ID: 1160877833

View in Genome Browser
Species Human (GRCh38)
Location 19:1305438-1305460
Sequence AGCTACTCGGGAGGCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109344
Summary {0: 5, 1: 210, 2: 7956, 3: 41130, 4: 60043}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160877823_1160877833 7 Left 1160877823 19:1305408-1305430 CCAGGCATGCTGGCACGCACCTC No data
Right 1160877833 19:1305438-1305460 AGCTACTCGGGAGGCCCAGGGGG 0: 5
1: 210
2: 7956
3: 41130
4: 60043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160877833 Original CRISPR AGCTACTCGGGAGGCCCAGG GGG Intergenic
Too many off-targets to display for this crispr