ID: 1160873261

View in Genome Browser
Species Human (GRCh38)
Location 19:1286400-1286422
Sequence CCCACGCGCGCGCCGCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 5, 3: 43, 4: 269}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160873237_1160873261 30 Left 1160873237 19:1286347-1286369 CCAACGCCCCCCAAGCCGCGCCC 0: 1
1: 0
2: 1
3: 29
4: 344
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873239_1160873261 24 Left 1160873239 19:1286353-1286375 CCCCCCAAGCCGCGCCCGGCCTC 0: 1
1: 0
2: 6
3: 25
4: 282
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873243_1160873261 20 Left 1160873243 19:1286357-1286379 CCAAGCCGCGCCCGGCCTCGCGC 0: 1
1: 0
2: 1
3: 41
4: 353
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873251_1160873261 -2 Left 1160873251 19:1286379-1286401 CCCCCGGAGCTCCGGGCGCCCCC 0: 1
1: 0
2: 3
3: 24
4: 269
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873249_1160873261 5 Left 1160873249 19:1286372-1286394 CCTCGCGCCCCCGGAGCTCCGGG 0: 1
1: 0
2: 3
3: 29
4: 370
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873240_1160873261 23 Left 1160873240 19:1286354-1286376 CCCCCAAGCCGCGCCCGGCCTCG 0: 1
1: 0
2: 6
3: 26
4: 240
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873252_1160873261 -3 Left 1160873252 19:1286380-1286402 CCCCGGAGCTCCGGGCGCCCCCC 0: 1
1: 0
2: 2
3: 26
4: 278
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873253_1160873261 -4 Left 1160873253 19:1286381-1286403 CCCGGAGCTCCGGGCGCCCCCCA 0: 1
1: 0
2: 3
3: 19
4: 303
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873254_1160873261 -5 Left 1160873254 19:1286382-1286404 CCGGAGCTCCGGGCGCCCCCCAC 0: 1
1: 0
2: 4
3: 23
4: 292
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873242_1160873261 21 Left 1160873242 19:1286356-1286378 CCCAAGCCGCGCCCGGCCTCGCG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873244_1160873261 15 Left 1160873244 19:1286362-1286384 CCGCGCCCGGCCTCGCGCCCCCG 0: 1
1: 2
2: 13
3: 125
4: 1031
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873246_1160873261 10 Left 1160873246 19:1286367-1286389 CCCGGCCTCGCGCCCCCGGAGCT 0: 1
1: 0
2: 2
3: 25
4: 281
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873247_1160873261 9 Left 1160873247 19:1286368-1286390 CCGGCCTCGCGCCCCCGGAGCTC 0: 1
1: 0
2: 5
3: 27
4: 284
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269
1160873241_1160873261 22 Left 1160873241 19:1286355-1286377 CCCCAAGCCGCGCCCGGCCTCGC 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG 0: 1
1: 1
2: 5
3: 43
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160873261 Original CRISPR CCCACGCGCGCGCCGCCGCC GGG Intronic
900233383 1:1574355-1574377 CCCACGAGCGCGGCCCGGCCCGG + Intronic
900310046 1:2029235-2029257 CCCTGGCGGGCACCGCCGCCTGG - Exonic
900344839 1:2205654-2205676 GCCACGAGCGCGTCGCCGCACGG + Intronic
900349670 1:2228500-2228522 GCGCCGCGCCCGCCGCCGCCCGG - Intergenic
901019789 1:6249799-6249821 GTCCCGCGCGCGCCGCCGCTCGG - Exonic
901420033 1:9144689-9144711 CCACCGCGCGCGGCCCCGCCAGG - Intergenic
901425953 1:9182561-9182583 CCCTCGCCCACGCCGCCGCTGGG + Intergenic
