenic
1169065561 20:2692797-2692819 CGCCGCCGCCGCCGCTCCCGGGG - Intergenic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1171011503 20:21511861-21511883 CGCCGCCACCGCCGCCGGGGTGG + Exonic
1171034717 20:21705889-21705911 CGCCGCCGCCGCCGCGTGAGAGG - Exonic
1171473562 20:25390617-25390639 CGCCGCGGCGGCCGAGCCGGAGG + Exonic
1172274958 20:33674360-33674382 CGCAGCCGAGCCCGAGCGGGTGG - Exonic
1172474528 20:35226884-35226906 CGCCGCCGCCGCCGCCCGCGCGG - Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1172841035 20:37903010-37903032 CGCCGCCTGCTCCGAGCGGGAGG + Intergenic
1172983454 20:38962524-38962546 CGCTGCCGCCTCTGTGCGGGGGG + Intronic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173729085 20:45316470-45316492 CGCCCCCGCCGCTCAGCTGGGGG - Exonic
1175429262 20:58890969-58890991 CGCGGGCGCCGCCGAGGGGCTGG - Intronic
1175962097 20:62642436-62642458 CGCCCCCGCCGCAGAGGGAGGGG - Exonic
1176068919 20:63216010-63216032 AGCCGCCGCCGCCGCCCGGCCGG - Exonic
1176145606 20:63564054-63564076 TGCCCCCGCCGCCGTGCAGGTGG + Exonic
1176380694 21:6111021-6111043 CCCCGCCCCCGCCGCCCGGGCGG - Intergenic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178513827 21:33229894-33229916 CGCCCCCGCCCCCGCGCCGGCGG + Intronic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178992450 21:37367039-37367061 TGCCGCCGCCGGCGAGCAGGCGG + Intronic
1179561595 21:42219239-42219261 CGCCGCCGCCGCCGCCCCCGGGG + Exonic
1179742778 21:43427219-43427241 CCCCGCCCCCGCCGCCCGGGCGG + Intergenic
1180960709 22:19761110-19761132 CAGCGCCGCCGCCGAGCCCGAGG + Exonic
1181299220 22:21867547-21867569 AGCCGCCGACGCTGACCGGGAGG + Exonic
1181669659 22:24420267-24420289 CCCCGCCGCCGCCGGGCCTGAGG + Intronic
1182586281 22:31345948-31345970 CGCCGGCGCCGCCTGGCGGGCGG - Exonic
1184557388 22:45240739-45240761 CGCCGCCGCCCCCGAGCCTGCGG - Intronic
1184747288 22:46463739-46463761 CGCTGCCGCAGCCGCGAGGGCGG - Exonic
1184766949 22:46577127-46577149 CGCCGCCGCCTCCGCGCTCGTGG + Intronic
1185290806 22:50026405-50026427 CGCCGCCACCTCAGAGCGGAGGG + Intronic
1185290826 22:50026515-50026537 CGCCGCCACCTCAGAGCGGAGGG + Intronic
1185409439 22:50674438-50674460 CGCCGCCGCCGCCGCCCCTGCGG + Intergenic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
949970248 3:9397678-9397700 CGCCGCCGCTGCCGGGGGAGGGG + Intronic
950007992 3:9703885-9703907 CGCCGCCGCCGCCGACACCGCGG + Exonic
951881403 3:27484199-27484221 TGCCGCCGCCGCCGAGCCCCCGG + Intronic
951907893 3:27721907-27721929 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
952241225 3:31532941-31532963 CGCCGCCGCCGCCTGGTGCGAGG - Exonic
952287242 3:31981036-31981058 CCCGGCCGCCGCCGACCGGCTGG + Exonic
953989871 3:47475813-47475835 CGCCGCCGCCGCAGCTTGGGAGG - Exonic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
955387636 3:58492155-58492177 CGCCGCCGCCGCGCAGTGAGTGG + Intronic
956978972 3:74614603-74614625 CGCCGCCGCCGCCAAGCGCCAGG + Intergenic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
