ID: 1160874055

View in Genome Browser
Species Human (GRCh38)
Location 19:1289085-1289107
Sequence CTGGAGTCGCATCCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160874055 Original CRISPR CTGGAGTCGCATCCGGCTGC AGG Intronic
901378829 1:8859269-8859291 CTGGAGTTCCAGCCTGCTGCTGG + Intergenic
901629732 1:10642230-10642252 ATGGAGTCGCTGGCGGCTGCGGG + Intronic
903276544 1:22225715-22225737 CAGGAGTCACATCTGGCTGTAGG + Intergenic
906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG + Intergenic
907425269 1:54375536-54375558 CTGGAGTCACAGTCAGCTGCTGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG + Intronic
923036250 1:230287109-230287131 CTGGAGTCGCCTCCGCCCGCCGG + Intergenic
1075521934 10:123148412-123148434 CTGGAGACGCCACCGGCCGCCGG - Exonic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG + Intronic
1107656419 13:42596365-42596387 CTTGACTGGCATCTGGCTGCTGG - Intronic
1113484613 13:110645151-110645173 TTTGAGTCACAGCCGGCTGCAGG - Intronic
1114549507 14:23524923-23524945 CTGGGGGAGCCTCCGGCTGCAGG - Exonic
1119331835 14:73800655-73800677 CTGGAGTCCTTTCCTGCTGCAGG + Intergenic
1122254568 14:100467418-100467440 CAGGACTCCCACCCGGCTGCAGG + Intronic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1122346476 14:101064203-101064225 CTGGAGAGGGCTCCGGCTGCAGG - Intergenic
1123703832 15:22936573-22936595 CTGGAGCGTCATCAGGCTGCAGG + Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1129456178 15:75677174-75677196 CTGCAGTCCCAGCTGGCTGCAGG - Exonic
1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG + Intronic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132860733 16:2070557-2070579 CGCGAGCAGCATCCGGCTGCAGG + Exonic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG + Intronic
1153006136 18:500333-500355 CTGGGGGCGCACCCGGCTCCCGG - Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161241915 19:3227577-3227599 CTGGAGGTGCACCCGGCTCCTGG + Intronic
1163494694 19:17639490-17639512 CTGGAGTCTCTCCGGGCTGCTGG + Exonic
1163683509 19:18697086-18697108 CTGGACCCCCATCCAGCTGCTGG - Intronic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
1166500727 19:43339178-43339200 CTGGAGTCCCTTCCAACTGCTGG - Intergenic
1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG + Intergenic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
929787177 2:45001343-45001365 CTGGAGCCGCTGCCGGCGGCCGG - Intergenic
942251093 2:174048458-174048480 CGCGAGTGGCAGCCGGCTGCGGG - Intergenic
946689850 2:222301744-222301766 CTGGACTCCCATCCAGCTGCGGG - Intronic
1172023996 20:31935647-31935669 CAGCAGTCACATCCTGCTGCAGG - Intronic
1183164059 22:36134197-36134219 CTGGAATCCCAGCCTGCTGCTGG - Intergenic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
960696554 3:120402059-120402081 CTGGAGTCCCATCTGGGTCCTGG - Intronic
968616270 4:1579132-1579154 CTGGAGGCGCAGCCGCCTCCGGG - Intergenic
986603894 5:9502515-9502537 CTGGAGTCGCTTTCAGCTGTGGG + Intronic
988787585 5:34578976-34578998 CTGGAGTGGCCTGGGGCTGCAGG - Intergenic
1007271575 6:40641367-40641389 CTGGAGTCCCTTCTGGCTGTGGG + Intergenic
1015206739 6:130649202-130649224 CTGCAGTCGGCTCCTGCTGCAGG + Intergenic
1019448401 7:1083226-1083248 CTGAAGGCGCGTGCGGCTGCTGG - Intronic
1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG + Intergenic
1038261974 8:26003499-26003521 CTGGAATCAGATCCGGCTTCAGG + Intronic
1039612743 8:38932401-38932423 CTGGAGTCGGTTCAGGCTTCAGG + Intronic
1049240634 8:141535906-141535928 CTGGTGACGGATCCGCCTGCCGG + Intergenic
1049421181 8:142517350-142517372 CTGGGGTGTCATCCGGGTGCCGG - Intronic
1049676188 8:143890336-143890358 CTGGAGCCGCTCCTGGCTGCTGG - Intergenic
1200921265 Y:8615511-8615533 CTGTAGTCGTGTCCTGCTGCAGG - Intergenic