901540175 1:9910362-9910384 CCCACGCGCCCGCCTCCCTCCGG - Intergenic
903233934 1:21937494-21937516 CCTCCGCGCGGGCCGCGGCCCGG + Intergenic
903384646 1:22918399-22918421 CCCGCACGCCCGCCCCCGCCAGG - Intergenic
903750223 1:25616838-25616860 CACACGCGCGCACAGCCACCCGG - Intergenic
904610854 1:31725516-31725538 CCCAGGAGCGCGCTGCCGCAAGG - Intergenic
904724919 1:32539783-32539805 CCCGCGCCCGCCTCGCCGCCCGG + Intronic
905449514 1:38047335-38047357 GCCTCGCGCTCGCAGCCGCCAGG - Intergenic
905647199 1:39633020-39633042 CCCTCGCCCGCCCCGCCCCCGGG - Intronic
905867134 1:41382452-41382474 CCTACGCTGCCGCCGCCGCCGGG + Exonic
905912100 1:41662233-41662255 CCCGCGCGCTCGGCTCCGCCCGG + Intronic
910773383 1:90851574-90851596 ACCACGCGCGGGCTCCCGCCGGG + Intergenic
913161873 1:116152353-116152375 CCCACACGCGCTCTGCAGCCTGG + Intergenic
917920132 1:179743884-179743906 GCCTCGCGCCCGCCGCCACCCGG + Intronic
919724531 1:200873231-200873253 CCGCCGCGGGCCCCGCCGCCCGG - Exonic
920556752 1:206909738-206909760 TCCACGAGCGCGCCGCGGGCAGG + Exonic
922416602 1:225428022-225428044 TCCACGCGCGCGACGCTACCCGG + Intronic
923490412 1:234478911-234478933 CCACCTCGCGCGCCGCCTCCGGG + Exonic
924090103 1:240492922-240492944 CCCGCGCGCGCCCGGCCGCTGGG - Exonic
1063115128 10:3067488-3067510 GCCCCGCCCGCGCCCCCGCCCGG - Intronic
1064209115 10:13348211-13348233 CCCCCGCGCGCCCAGCCGGCGGG - Exonic
1065188927 10:23193236-23193258 CCCAGGCGCCCGCCGCCGCCCGG - Exonic
1070800835 10:79243559-79243581 CCCGCGCCGCCGCCGCCGCCGGG + Intronic
1071086830 10:81875254-81875276 CCCGCGCCCGCGCCCGCGCCCGG + Intergenic
1072089637 10:92115042-92115064 CCCCCGCGCCCGCGGCCGCCGGG - Intronic
1074503343 10:114044973-114044995 CCCGCGCCCGCGCCGCCGCCCGG + Exonic
1074721753 10:116271176-116271198 CCCGGGCGCGCGCCCTCGCCCGG - Intronic
1075801828 10:125159338-125159360 CCTCCTCGCCCGCCGCCGCCGGG - Intronic
1076035654 10:127196637-127196659 CCCACGCACGCGGCCCGGCCCGG - Intronic
1077250235 11:1557596-1557618 CCCAGGCGCCCGCCGGGGCCAGG + Intronic
1081636894 11:44727351-44727373 CCCCCCCGCGCGCCGCCCCGGGG + Intronic
1081831473 11:46119884-46119906 CCCCCGCCCGCGCCCCCGCCGGG - Intronic
1083207546 11:61161590-61161612 CACACACGCTCGCGGCCGCCCGG + Exonic
1083572588 11:63768440-63768462 CCCACGCCGGGGCCCCCGCCCGG + Intronic
1085011252 11:73142727-73142749 CCCACGTGCGCGCCCCCGAGCGG - Intergenic
1085284575 11:75351550-75351572 CCCACGCGCCCCCCGCCGGGCGG + Intronic
1091113638 11:132994226-132994248 CTCCCGCGCGCGCCGGCTCCTGG - Intronic
1094199271 12:27780249-27780271 CCTACGCGCGCGCCGGTTCCGGG - Exonic
1096222921 12:49843251-49843273 CCCAGGCGCTCGCCGGCTCCAGG - Intergenic
1096771617 12:53939200-53939222 CACACTGGCGCGCCGCCTCCGGG - Exonic
1101102478 12:101407758-101407780 CCCTCGCTCCCGCCCCCGCCTGG - Exonic
1102101295 12:110281060-110281082 CCCTCCCGCGCGCCGCCCCTAGG - Intronic
1102457091 12:113077662-113077684 CCGCCGCCTGCGCCGCCGCCTGG + Exonic
1103595506 12:122022425-122022447 CCCCGGCGCCCGCCGCCTCCGGG - Intronic
1103856007 12:123972226-123972248 CCCCCGCGCCCGCCCCCGCGGGG - Intronic