961545296 3:127629139-127629161 CGCCGCCGCCGCCGCCCGCGCGG + Intergenic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
962367459 3:134795828-134795850 CTCGGCCGCTGCCGAGCGCGGGG + Intronic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
963236722 3:142963611-142963633 CGCCGCTGCCGCAGCGCGGGCGG - Exonic
964451525 3:156817130-156817152 GGCGGCCGTCGCCGGGCGGGAGG + Intergenic
966362832 3:179148533-179148555 CGCCGCCGCCGCCGCCCGCGGGG + Exonic
966915830 3:184583718-184583740 CGCCGCCGCAGCCGGCCCGGGGG + Intronic
967849546 3:194071412-194071434 CTCCGCCCCCGCCGGGCGTGGGG - Intergenic
968642493 4:1721587-1721609 CGCCGCCGCCGCCAGGAAGGAGG - Exonic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
968965146 4:3765922-3765944 CGCCGCCGCCGCCCTGCGCTGGG - Intergenic
969716911 4:8872108-8872130 CCCCGCCCCCACGGAGCGGGTGG - Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333151 4:15004226-15004248 CGCAGCAGCCGCAGAGCCGGAGG + Exonic
970824168 4:20253039-20253061 CGCCAAGGACGCCGAGCGGGAGG + Intergenic
973137311 4:46724414-46724436 CGCCGCCGCGGCCCAGCGAGCGG - Intergenic
973293259 4:48490446-48490468 GGCCGCGCCCGCCGAGCAGGGGG - Exonic
974047246 4:56908259-56908281 CGCCACTGCCGCCGCCCGGGCGG - Intronic
975118764 4:70705790-70705812 CGCCGCCGCCGCCGCCAGTGCGG + Intronic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
975986236 4:80203145-80203167 GGCCGCCGCCGCCGCTCGGCAGG - Exonic
976431240 4:84965999-84966021 AGCCGCCGCCGCCGCCAGGGTGG - Intronic
978072541 4:104491325-104491347 CGCCGCCACCGCCGGCGGGGAGG + Exonic
981528855 4:145733344-145733366 CGTCGCCCCCGCGGAGCGCGCGG + Intronic
982745859 4:159103583-159103605 CGCCTCGGCCGCCGGTCGGGAGG - Intergenic
984462989 4:180059155-180059177 CGCCGCCGCGGCCGGGCGCAGGG - Intergenic
984888760 4:184473563-184473585 CGCCGCCGCCGCCGCTCAGAAGG - Intronic
985014903 4:185623708-185623730 CCTCGCCGGCCCCGAGCGGGGGG + Exonic
985451409 4:190065659-190065681 CGCCTCCGCCTCCGCGCGGCAGG + Intergenic
985452398 4:190068951-190068973 CGCCTCCGCCTCCGCGCGGCAGG + Intergenic
985453383 4:190072248-190072270 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985454373 4:190075541-190075563 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985455361 4:190078834-190078856 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985457333 4:190085428-190085450 CGCCTCCGCCTCCGCGCGGCAGG + Intergenic
985458320 4:190088721-190088743 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985459309 4:190092021-190092043 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985463561 4:190174790-190174812 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
986330751 5:6714400-6714422 CGCCGCGGCCGCCGCCCGGCCGG - Intergenic
986402788 5:7396046-7396068 CGCCACCGCCACCGCGCGGGAGG - Intergenic
986858799 5:11903701-11903723 CGCCGCCGCCGCCTGCCGGCCGG + Intronic
986858970 5:11904312-11904334 CGCCTCAGCCGCCGAGGGCGAGG + Intergenic
987132348 5:14871572-14871594 AGCCGCCGCCGCCGCGCCCGAGG - Exonic
