ID: 1160874435

View in Genome Browser
Species Human (GRCh38)
Location 19:1290610-1290632
Sequence CCCGGTGGCCGTGTGTTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160874425_1160874435 11 Left 1160874425 19:1290576-1290598 CCGGTGGTCTCCTTGTCATCCAT No data
Right 1160874435 19:1290610-1290632 CCCGGTGGCCGTGTGTTCCCCGG No data
1160874430_1160874435 -8 Left 1160874430 19:1290595-1290617 CCATGAGGGTCCTGCCCCGGTGG No data
Right 1160874435 19:1290610-1290632 CCCGGTGGCCGTGTGTTCCCCGG No data
1160874428_1160874435 1 Left 1160874428 19:1290586-1290608 CCTTGTCATCCATGAGGGTCCTG No data
Right 1160874435 19:1290610-1290632 CCCGGTGGCCGTGTGTTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160874435 Original CRISPR CCCGGTGGCCGTGTGTTCCC CGG Intronic