1105243659 13:18628852-18628874 CCCAGGCGGCCGCCGCCGCCAGG + Intergenic
1105512408 13:21061467-21061489 TCCACGCCACCGCCGCCGCCCGG - Exonic
1106735652 13:32586233-32586255 CACACGGGCACGCCGCCGCGGGG - Intergenic
1113200998 13:107867342-107867364 CGCCCGCGGGCGCCGCCGCCGGG + Intergenic
1113312035 13:109140998-109141020 CCCCCGCCCCCGCCCCCGCCCGG + Exonic
1113962235 13:114132519-114132541 CCCAAGCGCGCGCCGAGCCCGGG + Exonic
1117478308 14:56118760-56118782 TCCCCGCCCGCGCCGCTGCCCGG - Intronic
1117478347 14:56118875-56118897 CCCGCCCCCGCGCCGCCGTCCGG - Intronic
1117978737 14:61321820-61321842 TCCAAGCGCGCGGCGCCTCCCGG - Exonic
1118854583 14:69611437-69611459 TGCACGCACGCGCCGCCGGCCGG - Intergenic
1119539131 14:75427668-75427690 ACCCCCCGCGCACCGCCGCCCGG - Intergenic
1120788035 14:88554757-88554779 CCCATGAGCGCGCCGCGGCCCGG - Intergenic
1120914802 14:89701686-89701708 CCCGCTGGCGCGCCGGCGCCGGG - Intergenic
1121342791 14:93115405-93115427 CCCACGCCCCCGCCGCCTGCGGG + Intronic
1122208471 14:100159943-100159965 CCCACCCGCGGGCAGCCGTCGGG + Exonic
1123487636 15:20755779-20755801 CCCGGGCGGCCGCCGCCGCCAGG - Intergenic
1123544128 15:21324837-21324859 CCCGGGCGGCCGCCGCCGCCAGG - Intergenic
1126786206 15:52179644-52179666 GCCAGGCCCGCGCCACCGCCCGG - Intronic
1127480304 15:59371965-59371987 CCCGCCCGCGTGCCGCTGCCAGG + Intronic
1129260825 15:74366167-74366189 TCCCAGCGCACGCCGCCGCCCGG - Intronic
1129424647 15:75454747-75454769 CCCCCGACCGTGCCGCCGCCGGG - Intronic
1129763976 15:78149501-78149523 CCCACGCGCCCGCCCACACCCGG - Intronic
1130224567 15:82047018-82047040 CGCACGCCCGCGCCGCCCGCTGG - Intergenic
1130517001 15:84633444-84633466 CCCACGCGCGCCGCACGGCCGGG + Intergenic
1131272660 15:90956683-90956705 CCCCCGGGCCCGCCGCAGCCAGG + Exonic
1132419388 15:101652388-101652410 CCCAGGCGCGCCCCGCCCCCCGG - Intronic
1202952470 15_KI270727v1_random:52110-52132 CCCGGGCGGCCGCCGCCGCCAGG - Intergenic
1132527529 16:425163-425185 GCCAGGCGTGCGCCGCCTCCTGG + Intergenic
1132683721 16:1153777-1153799 CCCCTGGGCGCGCCGCCCCCTGG + Exonic
1132879522 16:2155841-2155863 CTCACCCGCCCGCGGCCGCCCGG - Exonic
1133011023 16:2911967-2911989 ACCGCGCGCGCGACCCCGCCGGG - Intronic
1133021464 16:2968795-2968817 CTCACGCGCCCGCAGCCGTCGGG - Intronic
1133340663 16:5033667-5033689 CGCGCGCGCGCGCCTCCCCCGGG - Exonic
1134529888 16:14975086-14975108 CCCCCGCGCCCGCGGCCGGCGGG - Exonic
1136153763 16:28368508-28368530 CCCACGCGCCCTGCGCAGCCAGG - Intergenic
1136209329 16:28746762-28746784 CCCACGCGCCCTGCGCAGCCAGG + Intergenic
1137617327 16:49855698-49855720 CGCTCGCTCGCGCCTCCGCCGGG + Intronic
1139215897 16:65123586-65123608 CCCGAGCGCCCGCAGCCGCCCGG + Intronic
1139534451 16:67562809-67562831 CCGGCGCCAGCGCCGCCGCCGGG + Intronic
1140462246 16:75148960-75148982 CCCGCGCGCGCGCGCCCGCCGGG - Intronic
1140504876 16:75464837-75464859 CCCACGGACGCGCCCCCTCCTGG + Intronic
1141132319 16:81444846-81444868 CACACGCGCGCGGCGGCGCGGGG + Intergenic
1141608602 16:85169315-85169337 CCTCGGCCCGCGCCGCCGCCGGG + Intergenic
1142619137 17:1154019-1154041 CCCACGCGCCCGCCCCCGAGTGG - Intronic
1142812165 17:2400489-2400511 TCCCCGCGAGAGCCGCCGCCTGG - Intronic