988547696 5:32173950-32173972 CGCCGCCGACAAGGAGCGGGCGG - Exonic
988577840 5:32444249-32444271 CGCCGCCGCCGCCCCGCTGTGGG + Exonic
989229989 5:39074476-39074498 CGCCGTCGCCGCCGAGGGGGCGG - Intergenic
989584865 5:43066826-43066848 CGCCAGCAGCGCCGAGCGGGGGG - Intronic
990381875 5:55227160-55227182 GGCCGCCGCCTCCGAGCAGTCGG - Exonic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992042290 5:72848139-72848161 CGCCGCGGCCGCCGAGCGCAAGG - Intronic
992105506 5:73447166-73447188 CGCCGCCACCGGCGAGGGCGAGG + Exonic
992627632 5:78649066-78649088 CGCCGCCGCCGCTGCCCGGCGGG - Intronic
995224708 5:109689791-109689813 CGCCGCCGCCGCCGACGCTGCGG - Exonic
999696272 5:154190778-154190800 TGCTGCCGCCGCCGGGCGGACGG + Exonic
1000220521 5:159209541-159209563 CGCGGCCGCCGCAGAGCGCCGGG - Intronic
1000302892 5:159972055-159972077 CGCCGCCGCCGTCGCCTGGGCGG + Exonic
1002058069 5:176610053-176610075 CGCCGCCGCCGCCGCCCGAGCGG + Exonic
1004229104 6:13814666-13814688 CGCCGCCGTCGCCTAGCGAATGG - Intergenic
1004614900 6:17280870-17280892 CGCCGCCGCCCCCCAGCTGTTGG - Intergenic
1004864278 6:19837867-19837889 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
1005040281 6:21594969-21594991 CGCCGCCTCCTCCAAGCCGGGGG + Exonic
1005303776 6:24495063-24495085 CGCCTCCGCCCCCGCGCCGGCGG + Exonic
1005320199 6:24646054-24646076 CGCCGCCGCCGCTCTGCGCGGGG + Exonic
1005895204 6:30172013-30172035 CGCCGCCGTCGCCCAGCTGCAGG - Exonic
1005912996 6:30327009-30327031 CGCCGCCGCGCCCGAGCCTGGGG + Intronic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006396251 6:33789177-33789199 CGCAGGCGCGGCGGAGCGGGCGG + Intergenic
1006458591 6:34145295-34145317 CGGAGCCGCCGCCAAGCGCGCGG + Intronic
1006472506 6:34236739-34236761 CGCCGCCGCTGCCGCGCGGGTGG - Intergenic
1006472739 6:34237540-34237562 CGCCGCGGGCGCCCTGCGGGGGG + Intronic
1008649063 6:53544939-53544961 CGCCGCCGCATCGGAGCGGGAGG - Exonic
1009396980 6:63211531-63211553 GGCGGCCGACGCCGAGCGGGCGG - Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1012895327 6:104940728-104940750 CGCCGCCGCAGCCCGGCGAGTGG - Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1014755892 6:125301807-125301829 GGAGGCCGCGGCCGAGCGGGCGG - Intronic
1014947493 6:127515670-127515692 CGCCGCCGCCGCCATTGGGGAGG + Exonic
1014947581 6:127516027-127516049 AGCCGCCGCCGCCCAGGGGCTGG - Exonic
1015148923 6:130018504-130018526 CGCCGCCGCCGCTGCCGGGGAGG - Exonic
1015149345 6:130020222-130020244 CGCCGCGGCGGCGGGGCGGGGGG + Intronic
1015799205 6:137044233-137044255 CACCGCCGCGGCCGCGCGGAGGG - Intronic
1016923214 6:149317061-149317083 GGCCGGCGGCGCCGCGCGGGTGG - Intronic
1017163879 6:151390638-151390660 CGCCCCCGCCCGCGAGCGGGAGG + Intronic
1017662437 6:156687483-156687505 CGCCGCGCTCGCCGAGCCGGAGG - Intergenic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1017672366 6:156779110-156779132 GCCCCCCGCCGCCGAGCCGGCGG - Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1018400491 6:163415138-163415160 CGCCGCCGCCGCCGCCGGAGAGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019536129 7:1530785-1530807 CGCCGCCGCCGCCTGGCGCTCGG - Exonic
