ID: 1160879768

View in Genome Browser
Species Human (GRCh38)
Location 19:1314092-1314114
Sequence TTCCCCGCCGTCGGCCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160879768_1160879772 10 Left 1160879768 19:1314092-1314114 CCTTGGGGGCCGACGGCGGGGAA No data
Right 1160879772 19:1314125-1314147 GCTTCCGCAGCTCTCCCCCCAGG No data
1160879768_1160879774 17 Left 1160879768 19:1314092-1314114 CCTTGGGGGCCGACGGCGGGGAA No data
Right 1160879774 19:1314132-1314154 CAGCTCTCCCCCCAGGTCCCTGG No data
1160879768_1160879781 30 Left 1160879768 19:1314092-1314114 CCTTGGGGGCCGACGGCGGGGAA No data
Right 1160879781 19:1314145-1314167 AGGTCCCTGGGACCCTCGCCTGG No data
1160879768_1160879775 18 Left 1160879768 19:1314092-1314114 CCTTGGGGGCCGACGGCGGGGAA No data
Right 1160879775 19:1314133-1314155 AGCTCTCCCCCCAGGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160879768 Original CRISPR TTCCCCGCCGTCGGCCCCCA AGG (reversed) Intergenic