1145059648 17:19724623-19724645 CCCACGCACGTGACACCGCCAGG + Intergenic
1146095947 17:29930275-29930297 CCTCGGCGCGCGCCGCCGCCTGG + Intronic
1146922377 17:36722397-36722419 CCCACCCGCGCACCCCCGCCCGG + Intergenic
1147150328 17:38510444-38510466 CACTCTGGCGCGCCGCCGCCTGG + Exonic
1147184448 17:38705774-38705796 GCCCCGCGCACGCCGCCCCCGGG - Intronic
1147830701 17:43296879-43296901 CCCCCGGGCGCGCCTCTGCCTGG + Intergenic
1148021782 17:44558178-44558200 CTCACCACCGCGCCGCCGCCGGG + Exonic
1149994611 17:61400086-61400108 CCACCGCGCGCGCCGCCGCCCGG + Exonic
1150239940 17:63622914-63622936 CCCGCTCGCGCGCCGCGGCCCGG + Intronic
1150268785 17:63849268-63849290 CACCCTCGCGCGCCCCCGCCTGG + Intergenic
1151783856 17:76265672-76265694 TCCCCGCCCCCGCCGCCGCCCGG - Intronic
1151812548 17:76453021-76453043 CCGAGGCGGGCGCCGGCGCCGGG + Exonic
1152109996 17:78352797-78352819 CCCACGCGCCCAGCGCGGCCTGG + Intergenic
1152175193 17:78782421-78782443 CTCCCGCGCGCGCCGCACCCCGG + Intergenic
1152349690 17:79777924-79777946 CCCCCGCCCCCGCCCCCGCCCGG + Intergenic
1152703870 17:81833112-81833134 CCCCCGCGCCCGGCCCCGCCCGG + Intronic
1152744220 17:82031730-82031752 CGGCCGCGCCCGCCGCCGCCCGG + Exonic
1152748423 17:82051656-82051678 CCCGCGCGCCCGCCCCGGCCCGG - Exonic
1152759075 17:82098844-82098866 CCCACCCGCGCGCCGCCATTGGG - Intergenic
1152781466 17:82228964-82228986 CCCCCGCGCACGTCACCGCCTGG - Intronic
1153238878 18:3013187-3013209 ACCCCGCGCGCGCCCCCGACCGG - Intronic
1153911264 18:9708298-9708320 CCCTCGCTCGCGCCGCCCGCGGG - Exonic
1153935045 18:9913966-9913988 CCTACGTGCGCGCCCCCGGCCGG - Intergenic
1154241567 18:12657983-12658005 CGGCCGCGCGCGCCGCCGCCGGG + Exonic
1154445283 18:14431033-14431055 CCCAGGCGGCCGCCGCCGCCAGG - Intergenic
1157662870 18:49460678-49460700 CCCAGGCGCGCGCGCCAGCCAGG + Exonic
1159798456 18:72869082-72869104 CCCACACCCGCGCCGCGGCTGGG + Intergenic
1160691049 19:460834-460856 CAGCCGCCCGCGCCGCCGCCGGG + Exonic
1160745376 19:708930-708952 CCCCCGCGCCCGCCGCCGCCCGG + Intergenic
1160745436 19:709092-709114 CACCCGCGCCCGCCCCCGCCCGG + Exonic
1160858249 19:1226976-1226998 CCCATGCCCGCGCCGCTTCCAGG + Intronic
1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG + Intronic
1160930596 19:1568015-1568037 CCCCCGCCCCCGCCGCCGTCGGG + Exonic
1160991978 19:1863775-1863797 CCGAGCCGCGCGCGGCCGCCGGG + Intergenic
1161028196 19:2046287-2046309 CTCACGCCCGCCCCGCTGCCCGG - Intronic
1161398000 19:4054810-4054832 CCGACGCGGGCGCCGACGCCGGG - Exonic
1161707234 19:5827845-5827867 CGCACGCGCGCGCCGCCGCCGGG - Exonic
1162046774 19:8005405-8005427 CCCGCGGGCGCCCCGCGGCCAGG + Intronic
1162145552 19:8610824-8610846 CCCGCCCGCCTGCCGCCGCCCGG + Intergenic
1162524097 19:11197532-11197554 TCTTCGCGCGCGCCGCAGCCTGG + Exonic
1162778754 19:12995916-12995938 CCTCCGCCCGCGCCGCCGGCCGG - Intronic
1163513058 19:17747653-17747675 CCCACCCCCGCGACGGCGCCAGG - Intergenic
1163607279 19:18281995-18282017 CCCCCGCCCCCGCCCCCGCCCGG - Intergenic
1165349389 19:35268097-35268119 CCCGCGCCCGCGCCGCCGGCCGG + Intergenic
1166304074 19:41927963-41927985 CCCCCGCGCCCGCCCCCTCCTGG + Intronic