1019562634 7:1666080-1666102 CGCCGCCGCCGCCGCGCTCGGGG + Intergenic
1020035017 7:4959309-4959331 CGCCGCCTCCGCTGAGGTGGAGG + Intergenic
1020238529 7:6374708-6374730 CGCCGCCGCGGCCCAGCGAGCGG + Exonic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1022375229 7:29806426-29806448 AGCCGCCGCCGCCCCGCGGCAGG - Intergenic
1022715065 7:32891599-32891621 CGCCCCCGCCGCCGCGCCGGAGG - Exonic
1023382678 7:39623867-39623889 CACCCCCGCCGCCGCCCGGGTGG - Intronic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1028373429 7:90119627-90119649 CGCCTCCGCCCCGGAGCCGGAGG + Intergenic
1029362991 7:100100716-100100738 CTCCGCGGCCGCCGCGCGGAAGG + Intronic
1029390753 7:100272328-100272350 TGCTGCCGCCGCCGGGCGGCCGG + Intergenic
1029561064 7:101303196-101303218 AGCCGCCGCCGCCCAGCTGAGGG + Intergenic
1029640255 7:101815897-101815919 CGCCGCCGCCACCGAGGACGCGG - Intronic
1029701384 7:102248790-102248812 CTCAGCCGCCGCCGCGCCGGGGG + Exonic
1031052060 7:116954148-116954170 GGCCTCCGCGGCCGGGCGGGAGG - Intronic
1031629852 7:124033039-124033061 CGCCGCCGCTGCCGGGTGCGCGG + Intergenic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032306232 7:130734191-130734213 CGCTGCCGCCGCCGCCCGCGCGG + Intergenic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034128922 7:148698598-148698620 CGCCGGCAGCGGCGAGCGGGCGG + Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035022754 7:155808876-155808898 CGCCCCCGCCCCCGCGCTGGGGG - Intronic
1035553012 8:544649-544671 CGCCGCCGCCGCCCAGGCGCAGG - Exonic
1036723726 8:11201066-11201088 CAGCGCCGCCGCCGACGGGGGGG - Exonic
1037535222 8:19817431-19817453 CGCCGCCGCCACCGCGGGGGAGG - Exonic
1038304039 8:26383290-26383312 CGCCACCGGCGCGGCGCGGGAGG + Intronic
1039620861 8:38996280-38996302 CGCTGGCGCCGCCCAGCCGGAGG - Exonic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1040055732 8:43055886-43055908 CGCCGCGGCCTCCGAGCGGCTGG + Intronic
1040065594 8:43141297-43141319 CGCCGCCGCCGCCGCCTGGGAGG + Intronic
1041107589 8:54458072-54458094 CGCCGCCTCCCCCGACCCGGGGG - Exonic
1041489059 8:58411438-58411460 GGCCGCGGCCTCCGAGCGCGCGG + Exonic
1041690082 8:60679352-60679374 CCCCGCCGCCGCCGGCCCGGCGG - Intronic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1043388251 8:79768307-79768329 CGCCGCCGCCGCCGCCAGCGCGG - Intergenic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1045305180 8:100951815-100951837 CGCCGCCACCGCGGGGCGAGTGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045674067 8:104588986-104589008 CGCCGCCGCCGCCGAGCCACCGG + Exonic
1046094353 8:109539881-109539903 CGGAGCCTCCGCCGGGCGGGCGG + Intronic
1046103903 8:109644688-109644710 CGCCGCTGCCGCCGTCCAGGAGG + Exonic
1047998401 8:130357958-130357980 CGCTGCCGCCGCGCAGCTGGAGG - Intronic
1047998403 8:130357961-130357983 CGCCGCTGCCGCCGCGCAGCTGG - Intronic
1049570570 8:143368595-143368617 CGCGGCGGCCGCTGAGCGTGCGG - Intergenic
1049707939 8:144051436-144051458 AGCCACCGCCGCCGGGCGTGTGG + Exonic
1049762692 8:144338198-144338220 CGCCGCACCCCCCGCGCGGGCGG - Intergenic
1049784651 8:144444568-144444590 CGCCGCCGCCGTCGAGGGGCGGG - Intergenic
1049788486 8:144462529-144462551 CGCCGCCGCCGCCTGCCCGGCGG + Intronic
1052494689 9:29212328-29212350 AGCGGGCGCCGCGGAGCGGGTGG - Intergenic
1052888841 9:33677024-33677046 CGCCGCCGCCGCCGTGTTGGAGG + Intergenic
1053072932 9:35111617-35111639 CGTGGCCGCCGCGGCGCGGGTGG - Intronic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053306213 9:36986351-36986373 CCCCGCCGCGGCCGCGCCGGCGG + Intronic
1053434998 9:38068686-38068708 CGCCGCCGCGGCCATTCGGGGGG + Exonic
1053815034 9:41898818-41898840 CGCCGCCCCCGCCGCGCAGCGGG + Exonic
1054615562 9:67288623-67288645 CGCCGCCCCCGCCGCGCAGCGGG - Intergenic
1055501416 9:76906086-76906108 CGCAGCCGCCTCAGAGCGGCAGG - Exonic
1055611782 9:78031594-78031616 CGCCGCCGCCGCCGCCTGCGAGG + Intergenic
1056470752 9:86902888-86902910 CTCCACCGCCGCCGAGCCCGGGG + Intergenic
1057313011 9:93953315-93953337 CGCCACCGGCGCCGACCGGCAGG - Intronic
1057313424 9:93955166-93955188 CGCCGCCGCCGCCAAACCGCGGG - Exonic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1058053289 9:100427260-100427282 CGCCGCCGCCGCCCGGCGTTCGG + Intronic
1058861211 9:109119445-109119467 GGCCGCCGGCGCCGAGCAGCAGG + Exonic
1060952328 9:127612206-127612228 CCCCGCCGCCGGCGCGCGCGGGG - Intergenic
1061072991 9:128323103-128323125 CGCCATCGCCGCGGAGCCGGCGG - Exonic
1061196662 9:129110569-129110591 CGCCGCCGCCGCCGCGGCTGGGG + Exonic
1061802763 9:133121185-133121207 CGCCGCCCCCGCCGCGCGCCGGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062230553 9:135479707-135479729 CGCCGCCGCCACCGTCCGGTAGG + Intronic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1186638130 X:11427754-11427776 CGCTGCCGCTGCGGAGCCGGTGG + Intronic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1188005516 X:25013593-25013615 CGCCGCCACCGCCAACCGCGCGG - Exonic
1189821471 X:44873334-44873356 AGCCGCCGCTGCCGACCCGGGGG + Intronic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1190598383 X:52067560-52067582 CGCCGCCGCCTCCAACCGTGCGG - Exonic
1190610441 X:52186513-52186535 CGCCGCCGCCTCCAACCGTGCGG + Exonic
1192561499 X:72130976-72130998 CCCCGGGGGCGCCGAGCGGGTGG - Exonic
1195138209 X:101931895-101931917 CGCCGCCGCTGCCGCGCAGGCGG + Intronic
1195954799 X:110317834-110317856 CGCCGCCGCCGCAGCCCTGGGGG + Exonic
1196684026 X:118495708-118495730 CGCCGCCGACGCCGTGGGGCAGG + Intergenic
1196707399 X:118727862-118727884 AGCCGCAGCCGCCGAGCGCGGGG - Intronic
1197754026 X:129982732-129982754 CGCCGCCGCCGCCGAGAGAGAGG + Intronic
1199772595 X:150984036-150984058 CGGCGGCGGCGCCGGGCGGGCGG - Intronic
1200068744 X:153517677-153517699 CGCCGCCGGTGCAGAGCGTGGGG + Intronic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic
1200128764 X:153830210-153830232 CGCCCCCGCCGCAGCGCCGGCGG + Intronic
1200277778 X:154750884-154750906 CCCCGCGGCCGCCCCGCGGGCGG + Intronic