1166888252 19:45973943-45973965 CGCCCGCGCCCGCCGCCCCCCGG - Intergenic
1166984147 19:46649582-46649604 CCTGCGCAGGCGCCGCCGCCGGG - Exonic
1167738683 19:51311713-51311735 CCCCCGCCCCCGCCGCCCCCCGG + Intergenic
1167862796 19:52298488-52298510 TACACGCGCGCGCTGACGCCCGG - Intronic
1168272732 19:55258769-55258791 CCCACGCAGGCGCCTCAGCCGGG + Exonic
1168339435 19:55614901-55614923 CCCACGCGGGGGCGGGCGCCGGG + Exonic
927720096 2:25376952-25376974 CCCAGCCGCGCGCCGCAGCCGGG - Intergenic
927836354 2:26402135-26402157 CCCCCGCGCTCACCGCCTCCGGG - Exonic
927844413 2:26464023-26464045 CCCCCGCGCAGGCTGCCGCCTGG - Exonic
927966892 2:27275879-27275901 CCCCCGCCCCCGCCCCCGCCAGG + Intronic
928042327 2:27890743-27890765 CCTGCGCGCGCGCCGCGGGCAGG - Exonic
929033876 2:37672524-37672546 CCACCGCCAGCGCCGCCGCCCGG + Intronic
931649455 2:64454680-64454702 CCCACGCGCCGGGCGCCGGCCGG - Intronic
932180719 2:69643754-69643776 CCCCCGCGCGCGCTCCCGCCCGG + Intronic
932699978 2:73985403-73985425 GCCGCGCGCGCGCCGCCGCTCGG - Intergenic
934678461 2:96266044-96266066 CCCCCGCGCGCGTCACAGCCTGG + Intergenic
934738525 2:96702705-96702727 CACACGTGCGCTCCGCCGCCAGG - Intergenic
935149037 2:100417420-100417442 CCGACCCGCGCGGCGCCCCCAGG - Exonic
936433267 2:112482241-112482263 CCCGGGCGCCCGCCGCGGCCCGG - Exonic
938639813 2:133266674-133266696 GCCACGCGCTCACCGCAGCCCGG + Intronic
939990924 2:148876042-148876064 CCCACGCTCGCCTCGCCGCGTGG + Intronic
942450949 2:176107745-176107767 CCCGCCCGCGGGCCGCCGGCCGG + Exonic
943185189 2:184598376-184598398 CCCCCGCCCACCCCGCCGCCGGG - Exonic
943342134 2:186694111-186694133 CCCTGGCGCCCGCCGCCGCCCGG + Exonic
943669865 2:190649089-190649111 GCCGCCCGCGCGCCGCAGCCTGG + Intronic
947669143 2:231925785-231925807 CCCACGCGCCCGCCGGCGCGGGG + Intronic
947754319 2:232550790-232550812 CCCCCGCGCCCGCCCCCGCTGGG + Intronic
948207371 2:236169267-236169289 CTCACCCTGGCGCCGCCGCCCGG + Intergenic
1168753094 20:297645-297667 CCCCCGCGCGGCCCGCGGCCCGG + Exonic
1169164121 20:3407692-3407714 CCCCCGCCCCCGCCCCCGCCGGG - Intergenic
1169191458 20:3661137-3661159 TCCCCGCGCCCGCTGCCGCCGGG - Exonic
1171010355 20:21506048-21506070 CCCGCGCGGCCGACGCCGCCAGG + Intergenic
1171175894 20:23050497-23050519 CCCACGCGCCCGCCCCTACCCGG - Intergenic
1172367907 20:34363723-34363745 CCCGCGCCGGCCCCGCCGCCGGG - Intronic
1173454174 20:43190041-43190063 CTCACGCGCACGCCCGCGCCTGG + Intergenic
1173672861 20:44810267-44810289 TCCATGCCCGCGCCGGCGCCGGG + Exonic
1174386618 20:50191347-50191369 CCCCCGCGCCCGCCTCCTCCGGG + Exonic
1174386696 20:50191610-50191632 GCCATGCCTGCGCCGCCGCCCGG - Exonic
1175429127 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG + Intronic
1176016621 20:62937399-62937421 CCCTGCCCCGCGCCGCCGCCGGG + Intronic
1176143205 20:63554083-63554105 CCCACCCCCGCCCCGCCCCCGGG + Exonic
1176173628 20:63707660-63707682 GCCAGCCGCGCGCCGCCTCCAGG - Intronic
1176450708 21:6858830-6858852 CCCAGGCGGCCGCCGCCGCCAGG + Intergenic
1176547802 21:8209003-8209025 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1176555694 21:8253205-8253227 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1176555712 21:8253274-8253296 CCTGCGCCCGCGCCGCCGTCAGG + Intergenic
1176574628 21:8436237-8436259 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1176611241 21:8987529-8987551 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1176828877 21:13723848-13723870 CCCAGGCGGCCGCCGCCGCCAGG + Intergenic
1178535109 21:33404020-33404042 CCCACCCGCGCGCCCGCGCCGGG + Intronic
1180951935 22:19724388-19724410 CCCGCGCTCGCGCCGCAGCCCGG + Exonic
1181094383 22:20495709-20495731 CCCCCGCGTTCGCTGCCGCCCGG + Intronic
1182464421 22:30505647-30505669 TCCGCCCGCCCGCCGCCGCCTGG + Exonic
1182804456 22:33058391-33058413 CGCGCGCGAGCGCCCCCGCCCGG + Intergenic
1183683771 22:39350210-39350232 CCCGCCGCCGCGCCGCCGCCGGG - Intronic
1183788385 22:40045144-40045166 CCCACGCGCGCTCCCTCGCGAGG - Intronic
1184086898 22:42270692-42270714 CCCGCCCGCGCGCCGCGGCCCGG - Intronic
1184523109 22:45007439-45007461 CGCCCCCGCGCGCCCCCGCCCGG - Intronic
1203252676 22_KI270733v1_random:125288-125310 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1203260732 22_KI270733v1_random:170374-170396 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950316371 3:12004862-12004884 CTCCCGCGCCCGCAGCCGCCAGG + Exonic
951078536 3:18425255-18425277 CCCGGCCGCCCGCCGCCGCCCGG + Intronic
954778976 3:53045665-53045687 CCCGCGCGCCCGCCGGCGCCCGG + Intronic
955228462 3:57079368-57079390 CCCCCGCGGGCGCCGGAGCCGGG + Intergenic
959539854 3:107525192-107525214 CCCACGCGCTCTGCGCCGCGCGG + Intronic
960120783 3:113947645-113947667 CCCACCGGCGCGCCGCCCGCAGG + Intergenic
963228765 3:142889038-142889060 CTCACGCGCGCACCGCCGCGGGG + Exonic
964622615 3:158732298-158732320 ACCCCGCGGGCGCCGCCACCGGG + Exonic
966866533 3:184261497-184261519 CCCCCGCCCCCGCCCCCGCCCGG - Intronic
968353330 3:198080741-198080763 CCCAAGCCCGCGCTGCCGGCAGG + Intergenic
968661801 4:1801751-1801773 CCCACCCCCGCGCCGCCCCAGGG - Intronic
968691528 4:1992685-1992707 TCCCCGCGAGCGCCGCCTCCTGG + Intronic
969597834 4:8158897-8158919 CCCGCGCCCCCGCTGCCGCCCGG + Intergenic
969714277 4:8860949-8860971 CCCTCGCCCCCGCCCCCGCCCGG - Intronic
969829255 4:9781864-9781886 TCCCCGCGCGCTCCGCAGCCCGG + Exonic
970332833 4:15003040-15003062 CCCGCGATCGTGCCGCCGCCGGG - Exonic
971244008 4:24912665-24912687 CGCACCCGCGCGACCCCGCCAGG - Intronic
972484248 4:39527248-39527270 CCCAGGCTGGCCCCGCCGCCCGG - Intronic
973110385 4:46390295-46390317 CCCAGGCGCCCGACGCCGCCCGG - Intronic
979547128 4:121951431-121951453 CCGAGGCGCGGGCCGCGGCCGGG + Intronic
981920103 4:150078113-150078135 GCGACGCGCGCTCCTCCGCCTGG - Intergenic
985006011 4:185535666-185535688 CCCCCGCGCCCGCCGCGGCCCGG - Intergenic
985129711 4:186726930-186726952 CGCCCGCGCTCGCCGGCGCCCGG - Intergenic
986315480 5:6583651-6583673 CACACTCGCGCACCGCAGCCCGG - Intergenic
990825430 5:59893357-59893379 CCGCCGCCCCCGCCGCCGCCCGG - Exonic
992487590 5:77210877-77210899 CGCCCGCGCCCGCGGCCGCCGGG - Exonic
992549176 5:77845017-77845039 CCCACGCGCGCGCCTCCTCGTGG + Intronic
997361715 5:133299459-133299481 CCCACCTGCCAGCCGCCGCCTGG - Intronic
1001563307 5:172684009-172684031 CCCAGGAGCACGTCGCCGCCGGG - Exonic
1002559475 5:180071776-180071798 CGCGCGCTCCCGCCGCCGCCCGG - Exonic
1002926767 6:1609687-1609709 CCTGCGCCCGCGCCGGCGCCCGG - Intergenic
1004903272 6:20212653-20212675 CGCCAGCGGGCGCCGCCGCCTGG + Intergenic
1006145810 6:31959008-31959030 CCCAGGCGCGCACTTCCGCCCGG + Exonic
1006787878 6:36679995-36680017 CCCCCTGGGGCGCCGCCGCCTGG + Intronic
1010244796 6:73653511-73653533 CCCCCGCCCCCGCCCCCGCCCGG + Intronic
1013242799 6:108261277-108261299 ACCGCGAGCGCGCCGCCGCGGGG + Intergenic
1016010740 6:139135483-139135505 CCGCCGCGCCCGCCGCTGCCAGG - Exonic
1016340920 6:143060816-143060838 CCCGCGCCCGCGCCCGCGCCCGG + Intronic
1017021397 6:150143051-150143073 GCCGCGCGCGCCCAGCCGCCCGG - Intergenic
1018872999 6:167797142-167797164 CCAGCGCGTGCGCCGCGGCCAGG - Intergenic
1018959872 6:168440843-168440865 CCCACGCGCGCGCACCCTCGGGG - Intergenic
1020201219 7:6081538-6081560 CCCACGCGCGCGCCGCAGTTTGG + Intergenic
1021868257 7:24979817-24979839 TCCGAGCCCGCGCCGCCGCCAGG + Intronic
1021890318 7:25180444-25180466 CCCACCCGCGCCCCGCCCCCAGG + Intergenic
1022099642 7:27161521-27161543 CCCACCCCCACCCCGCCGCCAGG - Intergenic
1022942548 7:35254241-35254263 GCCACGCGGGCGCCGCACCCTGG - Intergenic
1024323274 7:48089707-48089729 GCCCCGCGCGCTCCGTCGCCGGG - Intronic
1024520943 7:50304026-50304048 CCCCCGCGCGCACCGCGCCCGGG - Intergenic
1026091223 7:67302450-67302472 CCCACAGGCGCCCCGCCTCCTGG + Intergenic
1026745206 7:73006078-73006100 CCCACAGGCGCCCCGCCTCCTGG - Intergenic
1027031314 7:74890750-74890772 CCCACAGGCGCCCCGCCTCCTGG - Intergenic
1027098536 7:75359018-75359040 CCCACAGGCGCCCCGCCTCCTGG + Intergenic
1029399645 7:100335912-100335934 CCCACAGGCGCCCCGCCTCCTGG + Intergenic
1029496347 7:100897092-100897114 GGCACGCGGGCGCCGCCGCCAGG + Intergenic
1029849356 7:103446154-103446176 TCGACGCGCGCGCTGCCTCCAGG + Exonic
1029896341 7:103989093-103989115 CCTCCGCGCTCGCCGCCGCCGGG - Intronic
1030093336 7:105876700-105876722 CTCGCGCGCCCGCGGCCGCCAGG + Intergenic
1031051980 7:116953858-116953880 CCCCCGCGCGCCCAGCTGCCCGG - Intronic
1032068737 7:128791336-128791358 CCCCGCCGCTCGCCGCCGCCCGG - Intronic
1032344358 7:131105944-131105966 CGCGCGCGCCCGCCGCCGCCCGG - Intergenic
1033390726 7:140924838-140924860 CCTCCGCCCGCGGCGCCGCCCGG - Intergenic
1033660678 7:143399766-143399788 CCCACGCGCGGGCCAGCCCCAGG - Exonic
1034223010 7:149460217-149460239 CCCACGCAGGCCCGGCCGCCCGG + Intronic
1034349036 7:150404889-150404911 CCCAGGGCCGCTCCGCCGCCGGG + Intronic
1034977857 7:155458450-155458472 CCGCCGCCCGAGCCGCCGCCGGG - Exonic
1035153159 7:156892474-156892496 CGCCCCCGCGCTCCGCCGCCAGG - Intronic
1035171227 7:157018380-157018402 CCCACGCGCTCGCCGCAGTCCGG - Intergenic
1036398254 8:8386562-8386584 GGCCCGCGCGCCCCGCCGCCCGG + Intergenic
1037547819 8:19940387-19940409 CCCACGTGCTCGCAGCCGCGCGG - Intronic
1037903824 8:22703763-22703785 CACAGGCGCCCCCCGCCGCCCGG + Intergenic
1038543922 8:28411691-28411713 GCCCCGCGCCGGCCGCCGCCGGG + Intronic
1038727667 8:30095615-30095637 CCCACGCGCGCGCGCGAGCCCGG - Intronic
1039921572 8:41897132-41897154 TCGCCGCGCTCGCCGCCGCCAGG - Intergenic
1039936596 8:42051639-42051661 GCGGCCCGCGCGCCGCCGCCCGG - Intronic
1040471245 8:47737587-47737609 CCCCCGCGCCCGGCCCCGCCCGG - Exonic
1040688760 8:49910020-49910042 CCCCCGCGCGCGCCGCAGGCCGG + Intronic
1042367337 8:67952323-67952345 CCCGCGCGCCCGCTGCTGCCCGG - Exonic
1042399649 8:68331083-68331105 CCCACGCGCGCGTGGCTCCCCGG + Exonic
1044343153 8:91070678-91070700 CCCTACCCCGCGCCGCCGCCGGG + Intronic
1045327297 8:101126684-101126706 CTCCCGGCCGCGCCGCCGCCCGG + Intergenic
1047097419 8:121640047-121640069 CCCACGCACGCCCTGCCTCCGGG + Intronic
1048867300 8:138770362-138770384 CCCACTCGGGCTCCGCCACCTGG + Intronic
1048981727 8:139706033-139706055 CCCCCGCCCGCGCTGCCGCGGGG - Intergenic
1049419550 8:142510766-142510788 CCCGTCCGCCCGCCGCCGCCAGG - Intronic
1049419667 8:142511106-142511128 CCCCCGCCCGCGCCCCTGCCCGG - Intronic
1049470788 8:142774219-142774241 CCCAGGCCCGCGCCGGCCCCAGG + Intronic
1049647080 8:143740294-143740316 GCCCCGCGCGCGCCGCCCTCAGG + Intergenic
1049689899 8:143953836-143953858 CCCAGGCCAGCGCCGCAGCCGGG + Intronic
1049707319 8:144048937-144048959 CCTCCGCCCGCGCCTCCGCCAGG + Intergenic
1049791639 8:144475112-144475134 TCCGCGCGCGCTCCGCCCCCGGG + Intronic
1049843202 8:144787245-144787267 CCCGCGCGCCCGCCCCCGCCGGG + Intronic
1050345288 9:4679882-4679904 CTCACCTGGGCGCCGCCGCCTGG - Exonic
1050472548 9:6008041-6008063 GCCGTGCGCGCGCCGCCGCCGGG - Intergenic
1053003160 9:34589064-34589086 CACACGCGCGCGCGGGCGCGCGG + Intronic
1057146939 9:92764849-92764871 CGCCCGCCCGCGCCGCCGCACGG + Intergenic
1057337343 9:94166314-94166336 CCCTCGCGCCCGTCGCTGCCGGG - Intergenic
1057716695 9:97501643-97501665 CCCGCCCGCCCGCGGCCGCCCGG + Exonic
1060128689 9:121074931-121074953 ACCACGCGCGCGCGGCCCCTCGG + Intronic
1060811475 9:126613397-126613419 CCCGAGCAGGCGCCGCCGCCCGG + Intergenic
1060952327 9:127612205-127612227 CCCCCGCGCGCGCCGGCGGCGGG + Intergenic
1061976096 9:134068531-134068553 CCCGCGCGCGCGCTCCCGCCAGG - Intronic
1062462010 9:136666057-136666079 CCCGCCCGCCCGCCGCCGGCAGG - Intronic
1062499161 9:136844957-136844979 CCCCCACGTGCGCTGCCGCCTGG + Exonic
1062537790 9:137028416-137028438 ACCCTGCGCGCGCCGCCGCCGGG + Intronic
1062556095 9:137114091-137114113 CCCCCGCCCGCGACCCCGCCCGG + Intronic
1062556112 9:137114132-137114154 CCCCCGCCCGCGACCCCGCCCGG + Intronic
1062556129 9:137114173-137114195 CCCCCGCCCGCGACCCCGCCCGG + Intronic
1062621250 9:137423447-137423469 CGCAGCCCCGCGCCGCCGCCTGG + Exonic
1203518474 Un_GL000213v1:25687-25709 CCCAGGCGGCCGCCGCCGCCAGG - Intergenic
1203469079 Un_GL000220v1:108439-108461 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1203476900 Un_GL000220v1:152411-152433 CCGGCGCGCCCGCCCCCGCCCGG - Intergenic
1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG + Intronic
1190304482 X:49074251-49074273 CCCCCGCGCGGGGCGCCGCAGGG + Intronic
1190862716 X:54359001-54359023 CCCGCCCCCTCGCCGCCGCCAGG + Intergenic
1196807990 X:119605757-119605779 TCCTCGCGCTCTCCGCCGCCTGG - Exonic
1198727458 X:139692237-139692259 CTGACCCGCGCGCCGCCGCTGGG + Intronic
1200092946 X:153644278-153644300 CCCCCGCACCCGCCCCCGCCGGG - Intronic